Search Results

Search found 7217 results on 289 pages for 'nice'.

Page 218/289 | < Previous Page | 214 215 216 217 218 219 220 221 222 223 224 225  | Next Page >

  • Complex string split in Java

    - by c0mrade
    Consider the following String : 5|12345|value1|value2|value3|value4+5|777|value1|value2|value3|value4?5|777|value1|value2|value3|value4+ Here is how I want to split string, split it with + so I get this result : myArray[0] = "5|12345|value1|value2|value3|value4"; myArray[1] = "5|777|value1|value2|value3|value4?5|777|value1|value2|value3|value4"; if string has doesn't contain char "?" split it with "|" and continue to part II, if string does contain "?" split it and for each part split it with "|" and continue to part II. Here is part II : myObject.setAttribute1(newString[0]); ... myObject.setAttribute4(newString[3]); Here what I've got so far : private static String input = "5|12345|value1|value2|value3|value4+5|777|value1|value2|value3|value4?5|777|value1|value2|value3|value4+"; public void mapObject(String input){ String[] myArray = null; if (input.contains("+")) { myArray = input.split("+"); } else { myArray = new String[1]; myArray[0] = input; } for (int i = 0; i < myArray.length; i++) { String[] secondaryArray = null; String[] myObjectAttribute = null; if (myArray[i].contains("?")) { secondaryArray = temporaryString.myArray[i].split("?"); for (String string : secondaryArray) { myObjectAttribute = string.split("\\|"); } } else { myObjectAttribute = myArray[i].toString().split("\\|"); } myObject.setAttribute1(myObjectAttribute[0]); ... myObject.setAttribute4(myObjectAttribute[3]); System.out.println(myObject.toString()); } Problem : When I split myArray, going trough for with myArray[0], everything set up nice as it should. Then comes the myArray[1], its split into two parts then the second part overrides the value of the first(how do I know that?). I've overridden toString() method of myObject, when I finish I print the set values so I know that it overrides it, does anybody know how can I fix this?

    Read the article

  • Using Gdata Calendar API for PHP App to create a calender system with event ownership

    - by linuxlover101
    Hello, I'm working on a PHP app, and I'm trying to find the best way to set up a calendar system. First let me describe the intended function of the system: The application has multiple users who can login simultaneously. Each user should be able to add their own events and display them on their "profile." Also, on another page, the events should be able to be shown all together (from all users) and from each individual users exclusively. Since Google Calendar has a nice calendar-looking interface, I thought I would work with the GData APIs. Originally, I thought this would make things easier. But then it seems that if I want to represent event ownership, either each user would have to have a google account or somehow they all would each have to have a separate calendar. Thus, the application would have to create the calendar (if it does not exist) and be able to edit only their calendar. Two questions: Can I somehow use the GData APIs to accomplish my goal? (Mainly event ownership.) Should I just create my own calendar like application? Thanks!

    Read the article

  • Force full garbage collection when memory occupation goes beyond a certain threshold

    - by Silvio Donnini
    I have a server application that, in rare occasions, can allocate large chunks of memory. It's not a memory leak, as these chunks can be claimed back by the garbage collector by executing a full garbage collection. Normal garbage collection frees amounts of memory that are too small: it is not adequate in this context. The garbage collector executes these full GCs when it deems appropriate, namely when the memory footprint of the application nears the allotted maximum specified with -Xmx. That would be ok, if it wasn't for the fact that these problematic memory allocations come in bursts, and can cause OutOfMemoryErrors due to the fact that the jvm is not able to perform a GC quickly enough to free the required memory. If I manually call System.gc() beforehand, I can prevent this situation. Anyway, I'd prefer not having to monitor my jvm's memory allocation myself (or insert memory management into my application's logic); it would be nice if there was a way to run the virtual machine with a memory threshold, over which full GCs would be executed automatically, in order to release very early the memory I'm going to need. Long story short: I need a way (a command line option?) to configure the jvm in order to release early a good amount of memory (i.e. perform a full GC) when memory occupation reaches a certain threshold, I don't care if this slows my application down every once in a while. All I've found till now are ways to modify the size of the generations, but that's not what I need (at least not directly). I'd appreciate your suggestions, Silvio P.S. I'm working on a way to avoid large allocations, but it could require a long time and meanwhile my app needs a little stability

    Read the article

  • Subsonic 3, SimpleRepository, SQL Server: How to find rows with a null field?

    - by desautelsj
    How ca I use Subsonic's Find<T> method to search for rows with a field containing the "null" value. For the sake of the discussion, let's assume I have a c# class called "Visit" which contains a nullable DateTime field called "SynchronizedOn" and also let's assume that the Subsonic migration has created the corresponding "Visits" table and the "SynchronizedOn" field. If I was to write the SQL query myself, I would write something like: SELECT * FROM Visits WHERE SynchronizedOn IS NULL When I use the following code: var visits = myRepository.Find<Visit>(x => x.SynchronizedOn == null); Subsonic turns it into the following SQL query: SELECT * FROM Visits WHERE SynchronizedOn == null which never returns any rows. I tried the following code but it throws an error: visits = repository.Find<Visit>(x => x.SynchronizedOn.HasValue); I was able to use the following syntax: var query = from v in repository.All<Visit>() where v.SynchronizedOn == null orderby v.CreatedOn select v; visits = query.ToList<Visit>(); but it's not as nice an short as using the Find<T> method. Anyone knows how I can specify the "SynchronizedOn IS NULL" condition in the Find<T> method?

    Read the article

  • IRC Server configuration possibilities

    - by Katai
    I need to know a couple of things, concerning IRC servers that I couldnt directly find out over google (or werent clear enough for me to be sure if it actually works) I'm working at a larger community site, and wanted to deliver an in-page chat. Since it would be a nice feature to let people access it from outside too, over their own clients, I tought implementing an IRC Server would be the best solution (probably dedicated, I'll have to teach myself a couple of things for that) I plan to include a Web-based IRC client over an APE Client / Server. The problem is, I want to strip down the user rights, to disallow many functionalities that IRC would offer: Change of nicknames: The user logs in over the Page login, and I'll automatically create an IRC auth for this user with that password. So basically, he would connect to the IRC client over a button. And after connecting, he shouldnt be able to change his nickname at all Creating channels: I want the possibility to create channels, but not from 'normal' users. Basically, I would prefer to set up basic channels that are public, and if a user really creates an own channel, that one should be private and via invitation (is that possible?) Private conversations: private conversations should be filtered out from the allaround IRC client, into separate 'in-browser-windows' that I create over JS. I guess I just have to filter the stuff coming from IRC - or is there a better solution to that? Only 'registered' users have access: Like I said, if someone registers on the page, I would like to create an IRC 'account' for him. Users that arent registered on the page, cant access the IRC server at all (or get thrown out). Mainly to avoid spammers or bots from outside. Is this stuff solvable over IRC? I've read some FAQ's and Instructions for IRC OP's and servers, but I couldnt find a clear answer - it seems that everyone can do pretty much everything - I would like to configure it in a way that user possibilities are more cut down. Basically, giving users the possibility to chat, but not more. So the Question basically is, how possible / solvable this issues are allaround, or if I have to find other solutions for this.

    Read the article

  • P6 Architecture - Register renaming aside, does the limited user registers result in more ops spent

    - by mrjoltcola
    I'm studying JIT design with regard to dynamic languages VM implementation. I haven't done much Assembly since the 8086/8088 days, just a little here or there, so be nice if I'm out of sorts. As I understand it, the x86 (IA-32) architecture still has the same basic limited register set today that it always did, but the internal register count has grown tremendously, but these internal registers are not generally available and are used with register renaming to achieve parallel pipelining of code that otherwise could not be parallelizable. I understand this optimization pretty well, but my feeling is, while these optimizations help in overall throughput and for parallel algorithms, the limited register set we are still stuck with results in more register spilling overhead such that if x86 had double, or quadruple the registers available to us, there may be significantly less push/pop opcodes in a typical instruction stream? Or are there other processor optmizations that also optimize this away that I am unaware of? Basically if I've a unit of code that has 4 registers to work with for integer work, but my unit has a dozen variables, I've got potentially a push/pop for every 2 or so instructions. Any references to studies, or better yet, personal experiences?

    Read the article

  • Using Directives, Namespace and Assembly Reference - all jumbled up with StyleCop!

    - by Jack
    I like to adhere to StyleCop's formatting rules to make code nice and clear, but I've recently had a problem with one of its warnings: All using directives must be placed inside of the namespace. My problem is that I have using directives, an assembly reference (for mocking file deletion), and a namespace to juggle in one of my test classes: using System; using System.IO; using Microsoft.Moles.Framework; using Microsoft.VisualStudio.TestTools.UnitTesting; [assembly: MoledType(typeof(System.IO.File))] namespace MyNamespace { //Some Code } The above allows tests to be run fine - but StyleCop complains about the using directives not being inside the namespace. Putting the usings inside the namespace gives the error that "MoledType" is not recognised. Putting both the usings and the assembly reference inside the namespace gives the error 'assembly' is not a valid attribute location for this declaration. Valid attribute locations for this declaration are 'type'. All attributes in this block will be ignored. It seems I've tried every layout I can but to no avail - either the solution won't build, the mocking won't work or StyleCop complains! Does anyone know a way to set these out so that everything's happy? Or am I going to have to ignore the StyleCop warning in this case?

    Read the article

  • Can Django admin handle a one-to-many relationship via related_name?

    - by Mat
    The Django admin happily supports many-to-one and many-to-many relationships through an HTML <SELECT> form field, allowing selection of one or many options respectively. There's even a nice Javascript filter_horizontal widget to help. I'm trying to do the same from the one-to-many side through related_name. I don't see how it's much different from many-to-many as far as displaying it in the form is concerned, I just need a multi-select SELECT list. But I cannot simply add the related_name value to my ModelAdmin-derived field list. Does Django support one-to-many fields in this way? My Django model something like this (contrived to simplify the example): class Person(models.Model): ... manager = models.ForeignKey('self', related_name='staff', null=True, blank=True, ) From the Person admin page, I can easily get a <SELECT> list showing all possible staff to choose this person's manager from. I also want to display a multiple-selection <SELECT> list of all the manager's staff. I don't want to use inlines, as I don't want to edit the subordinates details; I do want to be able to add/remove people from the list. (I'm trying to use django-ajax-selects to replace the SELECT widget, but that's by-the-by.)

    Read the article

  • hg archive to Remote Directory

    - by Brett Daniel
    Is there any way to archive a Mercurial repository to a remote directory over SSH? For example, it would be nice if one could do the following: hg archive ssh://[email protected]/path/to/archive However, that does not appear to work. It instead creates a directory called ssh: in the current directory. I made the following quick-and-dirty script that emulates the desired behavior by creating a temporary ZIP archive, copying it over SSH, and unzipping the destination directory. However, I would like to know if there is a better way. if [[ $# != 1 ]]; then echo "Usage: $0 [user@]hostname:remote_dir" exit fi arg=$1 arg=${arg%/} # remove trailing slash host=${arg%%:*} remote_dir=${arg##*:} # zip named to match lowest directory in $remote_dir zip=${remote_dir##*/}.zip # root of archive will match zip name hg archive -t zip $zip # make $remote_dir if it doesn't exist ssh $host mkdir --parents $remote_dir # copy zip over ssh into destination scp $zip $host:$remote_dir # unzip into containing directory (will prompt for overwrite) ssh $host unzip $remote_dir/$zip -d $remote_dir/.. # clean up zips ssh $host rm $remote_dir/$zip rm $zip Edit: clone-and-push would be ideal, but unfortunately the remote server does not have Mercurial installed.

    Read the article

  • Scaling Literate Programming?

    - by Tetha
    Greetings. I have been looking at Literate Programming a bit now, and I do like the idea behind it: you basically write a little paper about your code and write down as much of the design decisions, the code probably surrounding the module, the inner workins of the module, assumptions and conclusions resulting from the design decisions, potential extension, all this can be written down in a nice way using tex. Granted, the first point: it is documentation. It must be kept up-to-date, but that should not be that bad, because your change should have a justification and you can write that down. However, how does Literate Programming Scale to a larger degree? Overall, Literate Programming is still just text. Very human readable text, of course, but still text, and thus, it is hard to follow large systems. For example, I reworked large parts of my compiler to use and some magic to chain compile steps together, because some "x.register_follower(y); y.register_follower(z); y.register_follower(a);..." got really unwieldy, and changing that to x y z a made it a bit better, even though this is at its breaking point, too. So, how does Literate Programming scale to larger systems? Does anyone try to do that? My thought would be to use LP to specify components that communicate with each other using event streams and chain all of these together using a subset of graphviz. This would be a fairly natural extension to LP, as you can extract a documentation -- a dataflow diagram -- from the net and also generate code from it really well. What do you think of it? -- Tetha.

    Read the article

  • CentOS - Convert Each WAV File to MP3/OGG

    - by Benny
    I am trying to build a script (I'm pretty new to linux scripting) and I can't seem to figure out why I'm not able to run this script. If I keep the header (#!/bin/sh) in, I get the following: -bash: /tmp/ConvertAndUpdate.sh: /bin/sh^M: bad interpreter: No such file or directory If I take it out, I get the following: 'tmp/ConvertAndUpdate.sh: line 2: syntax error near unexpected token `do 'tmp/ConvertAndUpdate.sh: line 2: `do Any ideas? Here is the full script: #!/bin/sh for file in *.wav; do mp3=$(basename .$file. .wav).mp3; #echo $mp3 nice lame -b 16 -m m -q 9 .resample 8 .$file. .$mp3.; touch .reference .$file. .$mp3.; chown apache.apache .$mp3.; chmod 600 .$mp3.; rm -f .$file.; mv .$file. /converted; sql="UPDATE recordings SET IsReady=1 WHERE Filename='${file%.*}'" echo $sql | mysql --user=me --password=pasword Recordings #echo $sql done

    Read the article

  • Job Opportunities

    - by James
    I have a few questions about my job opportunities and I appreaciate it if people could give me some feedback on what I should have in front of me. I am graduatating from a University of Wisconsin--La Crosse this December with a degree in CS and a math minor. I have a cumulative GPA of 3.84 and a major GPA of 4.0 right now (though I still have many classes in front of me). I already have a degree from the U of Minnesota (History, 3.69 GPA) and have worked in the business world for 3+ years (working for a small company in the baseball world, doing some computer programming, statistical research, operations work, technical writing, etc.) I know Java and C well, also am comfortable with Perl. I should have a good grasp of SQL by graduation. I am looking to get a nice programming job (and will be open to moving). Anyone have any advice on things I should learn etc? Also, I would like to know what everyone thinks about my chances of landing a decent job (I realize that is subjective). Also, any ideas on salary I should be looking for (say I am working a metropolitan area). Thanks.

    Read the article

  • Metamorphs Messing Up CSS in Ember.js Views

    - by Austin Fatheree
    I'm using Ember.js / handlebars to loop through a collection and spit out some items that I'd like bootstrap to handle nice and responsive like. Here is the issue: The bootstrap-responsive css has some declrations in it like: .row-fluid > [class*="span"]:first-child { margin-left: 0; } and .row-fluid:before, .row-fluid:after { display: table; content: ""; } These rules seem to target the first children. When I loop through my collection in handlebars I end up with a bunch of metamorph code around my items: <div class="row-fluid"> {{#each restaurantList}} {{view GS.vHomePageRestList content=this class="span6"}} {{/each}} </div> Here is what is produced: <div class="row-fluid"> <script id="metamorph-9-start" type="text/x-placeholder"></script> <script id="metamorph-104-start" type="text/x-placeholder"></script> <div id="ember2527" class="ember-view span6"> My View </div> <script id="metamorph-104-end" type="text/x-placeholder"></script> <script id="metamorph-105-start" type="text/x-placeholder"></script> <div id="ember2574" class="ember-view span6"> My View 2 </div> <script id="metamorph-105-end" type="text/x-placeholder"></script> <script id="metamorph-9-end" type="text/x-placeholder"></script> </div> So my question is this: 1. How can I tell css to ignore script tags? or 2. How can I edit the css bindings so that they skip over script tags when selecting the first or first child? or 3. How can I structure this so that Ember uses fewer/no metamorph tags? Here is a fiddle: http://jsfiddle.net/skilesare/SgwsJ/

    Read the article

  • Matplotlib canvas drawing

    - by Morgoth
    Let's say I define a few functions to do certain matplotlib actions, such as def dostuff(ax): ax.scatter([0.],[0.]) Now if I launch ipython, I can load these functions and start a new figure: In [1]: import matplotlib.pyplot as mpl In [2]: fig = mpl.figure() In [3]: ax = fig.add_subplot(1,1,1) In [4]: run functions # run the file with the above defined function If I now call dostuff, then the figure does not refresh: In [6]: dostuff(ax) I have to then explicitly run: In [7]: fig.canvas.draw() To get the canvas to draw. Now I can modify dostuff to be def dostuff(ax): ax.scatter([0.],[0.]) ax.get_figure().canvas.draw() This re-draws the canvas automatically. But now, say that I have the following code: def dostuff1(ax): ax.scatter([0.],[0.]) ax.get_figure().canvas.draw() def dostuff2(ax): ax.scatter([1.],[1.]) ax.get_figure().canvas.draw() def doboth(ax): dostuff1(ax) dostuff2(ax) ax.get_figure().canvas.draw() I can call each of these functions, and the canvas will be redrawn, but in the case of doboth(), it will get redrawn multiple times. My question is: how could I code this, such that the canvas.draw() only gets called once? In the above example it won't change much, but in more complex cases with tens of functions that can be called individually or grouped, the repeated drawing is much more obvious, and it would be nice to be able to avoid it. I thought of using decorators, but it doesn't look as though it would be simple. Any ideas?

    Read the article

  • How to draw line inside a scatter plot

    - by ruffy
    I can't believe that this is so complicated but I tried and googled for a while now. I just want to analyse my scatter plot with a few graphical features. For starters, I want to add simply a line. So, I have a few (4) points and like in this plot [1] I want to add a line to it. http://en.wikipedia.org/wiki/File:ROC_space-2.png [1] Now, this won't work. And frankly, the documentation-examples-gallery combo and content of matplotlib is a bad source for information. My code is based upon a simple scatter plot from the gallery: # definitions for the axes left, width = 0.1, 0.85 #0.65 bottom, height = 0.1, 0.85 #0.65 bottom_h = left_h = left+width+0.02 rect_scatter = [left, bottom, width, height] # start with a rectangular Figure fig = plt.figure(1, figsize=(8,8)) axScatter = plt.axes(rect_scatter) # the scatter plot: p1 = axScatter.scatter(x[0], y[0], c='blue', s = 70) p2 = axScatter.scatter(x[1], y[1], c='green', s = 70) p3 = axScatter.scatter(x[2], y[2], c='red', s = 70) p4 = axScatter.scatter(x[3], y[3], c='yellow', s = 70) p5 = axScatter.plot([1,2,3], "r--") plt.legend([p1, p2, p3, p4, p5], [names[0], names[1], names[2], names[3], "Random guess"], loc = 2) # now determine nice limits by hand: binwidth = 0.25 xymax = np.max( [np.max(np.fabs(x)), np.max(np.fabs(y))] ) lim = ( int(xymax/binwidth) + 1) * binwidth axScatter.set_xlim( (-lim, lim) ) axScatter.set_ylim( (-lim, lim) ) xText = axScatter.set_xlabel('FPR / Specificity') yText = axScatter.set_ylabel('TPR / Sensitivity') bins = np.arange(-lim, lim + binwidth, binwidth) plt.show() Everything works, except the p5 which is a line. Now how is this supposed to work? What's good practice here?

    Read the article

  • Setting Access-Control-Allow-Origin in Dreamhost possible?

    - by Kaushik Gopal
    Just wanted a confirmation for this: Firefox currently doesn't play well for picking custom fonts through a sub-domain via the font-face tag. Other browsers do this without any problems. A little research showed up saying that i am required to set the Access-Control-Allow-Origin as is shown in the link here: http://pastie.org/653265 Essentially i have my blog at kaushikgopal.com/blog and i was trying to access fonts that within this blog that are available at font.kaushikgopal.com. I tried changing the same in my .htaccess file but couldn't resolve the issue.(I placed a .htaccess file within the font sub-domain folder and directly pasted code from the above pastie link). I submitted a ticket to dreamhost asking for assistance and they were helpful in clearly stating "We do not support Access-Control-Allow-Origin on shared hosting servers". So i didn't go the sub-domain route for fonts. But i'm a little curious, has anyone tried this (with a dreamhost hosting account would be helpful)? Just want to confirm what the tech-support guy suggested is accurate and there's no other way. Thanks. Another nice link clearly stating the problem : http://www.stevesouders.com/tests/font-face/xdomain.php

    Read the article

  • Link Maven OSGi to Maven NetBeans Platform Project

    - by mxro
    I am using NetBeans 6.9 Beta and I would like to accomplish the following: Set up a project representing the main application using Maven (for instance "Maven Project", "Maven NetBeans Application") Ideally, the project should only contain the necessary libraries to run in Apache Felix (I would like to be able to right-click the project and select "Run in Felix") I do not want that the project contains all the NetBean Platform APIs I would prefer to implement the modules using OSGi. For instance "Maven OSGi Bundle", "Maven NetBeans Module" + OSGi These are the problems, which I have at the moment: The standard Maven archetype ("Maven NetBeans Application") seems always to select all APIs and I have not found a way to deselect APIs - in normal NetBeans Platform Applications that can be accomplished by going to the project properties and deselected the platform modules) - I guess it has something to do with the NetBeans repository (http://bits.netbeans.org/maven2)? Do I have to create another repository? When creating normal "NetBeans Module" with OSGi support, the modules contain both NetBeans Module and OSGi meta data, which is nice. But the "Maven NetBeans Modules" have only NetBeans meta data and the Maven OSGi Bundles have only OSGi meta data). I figured out how to add modules to the project by using project / new and then placing the modules in the Maven project folder. However, I do not quite know yet how I could link to modules from other locations (NetBeans uses Maven modules, which have to be in the same directory as the project?). Below some useful links for Maven + OSGi in NetBeans wiki.netbeans.org/STS_69_Maven_OSGI NetBeans Maven OSGi Test Specification platform.netbeans.org/tutorials/nbm-maven-quickstart.html NetBeans Platform Quick Start Using Maven (6.9) wiki.netbeans.org/MavenBestPractices NetBeans Maven BestPractices maven.apache.org/pom.html#Aggregation Maven Documentation Multi-Module Projects (sorry about the missing protocol but couldn't post the message otherwise)

    Read the article

  • Variant datatype library for C

    - by Joey Adams
    Is there a decent open-source C library for storing and manipulating dynamically-typed variables (a.k.a. variants)? I'm primarily interested in atomic values (int8, int16, int32, uint, strings, blobs, etc.), while JSON-style arrays and objects as well as custom objects would also be nice. A major case where such a library would be useful is in working with SQL databases. The most obvious feature of such a library would be a single type for all supported values, e.g.: struct Variant { enum Type type; union { int8_t int8_; int16_t int16_; // ... }; }; Other features might include converting Variant objects to/from C structures (using a binding table), converting values to/from strings, and integration with an existing database library such as SQLite. Note: I do not believe this is question is a duplicate of http://stackoverflow.com/questions/649649/any-library-for-generic-datatypes-in-c , which refers to "queues, trees, maps, lists". What I'm talking about focuses more on making working with SQL databases roughly as smooth as working with them in interpreted languages.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • rails, mysql charsets & encoding: binary

    - by Benjamin Vetter
    Hi, i've a rails app that runs using utf-8. It uses a mysql database, all tables with mysql's default charset and collation (i.e. latin1). Therefore the latin1 tables contain utf-8 data. Sure, that's not nice, but i'm not really interested in it. Everything works fine, because the connection encoding is latin1 as well and therefore mysql does not convert between charsets. Only one problem: i need a utf-8 fulltext index for one table: mysql> show create table autocompletephrases; ... AUTO_INCREMENT=310095 DEFAULT CHARSET=utf8 COLLATE=utf8_unicode_ci But: I don't want to convert between charsets in my rails app. Therefore I would like to know if i could just set config/database.yml production: adapter: mysql >>>> encoding: binary ... which just calls SET NAMES 'binary' when connecting to mySQL. It looks like it works for my case, because i guess it forces mysql to -not- convert between charsets (mySQL docs). Does anyone knows about problems about doing this? Any side-effects? Or do you have any other suggestions? But i'd like to avoid converting my whole database to utf-8. Many Thanks! Benjamin

    Read the article

  • MSMQ on Win2008 R2 won’t receive messages from older clients

    - by Graffen
    Hi all I'm battling a really weird problem here. I have a Windows 2008 R2 server with Message Queueing installed. On another machine, running Windows 2003 is a service that is set up to send messages to a public queue on the 2008 server. However, messages never show up on the server. I've written a small console app that just sends a "Hello World" message to a test queue on the 2008 machine. Running this app on XP or 2003 results in absolutely nothing. However, when I try running the app on my Windows 7 machine, a message is delivered just fine. I've been through all sorts of security settings, disabled firewalls on all machines etc. The event log shows nothing of interest, and no exceptions are being thrown on the clients. Running a packet sniffer (WireShark) on the server reveals only a little. When trying to send a message from XP or 2003 I only see an ICMP error "Port Unreachable" on port 3527 (which I gather is an MQPing packet?). After that, silence. Wireshark shows a nice little stream of packets when I try from my Win7 client (as expected - messages get delivered just fine from Win7). I've enabled MSMQ End2End logging on the server, but only entries from the messages sent from my Win7 machine are appearing in the log. So somehow it seems that messages are being dropped silently somewhere along the route from XP or 2003 to my 2008 server. Does anyone have any clues as to what might be causing this mysterious behaviour? -- Jesper

    Read the article

  • Scrolling screen upward to expose TextView above keyboard

    - by Matt Winters
    I think I'm missing something obvious and would appreciate an answer. I have a view with a 2-section grouped tableView, each section having one row and a textView, the heights of the rows 335 and 140. This allows for a box with nicely rounded corners to type text into when the keyboard appears (140 height section) and when the keyboard is dismissed, a nice box to read more text (notes); most of the time, use is without the keyboard. I also added a toolbar at the bottom of the screen to scroll up above the keyboard. A button on the toolbar dismisses the keyboard. This last part works fine with the keyboard going up and down using a notification and the following code in a keyboardWillShow method: [UIView beginAnimations:@"showKeyboardAnimation" context:nil]; [UIView setAnimationDuration:0.50]; self.view.frame = CGRectMake(self.view.frame.origin.x, self.view.frame.origin.y, self.view.frame.size.width, self.view.frame.size.height - 216); [UIView commitAnimations]; But with the above code, the 2 sections of the tableView remain unscrolled, only the toolbar and the keyboard move. With the following code (found both in previous posts), both the toolbar and the tableView sections move. [UIView beginAnimations:nil context:NULL]; [UIView setAnimationDuration:0.50]; CGRect rect = self.view.frame; rect.origin.y -= 216; self.view.frame = rect; [UIView commitAnimations]; Now I know that I have to tweak the numbers to get the everything as I want it but my first question is what is substantively different between the 2 sets of code that the sections move in the 2nd but not in the 1st? The toolbar also moves with the 2nd code. The second question is, am I going to be able to scroll the smaller height section from off the screen to above the keyboard while at the same time moving the toolbar up just 216? Thanks

    Read the article

  • Why would javascript click-areas not be working in IE8?

    - by Edward Tanguay
    I'm trying to find a bug in an old ASP.NET application which causes IE8 to not be able to click on the following "button" area in our application: <td width="150px" class="ctl00_CP1_UiCommandManager1i toolBarItem" valign="middle" onmouseout="onMouseOverCommand(this,1,'ctl00_CP1_UiCommandManager1',0,0);" onmouseover="onMouseOverCommand(this,0,'ctl00_CP1_UiCommandManager1',0,0);" onmousedown="onMouseDownCommand(this, 'ctl00_CP1_UiCommandManager1', 0, 0);" onmouseup="onMouseUpCommand(this, 'ctl00_CP1_UiCommandManager1', 0, 0);" id="ctl00_CP1_UiCommandManager1_0_0"> <span style="width:100%;overflow:hidden;text-overflow:ellipsis;vertical-align:middle;white-space:nowrap;"> NEW </span> </td> When we switch IE8 to IE7 compatibility mode, the problem disappears, IE7 is able to click on it. Since the above HTML is generated by a third party control (Janus, http://www.janusys.com/controls), we don't have the source code. has anyone experienced any similar problems with IE8? I've determined that it actually fires the onMouseDownCommand command also the CSS of the button area is different in IE8, it doesn't have color shading that it does in IE7. I can imagine that somewhere the HTML is not valid and IE8 being stricter is not playing along, but where? any advice on how to narrow in on this bug welcome ANSWER: Turned out to be that the application was not checking the navigator.agent for "MSIE 8.0" and was thus treating IE8 has a non-Internet-Explorer browser. Thanks Lazarus for the tip, the IE8 Javascript debugger is very nice, like a Firebug for IE, will be using it more!

    Read the article

  • best way to pick a random subset from a collection?

    - by Tom
    I have a set of objects in a Vector from which I'd like to select a random subset (e.g. 100 items coming back; pick 5 randomly). In my first (very hasty) pass I did an extremely simple and perhaps overly clever solution: Vector itemsVector = getItems(); Collections.shuffle(itemsVector); itemsVector.setSize(5); While this has the advantage of being nice and simple, I suspect it's not going to scale very well, i.e. Collections.shuffle() must be O(n) at least. My less clever alternative is Vector itemsVector = getItems(); Random rand = new Random(System.currentTimeMillis()); // would make this static to the class List subsetList = new ArrayList(5); for (int i = 0; i < 5; i++) { // be sure to use Vector.remove() or you may get the same item twice subsetList.add(itemsVector.remove(rand.nextInt(itemsVector.size()))); } Any suggestions on better ways to draw out a random subset from a Collection?

    Read the article

  • SmtpClient.SendAsync - How to ensure my application doesn't finish before callback?

    - by James
    Hi, I need to send emails asychronously through a console application. I need to do some DB updates on the callback but my application is exiting before the callback code gets run! How can I stop this from happening in a nice manner rather than simply guessing how long to wait before exiting. I would imagine the Async calls get placed in some form of thread? Is it possible to check if any are waiting to be called? Sample Code private static void SendCompletedCallback(object sender, AsyncCompletedEventArgs e) { // Get the unique identifier for this asynchronous operation. String token = (string) e.UserState; if (e.Cancelled) { Console.WriteLine("[{0}] Send canceled.", token); } if (e.Error != null) { Console.WriteLine("[{0}] {1}", token, e.Error.ToString()); } else { // update DB Console.WriteLine("Message sent."); } } public static void Main(string[] args) { var users = Repository.GetUsers(); SmtpClient client = new SmtpClient("Host"); client.SendCompleted += new SendCompletedEventHandler(SendCompletedCallback); MailAddress from = new MailAddress("[email protected]", "System", Encoding.UTF8); foreach (var user in users) { MailAddress to = new MailAddress(user.Email); MailMessage message = new MailMessage(from, to); message.Body = "This is a test"; message.BodyEncoding = System.Text.Encoding.UTF8; message.Subject = "test message 1" + someArrows; message.SubjectEncoding = System.Text.Encoding.UTF8; string userState = String.Format("Message for user id {0}", user.ID); client.SendAsync(message, userState); message.Dispose(); } // need to wait here until I have received a callback for each message // otherwise the application will exit }

    Read the article

< Previous Page | 214 215 216 217 218 219 220 221 222 223 224 225  | Next Page >