Search Results

Search found 7217 results on 289 pages for 'd nice'.

Page 219/289 | < Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >

  • Can Django admin handle a one-to-many relationship via related_name?

    - by Mat
    The Django admin happily supports many-to-one and many-to-many relationships through an HTML <SELECT> form field, allowing selection of one or many options respectively. There's even a nice Javascript filter_horizontal widget to help. I'm trying to do the same from the one-to-many side through related_name. I don't see how it's much different from many-to-many as far as displaying it in the form is concerned, I just need a multi-select SELECT list. But I cannot simply add the related_name value to my ModelAdmin-derived field list. Does Django support one-to-many fields in this way? My Django model something like this (contrived to simplify the example): class Person(models.Model): ... manager = models.ForeignKey('self', related_name='staff', null=True, blank=True, ) From the Person admin page, I can easily get a <SELECT> list showing all possible staff to choose this person's manager from. I also want to display a multiple-selection <SELECT> list of all the manager's staff. I don't want to use inlines, as I don't want to edit the subordinates details; I do want to be able to add/remove people from the list. (I'm trying to use django-ajax-selects to replace the SELECT widget, but that's by-the-by.)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Swing data binding frameworks

    - by Ahe
    Hi Almost the same question has been asked a year ago, but the there has been some new development in this area. Selecting a (data binding) framework for swing application seems to be quite difficult. JSR-295 is abandoned, many swing frameworks which provide binding are work-in-progress, abandoned or too heavy for my quite simple app. JGoodies Swing suite is expensive, but luckily its libraries are free. Has anyone any real-world experience of new UFaceKit. It looks promising, but quite immature. I am particularly interested in Swing implementation and documentation. Any insight on UFaceKits development schedule would be appreciated, because I can hold by framework choice for a while. Requirements are not anything fancy, just working binding with a nice API. I also found Mogwai dataBinding, but it seems quite incomplete and requires manual synchronization activation, which makes it useless compared to coarse grained synchronization easily written by hand. Incomplete frameworks include at least Spring RCP and many JSR-296 forks. So, is the JGoodies data binding really the only realistic choice? Or are there any other viable solutions available?

    Read the article

  • Why would javascript click-areas not be working in IE8?

    - by Edward Tanguay
    I'm trying to find a bug in an old ASP.NET application which causes IE8 to not be able to click on the following "button" area in our application: <td width="150px" class="ctl00_CP1_UiCommandManager1i toolBarItem" valign="middle" onmouseout="onMouseOverCommand(this,1,'ctl00_CP1_UiCommandManager1',0,0);" onmouseover="onMouseOverCommand(this,0,'ctl00_CP1_UiCommandManager1',0,0);" onmousedown="onMouseDownCommand(this, 'ctl00_CP1_UiCommandManager1', 0, 0);" onmouseup="onMouseUpCommand(this, 'ctl00_CP1_UiCommandManager1', 0, 0);" id="ctl00_CP1_UiCommandManager1_0_0"> <span style="width:100%;overflow:hidden;text-overflow:ellipsis;vertical-align:middle;white-space:nowrap;"> NEW </span> </td> When we switch IE8 to IE7 compatibility mode, the problem disappears, IE7 is able to click on it. Since the above HTML is generated by a third party control (Janus, http://www.janusys.com/controls), we don't have the source code. has anyone experienced any similar problems with IE8? I've determined that it actually fires the onMouseDownCommand command also the CSS of the button area is different in IE8, it doesn't have color shading that it does in IE7. I can imagine that somewhere the HTML is not valid and IE8 being stricter is not playing along, but where? any advice on how to narrow in on this bug welcome ANSWER: Turned out to be that the application was not checking the navigator.agent for "MSIE 8.0" and was thus treating IE8 has a non-Internet-Explorer browser. Thanks Lazarus for the tip, the IE8 Javascript debugger is very nice, like a Firebug for IE, will be using it more!

    Read the article

  • Job Opportunities

    - by James
    I have a few questions about my job opportunities and I appreaciate it if people could give me some feedback on what I should have in front of me. I am graduatating from a University of Wisconsin--La Crosse this December with a degree in CS and a math minor. I have a cumulative GPA of 3.84 and a major GPA of 4.0 right now (though I still have many classes in front of me). I already have a degree from the U of Minnesota (History, 3.69 GPA) and have worked in the business world for 3+ years (working for a small company in the baseball world, doing some computer programming, statistical research, operations work, technical writing, etc.) I know Java and C well, also am comfortable with Perl. I should have a good grasp of SQL by graduation. I am looking to get a nice programming job (and will be open to moving). Anyone have any advice on things I should learn etc? Also, I would like to know what everyone thinks about my chances of landing a decent job (I realize that is subjective). Also, any ideas on salary I should be looking for (say I am working a metropolitan area). Thanks.

    Read the article

  • LINQ-To-SQL and Mapping Table Deletions

    - by Jake
    I have a many-to-many relationship between two tables, let's say Friends and Foods. If a friend likes a food I stick a row into the FriendsFoods table, like this: ID Friend Food 1 'Tom' 'Pizza' FriendsFoods has a Primary Key 'ID', and two non-null foreign keys 'Friend' and 'Food' to the 'Friends' and 'Foods' tables, respectively. Now suppose I have a Friend tom .NET object corresponding to 'Tom', and Tom no longer likes pizza (what is wrong with him?) FriendsFoods ff = tblFriendsFoods.Where(x => x.Friend.Name == 'Tom' && x.Food.Name == 'Pizza').Single(); tom.FriendsFoods.Remove(ff); pizza.FriendsFoods.Remove(ff); If I try to SubmitChanges() on the DataContext, I get an exception because it attempts to insert a null into the Friend and Food columns in the FriendsFoods table. I'm sure I can put together some kind of convoluted logic to track changes to the FriendsFoods table, intercept SubmitChanges() calls, etc to try and get this to work the way I want, but is there a nice, clean way to remove a Many-To-Many relationship with LINQ-To-SQL?

    Read the article

  • Check if the internet cannot be accessed in Python

    - by Sridhar Ratnakumar
    I have an app that makes a HTTP GET request to a particular URL on the internet. But when the network is down (say, no public wifi - or my ISP is down, or some such thing), I get the following traceback at urllib.urlopen: 70, in get u = urllib2.urlopen(req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 126, in urlopen return _opener.open(url, data, timeout) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 391, in open response = self._open(req, data) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 409, in _open '_open', req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 369, in _call_chain result = func(*args) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 1161, in http_open return self.do_open(httplib.HTTPConnection, req) File "/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib2.py", line 1136, in do_open raise URLError(err) URLError: <urlopen error [Errno 8] nodename nor servname provided, or not known> I want to print a friendly error to the user telling him that his network maybe down instead of this unfriendly "nodename nor servname provided" error message. Sure I can catch URLError, but that would catch every url error, not just the one related to network downtime. I am not a purist, so even an error message like "The server example.com cannot be reached; either the server is indeed having problems or your network connection is down" would be nice. How do I go about selectively catching such errors? (For a start, if DNS resolution fails at urllib.urlopen, that can be reasonably assumed as network inaccessibility? If so, how do I "catch" it in the except block?)

    Read the article

  • Specification Pattern and Boolean Operator Precedence

    - by Anders Nielsen
    In our project, we have implemented the Specification Pattern with boolean operators (see DDD p 274), like so: public abstract class Rule { public Rule and(Rule rule) { return new AndRule(this, rule); } public Rule or(Rule rule) { return new OrRule(this, rule); } public Rule not() { return new NotRule(this); } public abstract boolean isSatisfied(T obj); } class AndRule extends Rule { private Rule one; private Rule two; AndRule(Rule one, Rule two) { this.one = one; this.two = two; } public boolean isSatisfied(T obj) { return one.isSatisfied(obj) && two.isSatisfied(obj); } } class OrRule extends Rule { private Rule one; private Rule two; OrRule(Rule one, Rule two) { this.one = one; this.two = two; } public boolean isSatisfied(T obj) { return one.isSatisfied(obj) || two.isSatisfied(obj); } } class NotRule extends Rule { private Rule rule; NotRule(Rule obj) { this.rule = obj; } public boolean isSatisfied(T obj) { return !rule.isSatisfied(obj); } } Which permits a nice expressiveness of the rules using method-chaining, but it doesn't support the standard operator precedence rules of which can lead to subtle errors. The following rules are not equivalent: Rule<Car> isNiceCar = isRed.and(isConvertible).or(isFerrari); Rule<Car> isNiceCar2 = isFerrari.or(isRed).and(isConvertible); The rule isNiceCar2 is not satisfied if the car is not a convertible, which can be confusing since if they were booleans isRed && isConvertible || isFerrari would be equivalent to isFerrari || isRed && isConvertible I realize that they would be equivalent if we rewrote isNiceCar2 to be isFerrari.or(isRed.and(isConvertible)), but both are syntactically correct. The best solution we can come up with, is to outlaw the method-chaining, and use constructors instead: OR(isFerrari, AND(isConvertible, isRed)) Does anyone have a better suggestion?

    Read the article

  • Spelling correction for data normalization in Java

    - by dareios
    I am looking for a Java library to do some initial spell checking / data normalization on user generated text content, imagine the interests entered in a Facebook profile. This text will be tokenized at some point (before or after spell correction, whatever works better) and some of it used as keys to search for (exact match). It would be nice to cut down misspellings and the like to produce more matches. It would be even better if the correction would perform well on tokens longer than just one word, e.g. "trinking coffee" would become "drinking coffee" and not "thinking coffee". I found the following Java libraries for doing spelling correction: JAZZY does not seem to be under active development. Also, the dictionary-distance based approach seems inadequate because of the use of non-standard language in social network profiles and multi-word tokens. APACHE LUCENE seems to have a statistical spell checker that should be much more suited. Question here would how to create a good dictionary? (We are not using Lucene otherwise, so there is no existing index.) Any suggestions are welcome!

    Read the article

  • Development environment for ASP.NET with EpiServer

    - by Binary255
    At our company we are going to develop more for the Windows platform than we have done up until now. As this scale of Windows development is new to us it would be nice with some feedback from experienced developers. Requirements we have: 5 developers from the beginning. 15 developers a year from now. All developers should be able to develop at the same time. Be able to develop solution for ASP.NET and EpiServer 5. Our idea: A shared server which developers use for development through Terminal Services. SQL Server Express. Start with some free express edition of Visual Studio, upgrade to a commercial version if we need the additional features. Use IIS and not the web server built into Visual Studio. Questions: Are we on the right track? In terms of license costs the above should be cheapest, right? What do you think about multiple developers doing development using a shared TS-server? Do you know of any company which has a similar development environment? Are we going to miss some features of the full Visual Studio version immediately? Is using Express version a bad choice? Is IIS the best choice? If use IIS the developers may use the same port for deployment. If we use the built in web server each one has to set their own port as we're sharing a machine. Comment answer: We are thinking about a shared server as it will most likely decrease the license costs. So it's purely a cost issue. We are using CVS for version control. Our situation is that we develop on Mac and Linux, that's why buying 1 server license + Visual Studio licenses seems to be a cost effective way of starting this type of development.

    Read the article

  • (C#) Get index of current foreach iteration

    - by Graphain
    Hi, Is there some rare language construct I haven't encountered (like the few I've learned recently, some on Stack Overflow) in C# to get a value representing the current iteration of a foreach loop? For instance, I currently do something like this depending on the circumstances: int i=0; foreach (Object o in collection) { ... i++; } Answers: @bryansh: I am setting the class of an element in a view page based on the position in the list. I guess I could add a method that gets the CSSClass for the Objects I am iterating through but that almost feels like a violation of the interface of that class. @Brad Wilson: I really like that - I've often thought about something like that when using the ternary operator but never really given it enough thought. As a bit of food for thought it would be nice if you could do something similar to somehow add (generically to all IEnumerable objects) a handle on the enumerator to increment the value that an extension method returns i.e. inject a method into the IEnumerable interface that returns an iterationindex. Of course this would be blatant hacks and witchcraft... Cool though... @crucible: Awesome I totally forgot to check the LINQ methods. Hmm appears to be a terrible library implementation though. I don't see why people are downvoting you though. You'd expect the method to either use some sort of HashTable of indices or even another SQL call, not an O(N) iteration... (@Jonathan Holland yes you are right, expecting SQL was wrong) @Joseph Daigle: The difficulty is that I assume the foreach casting/retrieval is optimised more than my own code would be. @Jonathan Holland: Ah, cheers for explaining how it works and ha at firing someone for using it.

    Read the article

  • Entity framework entity class mapping with plain .net class

    - by Elan
    I have following in entity framework Table - Country Fields List item Country_ID Dialing_Code ISO_Alpha2 ISO_Alpha3 ISO_Full I would like to map only selected fields from this entity model to my domain class. My domain model class is public class DomainCountry { public int Country_ID { get; set; } public string Dialing_Code { get; set; } public string ISO_3166_1_Alpha_2 { get; set; } } The following will work however insert or update is not possible. In order to get insert or update we need to use ObjectSet< but it will not support in my case. IQueryable<DomainCountry> countries = context.Countries.Select( c => new DomainCountry { Country_ID = c.Country_Id, Dialing_Code = c.Dialing_Code, ISO_3166_1_Alpha_2 = c.ISO_3166_1_Alpha_2 }); It will be really fantastic could someone provide a nice solution for this. Ideally it will be kind of proxy class which will support all the futures however highly customizable i.e. only the columns we want to expose to the outer world

    Read the article

  • Getting Google results in Java? Need help!

    - by Cris Carter
    Hello. Right now, I'm trying to get the results from Google in Java, by searching for a term. I'm using a desktop program, not an applet. That in itself isn't complicated. but then Google gave me a 403 error. Anyways, I added referrer and User Agent and then it worked. Now, my problem is that I don't get the results page from Google. Instead, I get their script which gets the results page. My code right now simply uses a GET request on "http://www.google.com/search?q=" + Dork; Then it outputs each line. Here is what I get when I run my program: <.!doctype html<.head<.titledork - Google Search<./title<.scriptwindow.google={kEI:"9myaS-Date).getTime()}}};try{}catch(u){}window.google.jsrt_kill=1; align:center}#logo{display:block;overflow:hidden;position:relative;width:103px;height:37px; <./ script<./div Lots of stuff like that. I shortened it (A LOT) and put in dots to fit it here. So my big question is: How do I turn this whole mess into the nice results page I get when searching Google with a browser? Any help would be seriously appreciated, and I really need the answer fast. Also, please keep in mind that I do NOT want to use Google's API for this. Thanks in advance!

    Read the article

  • Throttling outbound API calls generated by a Rails app

    - by Sharpie
    I am not a professional web developer, but I like to wrench on websites as a hobby. Recently, I have been playing with developing a Rails app as a project to help me learn the framework. The goal of my toy app is to harvest data from another service through their API and make it available for me to query using a search function. However, the service I want to pull data from imposes a rate limit on the number of API calls that may be executed per minute. I plan on having my app run a daily update which may generate a burst of API calls that far exceeds the limit provided by the external service. I wish to respect the performance of the external site and so would like to throttle the rate at which my app executes the calls. I have done a little bit of searching and the overwhelming amount of tutorial material and pre-built libraries I have found cover throttling inbound API calls to a web app and I can find little discussion of controlling the flow of outbound calls. Being both an amateur web developer and a rails newbie, it is entirely possible that I have been executing the wrong searches in the wrong places. Therefore my questions are: Is there a nice website out there aggregating Rails tutorials that has material related to throttling outbound API requests? Are there any ruby gems or other libraries that would help me throttle the requests? I have some ideas of how I might go about writing a throttling system using a queue-based worker like DelayedJob or Resque to manage the API calls, but I would rather spend my weekends building the rest of the site if there is a good pre-built solution out there already.

    Read the article

  • Scrolling screen upward to expose TextView above keyboard

    - by Matt Winters
    I think I'm missing something obvious and would appreciate an answer. I have a view with a 2-section grouped tableView, each section having one row and a textView, the heights of the rows 335 and 140. This allows for a box with nicely rounded corners to type text into when the keyboard appears (140 height section) and when the keyboard is dismissed, a nice box to read more text (notes); most of the time, use is without the keyboard. I also added a toolbar at the bottom of the screen to scroll up above the keyboard. A button on the toolbar dismisses the keyboard. This last part works fine with the keyboard going up and down using a notification and the following code in a keyboardWillShow method: [UIView beginAnimations:@"showKeyboardAnimation" context:nil]; [UIView setAnimationDuration:0.50]; self.view.frame = CGRectMake(self.view.frame.origin.x, self.view.frame.origin.y, self.view.frame.size.width, self.view.frame.size.height - 216); [UIView commitAnimations]; But with the above code, the 2 sections of the tableView remain unscrolled, only the toolbar and the keyboard move. With the following code (found both in previous posts), both the toolbar and the tableView sections move. [UIView beginAnimations:nil context:NULL]; [UIView setAnimationDuration:0.50]; CGRect rect = self.view.frame; rect.origin.y -= 216; self.view.frame = rect; [UIView commitAnimations]; Now I know that I have to tweak the numbers to get the everything as I want it but my first question is what is substantively different between the 2 sets of code that the sections move in the 2nd but not in the 1st? The toolbar also moves with the 2nd code. The second question is, am I going to be able to scroll the smaller height section from off the screen to above the keyboard while at the same time moving the toolbar up just 216? Thanks

    Read the article

  • best way to pick a random subset from a collection?

    - by Tom
    I have a set of objects in a Vector from which I'd like to select a random subset (e.g. 100 items coming back; pick 5 randomly). In my first (very hasty) pass I did an extremely simple and perhaps overly clever solution: Vector itemsVector = getItems(); Collections.shuffle(itemsVector); itemsVector.setSize(5); While this has the advantage of being nice and simple, I suspect it's not going to scale very well, i.e. Collections.shuffle() must be O(n) at least. My less clever alternative is Vector itemsVector = getItems(); Random rand = new Random(System.currentTimeMillis()); // would make this static to the class List subsetList = new ArrayList(5); for (int i = 0; i < 5; i++) { // be sure to use Vector.remove() or you may get the same item twice subsetList.add(itemsVector.remove(rand.nextInt(itemsVector.size()))); } Any suggestions on better ways to draw out a random subset from a Collection?

    Read the article

  • parsing css measures

    - by david
    When i write a jQuery plugin i like to specify options for spacings the CSS way. I wrote a function that returns a CSS String as values in a object. 5px 10px returns top: 5px, right: 10px, bottom: 5px, left: 10px Now i often use the returned values to do some calculations and its not very nice to have to extract the measuring unit every time... I suck in writing regular expressions could someone help me complete this function: this.cssMeasure = function(cssString, separateUnits){ if ( cssString ){ var values = {} }else{ return errorMsg } var spacing = cssString.split(' ') var errorMsg = 'please format your css values correctly dude' if( spacing[4] || (spacing[2] && !spacing[3]) ) { return errorMsg } else if ( spacing[3] ) { values = {top: spacing[0], right:spacing[1], bottom:spacing[2], left:spacing[3]} } else if ( spacing[1] ) { values = {top: spacing[0], right:spacing[1], bottom:spacing[0], left:spacing[1]} } else { values = {top: spacing[0], right:spacing[0], bottom:spacing[0], left:spacing[0]} } if (separateUnits) { $.each(values, function(i, value){ /* at this place i need to extract the measuring unit of each value and return them separately something like top: {value: 10, unit: 'px'}, right: {bla} and so on */ }) } return values } if you have any idea how to improve this function i am open to your comments.

    Read the article

  • Mac OS X: Getting detailed process information (specifically its launch arguments) for arbitrary run

    - by Jasarien
    I am trying to detect when particular applications are launched. Currently I am using NSWorkspace, registering for the "did launch application" notification. I also use the runningApplications method to get apps that are currently running when my app starts. For most apps, the name of the app bundle is enough. I have a plist of "known apps" that I cross check with the name of that passed in the notification. This works fine until you come across an app that acts as a proxy for launching another application using command line arguments. Example: The newly released Portal on the Mac doesn't have a dedicated app bundle. Steam can create a shortcut, which serves as nothing more than to launch the hl2_osx app with the -game argument and portal as it's parameter. Since more Source based games are heading to the Mac, I imagine they'll use the same method to launch, effectively running the hl2_osx app with the -game argument. Is there a nice way to get a list of the arguments (and their parameters) using a Cocoa API? NSProcessInfo comes close, offering an `-arguments' method, but only provides information for its own process... NSRunningApplication offers the ability to get information about arbitrary apps using a PID, but no command line args... Is there anything that fills the gap between the two? I'm trying not to go down the route of spawning an NSTask to run ps -p [pid] and parsing the output... I'd prefer something more high level.

    Read the article

  • Linux 2.6.31 Scheduler and Multithreaded Jobs

    - by dsimcha
    I run massively parallel scientific computing jobs on a shared Linux computer with 24 cores. Most of the time my jobs are capable of scaling to 24 cores when nothing else is running on this computer. However, it seems like when even one single-threaded job that isn't mine is running, my 24-thread jobs (which I set for high nice values) only manage to get ~1800% CPU (using Linux notation). Meanwhile, about 500% of the CPU cycles (again, using Linux notation) are idle. Can anyone explain this behavior and what I can do about it to get all of the 23 cores that aren't being used by someone else? Notes: In case it's relevant, I have observed this on slightly different kernel versions, though I can't remember which off the top of my head. The CPU architecture is x64. Is it at all possible that the fact that my 24-core jobs are 32-bit and the other jobs I'm competing w/ are 64-bit is relevant? Edit: One thing I just noticed is that going up to 30 threads seems to alleviate the problem to some degree. It gets me up to ~2100% CPU.

    Read the article

  • Locking issues with replacing files on a website

    - by Moe Sisko
    I want to replace existing files on an IIS website with updated versions. Say these files are large pdf documents, which can be accessed via hyperlinks. The site is up 24x7, so I'm concerned about locking issues when a file is being updated at exactly the same time that someone is trying to read the file. The files are updated using C# code run on the server. I can think of two options for opening the file for writing. Option 1) Open the file for writing, using FileShare.Read : using (FileStream stream = new FileStream(path, FileMode.Create, FileAccess.Write, FileShare.Read)) While this file is open, and a user requests the same file for reading in a web browser via a hyperlink, the document opens up as a blank page. Option 2) Open the file for writing using FileShare.None : using (FileStream stream = new FileStream(path, FileMode.Create, FileAccess.Write, FileShare.None)) While this file is open, and a user requests the same file for reading in a web browser via a hyperlink, the browser shows an error. In IE 8, you get HTTP 500, "The website cannot display the page", and in Firefox 3.5, you get : "The process cannot access the file because it is being used by another process." The browser behaviour kind of makes sense, and seem reasonable. I guess its highly unlikely that a user will attempt to read a file at exactly the same time you are updating it. It would be nice if somehow, the file update was atomic, like updating a database with SQL wrapped around a transaction. I'm wondering if you guys worry about this sort of thing, and prefer either of the above options, or even have other options of your own for updating files.

    Read the article

  • Missing WM_PAINT when hosting a WPF control inside a winforms application.

    - by Boris
    Hi All, Consider the following scenario: 1) Create a winforms application with an empty form. 2) Create a WPF usercontrol in the same project which is just the default control with background changed to blue. <UserControl x:Class="WindowsFormsApplication2.UserControl1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Height="300" Width="300" Background="Blue"> <Grid> </Grid> </UserControl> 3) Build the project 4) Add the control to your form (an ElementHost is added and the control is added inside it). 5) Run the application (everything looks nice) 6) Start Spy++, click find window (Control+F) and move the cursor onto the WPF control (the blue square) Something strange happens, the control gets a WM_ERASEBKGND message but no WM_PAINT message so now it is white. You can resize the form, hide the form behind other windows and the WPF control will not get rendered. There is an image of the scenario here: http://img260.imageshack.us/img260/2296/wmpaint.png This is a simplified example of the situation I have in the actual application. Please tell me what is the best way to resolve this issue such that the WPF control renders itself correctly. I would like a solution that can be incorporated into a large application with many controls on the form. Thank you very much in advance, Boris

    Read the article

  • magento - multilingual site + Add store codes to url - want to show flag icons

    - by Mustapha George
    I want to have a multi-language magento site use a flag image instead of a language selector box for user to select language of page. There is a nice article on this at http://www.atwix.com/magento/replace-language-selector-flag-icons/ Only issue is that we use "Add store codes to url" option. I hacked this code, but it can use some refinement and make it more Magento looking. <?php if(count($this->getStores())>1): ?> <div class="form-language"> <div class="langs-wrapper"> <?php foreach ($this->getStores() as $_lang): ?> <?php if ($_lang->getCode() != 'default'): ?> <? $base_url = Mage::getBaseUrl(); // remove language in base url $base_url = str_replace('/en/' , "" , $base_url); $base_url = str_replace('/fr/' , "" , $base_url); $current_url = $this->helper('core/url')->getCurrentUrl(); // take out base url and language code $rest_of_url = str_replace($base_url , "" , $current_url); $rest_of_url = str_replace('/en/' , "" , $rest_of_url); $rest_of_url = str_replace('/fr/' , "" , $rest_of_url); // assmble new url $new_url = $base_url . '/' . $_lang->getCode() . '/' . $rest_of_url; ?> <a class="lang-flag" href="<?php echo $new_url ;?>"><img src="<?php echo $this->getSkinUrl('images/flags/' . $_lang->getCode() . '.png');?>" alt=""></a> <?php endif;?> <?php endforeach;?> </div> </div> <?php endif;?>

    Read the article

  • Reordering arguments using recursion (pro, cons, alternatives)

    - by polygenelubricants
    I find that I often make a recursive call just to reorder arguments. For example, here's my solution for endOther from codingbat.com: Given two strings, return true if either of the strings appears at the very end of the other string, ignoring upper/lower case differences (in other words, the computation should not be "case sensitive"). Note: str.toLowerCase() returns the lowercase version of a string. public boolean endOther(String a, String b) { return a.length() < b.length() ? endOther(b, a) : a.toLowerCase().endsWith(b.toLowerCase()); } I'm very comfortable with recursions, but I can certainly understand why some perhaps would object to it. There are two obvious alternatives to this recursion technique: Swap a and b traditionally public boolean endOther(String a, String b) { if (a.length() < b.length()) { String t = a; a = b; b = t; } return a.toLowerCase().endsWith(b.toLowerCase()); } Not convenient in a language like Java that doesn't pass by reference Lots of code just to do a simple operation An extra if statement breaks the "flow" Repeat code public boolean endOther(String a, String b) { return (a.length() < b.length()) ? b.toLowerCase().endsWith(a.toLowerCase()) : a.toLowerCase().endsWith(b.toLowerCase()); } Explicit symmetry may be a nice thing (or not?) Bad idea unless the repeated code is very simple ...though in this case you can get rid of the ternary and just || the two expressions So my questions are: Is there a name for these 3 techniques? (Are there more?) Is there a name for what they achieve? (e.g. "parameter normalization", perhaps?) Are there official recommendations on which technique to use (when)? What are other pros/cons that I may have missed?

    Read the article

  • MSMQ on Win2008 R2 won’t receive messages from older clients

    - by Graffen
    Hi all I'm battling a really weird problem here. I have a Windows 2008 R2 server with Message Queueing installed. On another machine, running Windows 2003 is a service that is set up to send messages to a public queue on the 2008 server. However, messages never show up on the server. I've written a small console app that just sends a "Hello World" message to a test queue on the 2008 machine. Running this app on XP or 2003 results in absolutely nothing. However, when I try running the app on my Windows 7 machine, a message is delivered just fine. I've been through all sorts of security settings, disabled firewalls on all machines etc. The event log shows nothing of interest, and no exceptions are being thrown on the clients. Running a packet sniffer (WireShark) on the server reveals only a little. When trying to send a message from XP or 2003 I only see an ICMP error "Port Unreachable" on port 3527 (which I gather is an MQPing packet?). After that, silence. Wireshark shows a nice little stream of packets when I try from my Win7 client (as expected - messages get delivered just fine from Win7). I've enabled MSMQ End2End logging on the server, but only entries from the messages sent from my Win7 machine are appearing in the log. So somehow it seems that messages are being dropped silently somewhere along the route from XP or 2003 to my 2008 server. Does anyone have any clues as to what might be causing this mysterious behaviour? -- Jesper

    Read the article

  • Create a HTML table from nested maps (and vectors)

    - by Kenny164
    I'm trying to create a table (a work schedule) I have coded previously using python, I think it would be a nice introduction to the Clojure language for me. I have very little experience in Clojure (or lisp in that matter) and I've done my rounds in google and a good bit of trial and error but can't seem to get my head around this style of coding. Here is my sample data (will be coming from an sqlite database in the future): (def smpl2 (ref {"Salaried" [{"John Doe" ["12:00-20:00" nil nil nil "11:00-19:00"]} {"Mary Jane" [nil "12:00-20:00" nil nil nil "11:00-19:00"]}] "Shift Manager" [{"Peter Simpson" ["12:00-20:00" nil nil nil "11:00-19:00"]} {"Joe Jones" [nil "12:00-20:00" nil nil nil "11:00-19:00"]}] "Other" [{"Super Man" ["07:00-16:00" "07:00-16:00" "07:00-16:00" "07:00-16:00" "07:00-16:00"]}]})) I was trying to step through this originally using for then moving onto doseq and finally domap (which seems more successful) and dumping the contents into a html table (my original python program outputed this from a sqlite database into an excel spreadsheet using COM). Here is my attempt (the create-table fn): (defn html-doc [title & body] (html (doctype "xhtml/transitional") [:html [:head [:title title]] [:body body]])) (defn create-table [] [:h1 "Schedule"] [:hr] [:table (:style "border: 0; width: 90%") [:th "Name"][:th "Mon"][:th "Tue"][:th "Wed"] [:th "Thur"][:th "Fri"][:th "Sat"][:th "Sun"] [:tr (domap [ct @smpl2] [:tr [:td (key ct)] (domap [cl (val ct)] (domap [c cl] [:tr [:td (key c)]]))]) ]]) (defroutes tstr (GET "/" ((html-doc "Sample" create-table))) (ANY "*" 404)) That outputs the table with the sections (salaried, manager, etc) and the names in the sections, I just feel like I'm abusing the domap by nesting it too many times as I'll probably need to add more domaps just to get the shift times in their proper columns and the code is getting a 'dirty' feel to it. I apologize in advance if I'm not including enough information, I don't normally ask for help on coding, also this is my 1st SO question :). If you know any better approaches to do this or even tips or tricks I should know as a newbie, they are definitely welcome. Thanks.

    Read the article

< Previous Page | 215 216 217 218 219 220 221 222 223 224 225 226  | Next Page >