Search Results

Search found 18092 results on 724 pages for 'matt long'.

Page 215/724 | < Previous Page | 211 212 213 214 215 216 217 218 219 220 221 222  | Next Page >

  • Getting zeros between data while reading a binary file in C

    - by indiajoe
    I have a binary data which I am reading into an array of long integers using a C programme. hexdump of the binary data shows, that after first few data points , it starts again at a location 20000 hexa adresses away. hexdump output is as shown below. 0000000 0000 0000 0000 0000 0000 0000 0000 0000 * 0020000 0000 0000 0053 0000 0064 0000 006b 0000 0020010 0066 0000 0068 0000 0066 0000 005d 0000 0020020 0087 0000 0059 0000 0062 0000 0066 0000 ........ and so on... But when I read it into an array 'data' of long integers. by the typical fread command fread(data,sizeof(*data),filelength/sizeof(*data),fd); It is filling up with all zeros in my data array till it reaches the 20000 location. After that it reads in data correctly. Why is it reading regions where my file is not there? Or how will I make it read only my file, not anything inbetween which are not in file? I know it looks like a trivial problem, but I cannot figure it out even after googling one night.. Can anyone suggest me where I am doing it wrong? Other Info : I am working on a gnu/linux machine. (slax-atma distro to be specific) My C compiler is gcc.

    Read the article

  • GSM Cell Towers Location & Triangulation Algorithm (Similar to OpenCellID / Skyhook / Google's MyLocation)

    - by ranabra
    Hi all, assuming I have a Fingerprint DB of Cell towers. The data (including Long. & Lat. CellID, signal strength, etc) is achieved by 'wardriving', similar to OpenCellID.org. I would like to be able to get the location of the client mobile phone without GPS (similar to OpenCellID / Skyhook Wireless/ Google's 'MyLocation'), which sends me info on the Cell towers it "sees" at the moment: the Cell tower connected to, and another 6 neighboring cell towers (assuming GSM). I have read and Googled it for a long time and came across several effective theories, such as using SQL 2008 Spatial capabilities, or using an euclidean algorithm, or Markov Model. However, I am lacking a practical solution, preferably in C# or using SQL 2008 :) The location calculation will be done on the server and not on the client mobile phone. the phone's single job is to send via HTTP/GPRS, the tower it's connected to and other neighboring cell towers. Any input is appreciated, I have read so much and so far haven't really advanced much. Thanx

    Read the article

  • How to interrupt a thread performing a blocking socket connect?

    - by Jason R
    I have some code that spawns a pthread that attempts to maintain a socket connection to a remote host. If the connection is ever lost, it attempts to reconnect using a blocking connect() call on its socket. Since the code runs in a separate thread, I don't really care about the fact that it uses the synchronous socket API. That is, until it comes time for my application to exit. I would like to perform some semblance of an orderly shutdown, so I use thread synchronization primitives to wake up the thread and signal for it to exit, then perform a pthread_join() on the thread to wait for it to complete. This works great, unless the thread is in the middle of a connect() call when I command the shutdown. In that case, I have to wait for the connect to time out, which could be a long time. This makes the application appear to take a long time to shut down. What I would like to do is to interrupt the call to connect() in some way. After the call returns, the thread will notice my exit signal and shut down cleanly. Since connect() is a system call, I thought that I might be able to intentionally interrupt it using a signal (thus making the call return EINTR), but I'm not sure if this is a robust method in a POSIX threads environment. Does anyone have any recommendations on how to do this, either using signals or via some other method? As a note, the connect() call is down in some library code that I cannot modify, so changing to a non-blocking socket is not an option.

    Read the article

  • Unit Testing Private Method in Resource Managing Class (C++)

    - by BillyONeal
    I previously asked this question under another name but deleted it because I didn't explain it very well. Let's say I have a class which manages a file. Let's say that this class treats the file as having a specific file format, and contains methods to perform operations on this file: class Foo { std::wstring fileName_; public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it //Long method to figure out what checksum it is. //Return the checksum. } }; Let's say I'd like to be able to unit test the part of this class that calculates the checksum. Unit testing the parts of the class that load in the file and such is impractical, because to test every part of the getChecksum() method I might need to construct 40 or 50 files! Now lets say I'd like to reuse the checksum method elsewhere in the class. I extract the method so that it now looks like this: class Foo { std::wstring fileName_; static int calculateChecksum(const std::vector<unsigned char> &fileBytes) { //Long method to figure out what checksum it is. } public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it return calculateChecksum( something ); } void modifyThisFileSomehow() { //Perform modification int newChecksum = calculateChecksum( something ); //Apply the newChecksum to the file } }; Now I'd like to unit test the calculateChecksum() method because it's easy to test and complicated, and I don't care about unit testing getChecksum() because it's simple and very difficult to test. But I can't test calculateChecksum() directly because it is private. Does anyone know of a solution to this problem?

    Read the article

  • Google App Engine how to get an object from the servlet ?

    - by Frank
    I have the following class objects in Google App Engine's dadastore, I can see them from the "Datastore Viewer " : import javax.jdo.annotations.IdGeneratorStrategy; import javax.jdo.annotations.IdentityType; import javax.jdo.annotations.PersistenceCapable; import javax.jdo.annotations.Persistent; import javax.jdo.annotations.PrimaryKey; @PersistenceCapable(identityType=IdentityType.APPLICATION) public class Contact_Info_Entry implements Serializable { @PrimaryKey @Persistent(valueStrategy=IdGeneratorStrategy.IDENTITY) Long Id; public static final long serialVersionUID=26362862L; String Contact_Id="",First_Name="",Last_Name="",Company_Name="",Branch_Name="",Address_1="",Address_2="",City="",State="",Zip="",Country=""; double D_1,D_2; boolean B_1,B_2; Vector<String> A_Vector=new Vector<String>(); public Contact_Info_Entry() { } ...... } How can my java applications get the object from a servlet url ? For instance if have an instance of Contact_Info_Entry who's Contact_Id is "ABC-123", and my App Id is : nm-java When my java program accesses the url : "http://nm-java.appspot.com/Check_Contact_Info?Contact_Id=ABC-123 How will the Check_Contact_Info servlet get the object from datastore and return it to my app ? public class Check_Contact_Info_Servlet extends HttpServlet { static boolean Debug=true; public void doGet(HttpServletRequest request,HttpServletResponse response) throws IOException { } ... protected void doPost(HttpServletRequest request,HttpServletResponse response) throws ServletException,IOException { doGet(request,response); } } Frank

    Read the article

  • How to produce 64 bit masks?

    - by egiakoum1984
    Based on the following simple program the bitwise left shit operator works only for 32 bits. Is it true? #include <iostream> #include <stdlib.h> using namespace std; int main(void) { long long currentTrafficTypeValueDec; int input; cout << "Enter input:" << endl; cin >> input; currentTrafficTypeValueDec = 1 << (input - 1); cout << currentTrafficTypeValueDec << endl; cout << (1 << (input - 1)) << endl; return 0; } The output of the program: Enter input: 30 536870912 536870912 Enter input: 62 536870912 536870912 How could I produce 64-bit masks?

    Read the article

  • Remove then Query fails in JPA (deleted entity passed to persist)

    - by nag
    I have two entitys MobeeCustomer and CustomerRegion i want to remove the object from CustomerRegion first Im put join Coloumn in CustomerRegion is null then Remove the Object from the entityManager but Iam getting Exception MobeeCustomer: public class MobeeCustomer implements Serialization{ private Long id; private String custName; private String Address; private String phoneNo; private Set<CustomerRegion> customerRegion = new HashSet<CustomerRegion>(0); @OneToMany(cascade = { CascadeType.PERSIST, CascadeType.REMOVE }, fetch = FetchType.LAZY, mappedBy = "mobeeCustomer") public Set<CustomerRegion> getCustomerRegion() { return CustomerRegion; } public void setCustomerRegion(Set<CustomerRegion> customerRegion) { CustomerRegion = customerRegion; } } CustomerRegion public class CustomerRegion implements Serializable{ private Long id; private String custName; private String description; private String createdBy; private Date createdOn; private String updatedBy; private Date updatedOn; private MobeeCustomer mobeeCustomer; @ManyToOne(fetch = FetchType.LAZY) @JoinColumn(name = "MOBEE_CUSTOMER") public MobeeCustomer getMobeeCustomer() { return mobeeCustomer; } public void setMobeeCustomer(MobeeCustomer mobeeCustomer) { this.mobeeCustomer = mobeeCustomer; } } sample code: for (CustomerRegion region : deletedRegionList) { region.setMobeeCustomer(null); getEntityManager().remove(region); } StackTrace: please suggest me how to remove the CustomerRegion Object I am getting Exception javax.persistence.EntityNotFoundException: deleted entity passed to persist: [com.manam.mobee.persist.entity.CustomerRegion#<null>] 15:46:34,614 ERROR [STDERR] at org.hibernate.ejb.AbstractEntityManagerImpl.throwPersistenceException(AbstractEntityManagerImpl.java:613) 15:46:34,614 ERROR [STDERR] at org.hibernate.ejb.AbstractEntityManagerImpl.flush(AbstractEntityManagerImpl.java:299) 15:46:34,614 ERROR [STDERR] at org.jboss.seam.persistence.EntityManagerProxy.flush(EntityManagerProxy.java:92) 15:46:34,614 ERROR [STDERR] at org.jboss.seam.framework.EntityHome.update(EntityHome.java:64)

    Read the article

  • prevent schemagen from adding the super-class to the schema?

    - by shay
    Hi, how do i prevent schemagen from adding the super-class to the schema? I have tried using XMLTransient on the super-class, and on its fields but they still show up in the schema . for example : @XmlTransient public class Asset { @XmlTransient public Long ID; } public class Movie extends Asset { } creates this schema : <xs:complexType name="asset"> <xs:sequence> <xs:element name="ID" type="xs:long" minOccurs="0"/> </xs:sequence> </xs:complexType> <xs:complexType name="movie"> <xs:complexContent> <xs:extension base="asset"> <xs:sequence/> </xs:extension> </xs:complexContent> </xs:complexType> the schema that i would like to see is : <xs:complexType name="movie"> <xs:complexContent> <xs:sequence/> </xs:extension> </xs:complexContent> </xs:complexType>

    Read the article

  • JPA 2.0 Provider Hibernate

    - by Rooh
    I have very strange problem we are using jpa 2.0 with hibernate annotations based Database generated through JPA DDL is true and MySQL as Database; i will provide some reference classes and then my porblem. @MappedSuperclass public abstract class Common implements serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; @ManyToOne @JoinColumn private Address address; //with all getter and setters //as well equal and hashCode } @Entity public class Parent extends Common{ private String name; @OneToMany(cascade = {CascadeType.MERGE,CascadeType.PERSIST}, mappedBy = "parent") private List<Child> child; //setters and rest of class } @Entity public class Child extends Common{ //some properties with getter/setters } @Entity public class Address implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; private String street; //rest of class with get/setter } as in code you can see that parents and child classes extends Common class so both have address property and id , the problem occurs when change the address refference in parent class it reflect same change in all child objects in list and if change address refference in child class then on merge it will change address refference of parent as well i am not able to figure out is it is problem of jpa or hibernate

    Read the article

  • Problems solving oddly acting labels in ie7.

    - by Qwibble
    Okay so this is sort of a double question so I'll split it into two. First part In modern browsers the main bold labels sit above their corresponding form elements, and align to the left as is expected. However in ie7, they randomly site 10-15px inset. I went through the developer tools and could find nothing to fix it. I've made sure all my margins and padding is reset so I don't really understand =S Here's the page demo - link Maybe some of you ie bug fixing genius's know what the problem is? =D Second part Again with labels, this time the in-line ones resident next to the check boxes and radio buttons. In modern browsers again, the side beside the form elements as expected, but not so in ie7 where they take a new line. I've tried floating, changing margins and everything but to no effect in sitting it in-line with the div.checker or div.radio that is created by the uniform Jquery plugin. Here's the page demo - link Sorry for troubling you with my ie7 problems, I know they arent the most fun to solve. Hopefully someone has the patience to help. Matt

    Read the article

  • Hashtable resizing leaks memory

    - by thpetrus
    I wrote a hashtable and it basically consists of these two structures: typedef struct dictEntry { void *key; void *value; struct dictEntry *next; } dictEntry; typedef struct dict { dictEntry **table; unsigned long size; unsigned long items; } dict; dict.table is a multidimensional array, which contains all the stored key/value pair, which again are a linked list. If half of the hashtable is full, I expand it by doubling the size and rehashing it: dict *_dictRehash(dict *d) { int i; dict *_d; dictEntry *dit; _d = dictCreate(d->size * 2); for (i = 0; i < d->size; i++) { for (dit = d->table[i]; dit != NULL; dit = dit->next) { _dictAddRaw(_d, dit); } } /* FIXME memory leak because the old dict can never be freed */ free(d); // seg fault return _d; } The function above uses the pointers from the old hash table and stores it in the newly created one. When freeing the old dict d a Segmentation Fault occurs. How am I able to free the old hashtable struct without having to allocate the memory for the key/value pairs again?

    Read the article

  • wsdl xml parsing , maxlength problem after encoding of text

    - by MichaelD
    We are working together with another firm. our application communicates with the other application through WCF on our side and a custom implemented java wsdl handler on the other side. They specify the wsdl format and one of the rules is that a specific string cannot contain more then 15 characters. (normally it's 60, but i take 15 for easy example reasons) When we try to send the following string to them we get an error that the string is too long according to the wsdl: "example & test" this is a string of 14 characters, so it should be allowed the microsoft wcf parser translates this to "example &amp; test" . This encoded string is 18 characters long. Now what is the standaard behavior to check a maxlength defined in a message? Is it the encoded message or the decoded message? I would think it's the decoded message , but i ain't sure. If it is the encoded message, how should we handle this so we would know how we have to split the string?

    Read the article

  • [hibernate - jpa] @OneToOne annotoation problem (i think...)

    - by blow
    Hi all, im new in hibernate and JPA and i have some problems with annotations. My target is to create this table in db (PERSON_TABLE with personal-details) ID ADDRESS NAME SURNAME MUNICIPALITY_ID First of all, i have a MUNICIPALITY table in db containing all municipality of my country. I mapped this table in this ENTITY: @Entity public class Municipality implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String country; private String province; private String name; @Column(name="cod_catasto") private String codCatastale; private String cap; public Municipality() { } ... Then i make an EMBEDDABLE class Address containing fields that realize a simple address... @Embeddable public class Address implements Serializable { @OneToOne(cascade=CascadeType.ALL) @JoinColumn(name="id_municipality") private Municipality municipality; @Column(length=45) private String address; public Address() { } ... Finally i embedded this class into Person ENTITY @Entity public class Person implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String name; private String surname; @Embedded private Address address; public Person() { } ... All works good when i have to save a new Person record, in fact hibernate creates a PERSON_TABLE as i want, but if i try to retrieve a Person record i have an exception. HQL is simply "from Person" The excpetion is (Entities is the package containing all classes above-mentioned): org.hibernate.AnnotationException: @OneToOne or @ManyToOne on Entities.Person.address.municipality references an unknown entity: Entities.Municipality Is the @OneToOne annotation the problem? Thanks.

    Read the article

  • IF-block brackets: best practice

    - by MasterPeter
    I am preparing a short tutorial for level 1 uni students learning JavaScript basics. The task is to validate a phone number. The number must not contain non-digits and must be 14 digits long or less. The following code excerpt is what I came up with and I would like to make it as readable as possible. if ( //set of rules for invalid phone number phoneNumber.length == 0 //empty || phoneNumber.length > 14 //too long || /\D/.test(phoneNumber) //contains non-digits ) { setMessageText(invalid); } else { setMessageText(valid); } A simple question I can not quite answer myself and would like to hear your opinions on: How to position the surrounding (outermost) brackets? It's hard to see the difference between a normal and a curly bracket. Do you usually put the last ) on the same line as the last condition? Do you keep the first opening ( on a line by itself? Do you wrap each individual sub-condition in brackets too? Do you align horizontally the first ( with the last ), or do you place the last ) in the same column as the if? Do you keep ) { on a separate line or you place the last ) on the same line with the last sub-condition and then place the opening { on a new line? Or do you just put the ) { on the same line as the last sub-condition? Community wiki.

    Read the article

  • Return latitude/longitude based on entered address

    - by Don
    I'm building a php based application for a client to enter in addresses for their customers' buildings. They'd like the ability to view the location on a map (either as individuals or grouped in a city search). What I'm trying to accomplish is a lookup once the address is entered into a form that populates the database, so after they enter in the addresss, city, state, zip (these are all US locations) they could click a "get lat/long info" link/button that would check to make sure the data is complete, then would lookup the address and return the latitude/longitude into the appropriate form fields. Then the form could be submitted to store the info, and I could later just pull the lat/long when plotting on a map. 1) Does this make sense, or would I be better off just doing the lookup when it's time to plot it? 2) Does anyone have any pointers to solve this problem? I've seen some of the Google/Yahoo API's but it looks like this is more based on the plotting a point part. I may be able to modify it to suit my needs, but I'm just trying to cut some research time posting here with the hopes one of you may have a more direct route. I'll RTFM if I have to... Thanks, D.

    Read the article

  • Using shared_ptr to implement RCU (read-copy-update)?

    - by yongsun
    I'm very interested in the user-space RCU (read-copy-update), and trying to simulate one via tr1::shared_ptr, here is the code, while I'm really a newbie in concurrent programming, would some experts help me to review? The basic idea is, reader calls get_reading_copy() to gain the pointer of current protected data (let's say it's generation one, or G1). writer calls get_updating_copy() to gain a copy of the G1 (let's say it's G2), and only one writer is allowed to enter the critical section. After the updating is done, writer calls update() to do a swap, and make the m_data_ptr pointing to data G2. The ongoing readers and the writer now hold the shared_ptr of G1, and either a reader or a writer will eventually deallocate the G1 data. Any new readers would get the pointer to G2, and a new writer would get the copy of G2 (let's say G3). It's possible the G1 is not released yet, so multiple generations of data my co-exists. template <typename T> class rcu_protected { public: typedef T type; typedef std::tr1::shared_ptr<type> rcu_pointer; rcu_protected() : m_data_ptr (new type()) {} rcu_pointer get_reading_copy () { spin_until_eq (m_is_swapping, 0); return m_data_ptr; } rcu_pointer get_updating_copy () { spin_until_eq (m_is_swapping, 0); while (!CAS (m_is_writing, 0, 1)) {/* do sleep for back-off when exceeding maximum retry times */} rcu_pointer new_data_ptr(new type(*m_data_ptr)); // as spin_until_eq does not have memory barrier protection, // we need to place a read barrier to protect the loading of // new_data_ptr not to be re-ordered before its construction _ReadBarrier(); return new_data_ptr; } void update (rcu_pointer new_data_ptr) { while (!CAS (m_is_swapping, 0, 1)) {} m_data_ptr.swap (new_data_ptr); // as spin_until_eq does not have memory barrier protection, // we need to place a write barrier to protect the assignments of // m_is_writing/m_is_swapping be re-ordered bofore the swapping _WriteBarrier(); m_is_writing = 0; m_is_swapping = 0; } private: volatile long m_is_writing; volatile long m_is_swapping; rcu_pointer m_data_ptr; };

    Read the article

  • Using "wildcards" in a vlist array to delete rows in Excel

    - by KMinner
    Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

    Read the article

  • How can I get the type I want?

    - by Danny Chen
    There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • Java object graph -> xml when direction of object association needs to be reversed.

    - by Sigmoidal
    An application I have been working on has objects with a relationship similar to below. In the real application both objects are JPA entities. class Underlying{} class Thing { private Underlying underlying; public Underlying getUnderlying() { return underlying; } public void setUnderlying(final Underlying underlying) { this.underlying = underlying; } } There is a requirement in the application to create xml of the form: <template> <underlying> <thing/> <thing/> <thing/> </underlying> </template> So we have a situation where the object graph expresses the relationship between Thing and Underlying in the opposite direction to how it's expressed in the xml. I expect to use JAXB to create the xml but ideally I don't want to have to create a new object hierarchy to reflect the associations in the xml. Is there any way to create xml of the form required from the entities in their current form (through the use of xml annotations or something)? I don't have any experience using JAXB but from the limited research I've done it doesn't seem like it's possible to reverse the direction of association in any straightforward way. Any help/advice would be greatly appreciated. One other option that has been suggested is to use XLST to transform the xml into the correct format. I have done no research on this topic as yet but I'll add to the question when I have some more info. Thanks, Matt.

    Read the article

  • Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

    - by vIceBerg
    I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 211 212 213 214 215 216 217 218 219 220 221 222  | Next Page >