Search Results

Search found 9788 results on 392 pages for 'character limit'.

Page 23/392 | < Previous Page | 19 20 21 22 23 24 25 26 27 28 29 30  | Next Page >

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • what should be limit to use for IPTABLE rate limiting for a webserver

    - by Registered User
    I see on my webserver some logs as follows 203.252.157.98 - :25:02 "GET //phpmyadmin/ HTTP/1.1" 404 393 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:03 "GET //phpMyAdmin/ HTTP/1.1" 404 394 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:03 "GET //pma/ HTTP/1.1" 404 388 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:04 "GET //dbadmin/ HTTP/1.1" 404 391 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:05 "GET //myadmin/ HTTP/1.1" 404 391 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:06 "GET //phppgadmin/ HTTP/1.1" 404 394 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:06 "GET //PMA/ HTTP/1.1" 404 389 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:07 "GET //admin/ HTTP/1.1" 404 389 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :25:08 "GET //MyAdmin/ HTTP/1.1" 404 392 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :27:36 "GET //phpmyadmin/ HTTP/1.1" 404 393 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :27:42 "GET //phpMyAdmin/ HTTP/1.1" 404 394 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :27:42 "GET //pma/ HTTP/1.1" 404 388 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - :27:43 "GET //dbadmin/ HTTP/1.1" 404 391 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" 203.252.157.98 - - "GET //myadmin/ HTTP/1.1" 404 391 "-" "Made by ZmEu @ WhiteHat Team - www.whitehat.ro" and some more as follows 118.219.234.254 - - [19/Oct/2010:22:57:41 "GET /pma/scripts/setup.php HTTP/1.1" 404 399 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:41 "GET /scripts/setup.php HTTP/1.1" 404 397 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:42 "GET /sqlweb/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:42 "GET /web/phpMyAdmin/scripts/setup.php HTTP/1.1" 404 408 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:43 "GET /web/phpmyadmin/scripts/setup.php HTTP/1.1" 404 408 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:44 "GET /web/scripts/setup.php HTTP/1.1" 404 400 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:44 "GET /webadmin/scripts/setup.php HTTP/1.1" 404 403 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:45 "GET /webdb/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:22:57:45 "GET /websql/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:51 "GET /admin/phpmyadmin/scripts/setup.php HTTP/1.1" 404 407 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:52 "GET /admin/pma/scripts/setup.php HTTP/1.1" 404 404 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:52 "GET /admin/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:53 "GET /db/scripts/setup.php HTTP/1.1" 404 399 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:54 "GET /dbadmin/scripts/setup.php HTTP/1.1" 404 402 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:54 "GET /myadmin/scripts/setup.php HTTP/1.1" 404 403 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:55 "GET /mysql/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:55 "GET /mysqladmin/scripts/setup.php HTTP/1.1" 404 405 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:56 "GET /phpMyAdmin/scripts/setup.php HTTP/1.1" 404 405 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:56 "GET /phpadmin/scripts/setup.php HTTP/1.1" 404 403 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:57 "GET /phpmyadmin/scripts/setup.php HTTP/1.1" 404 404 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:57 "GET /pma/scripts/setup.php HTTP/1.1" 404 399 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:58 "GET /scripts/setup.php HTTP/1.1" 404 397 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:58 "GET /sqlweb/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:59 "GET /web/phpMyAdmin/scripts/setup.php HTTP/1.1" 404 408 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:38:59 "GET /web/phpmyadmin/scripts/setup.php HTTP/1.1" 404 408 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:39:00 "GET /web/scripts/setup.php HTTP/1.1" 404 400 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:39:01 "GET /webadmin/scripts/setup.php HTTP/1.1" 404 403 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:39:01 "GET /webdb/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" 118.219.234.254 - - [19/Oct/2010:05:39:02 "GET /websql/scripts/setup.php HTTP/1.1" 404 401 "-" "Mozilla/4.0 (compatible; MSIE 6.0; Windows 98)" I have 2 questions 1) When such an attack happens on my site then while such scanning is going on how do I detect it? (In a very less time) 2)I have decided to rate limit the IPTABLES so as to reduce such DOS attacks by some script kiddies (to scan for vulnerabilities in phpmyadmin or some other script) to some extent.So how much should it be limited so that genuine users do not get kicked out.What is the best practise for question 2?

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • Openvz: What exactly does it mean when tcpsndbuf failcnt increases? Why must there be a minimum difference between limit and barrier?

    - by Antonis Christofides
    When the failcnt of tcpsndbuf increases, what does this mean? Does it mean the system had to go past the barrier, or past the limit? Or, maybe, that the system failed to provide enough buffers, either because it needed to go past the limit, or because it needed to go past the barrier but couldn't because other VMs were using too many resources? I understand the difference between barrier and limit only for disk space, where you can specify a grace period for which the system can exceed the barrier but not the limit. But in resources like tcpsndbuf, which have no such thing as a grace period, what is the meaning of barrier vs. limit? Why does the difference between barrier and limit in tcpsndbuf be at least 2.5KB times tcpnumsock? I could understand it if, e.g., tcpsndbuf should be at least 2.5KB times tcpnumsock (either the barrier or the limit), but why should I care about the difference between the barrier and the limit?

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • AsyncTask, RejectedExecutionException and Task Limit

    - by Samuh
    I am fetching lots of thumbnails from a remote server and displaying them in a grid view, using AsyncTask. The problem is, my grid view displays 20 thumbnails at a time, so that creates 20 AsyncTasks and starts 20 executes, one per thumbnail. I get RejectedExecution exception in my code. I recall reading somewhere that there is a limit to number of tasks that AsyncTask can have in its queue at a time, i might be hitting that. Was this bar lifted? Is there a way to increase this limit? Is it safe to just ignore this exception?(by having an empty catch(RejectedException e){} block?) I am running this code on Android 1.6 emulator and the API level in my code(minSDKVersion is 3). [EDIT: Added SDK and API level info]

    Read the article

  • Limit a program's execution time in C (Monte Carlo technique)

    - by rrs90
    I am working on a project which has no determined algorithm to solve using C language. I am Using Monte Carlo technique for solving that problem. And the number of random guesses I want to limit to the execution time specified by the user. This means I want to make full use of the execution time limit defined by the user (as a command line argument) to make as many random iterations as possible. Can I check the execution time elapsed so far for a loop condition. Eg: for(trials=0;execution_time P.S. I am using code blocks 10.05 for coding and GNU compiler.

    Read the article

  • Will be self-taught limit me?

    - by Isaiah
    I'm 21 and am pretty efficient in html/css, python, and javascript. I also know my way around lisp languages and enjoy programing in them. My problem is that I'm extremely self-taught and not quite confident that I could land a job programing, but I really need a job soon as I've just become a father. I haven't even created a resume yet because I'm not really sure what to put on it except my lone experience. So I wanted to ask, will being primarily self-taught with some experience on small projects I've done for a few clients limit me too much? I mean I know I need some kind of education so I've enrolled part time in a community college to work on a degree in computer science, but it's years till then. And if it will limit me a lot, what kind of skills would be good to work on to make my chances any better? Thank You

    Read the article

  • Django QuerySet filter + order_by + limit

    - by handsofaten
    So I have a Django app that processes test results, and I'm trying to find the median score for a certain assessment. I would think that this would work: e = Exam.objects.all() total = e.count() median = int(round(total / 2)) median_exam = Exam.objects.filter(assessment=assessment.id).order_by('score')[median:1] median_score = median_exam.score But it always returns an empty list. I can get the result I want with this: e = Exam.objects.all() total = e.count() median = int(round(total / 2)) exams = Exam.objects.filter(assessment=assessment.id).order_by('score') median_score = median_exam[median].score I would just prefer not to have to query the entire set of exams. I thought about just writing a raw MySQL query that looks something like: SELECT score FROM assess_exam WHERE assessment_id = 5 ORDER BY score LIMIT 690,1 But if possible, I'd like to stay within Django's ORM. Mostly, it's just bothering me that I can't seem to use order_by with a filter and a limit. Any ideas?

    Read the article

  • Is there Any Limit on stack memory!

    - by Vikas
    I was going through one of the threads. A program crashed because It had declared an array of 10^6 locally inside a function. Reason being given was memory allocation failure on stack leads to crash. when same array was declared globally, it worked well.(memory on heap saved it). Now for the moment ,Let us suppose, stack grows downward and heap upwards. We have: ---STACK--- ---HEAP---- Now , I believe that if there is failure in allocation on stack, it must fail on heap too. So my question is :Is there any limit on stack size? (crossing the limit caused the program to crash). Or Am I missing something?

    Read the article

  • PHP: Coding long-running scripts when servers impose an execution time limit

    - by thomasrutter
    FastCGI servers, for example, impose an execution time limit on PHP scripts which cannot be altered using set_time_limit() in PHP. IIS does this too I believe. I wrote an import script for a PHP application that works well under mod_php but fails under FastCGI (mod_fcgid) because the script is killed after a certain number of seconds. I don't yet know of a way of detecting what your time limit is in this case, and haven't decided how I'm going to get around it. Doing it in small chunks with redirects seems like one kludge, but how? What techniques would you use when coding a long-running task such as an import or export task, where an individual PHP script may be terminated by the server after a certain number of seconds? Please assume you're creating a portable script, so you don't necessarily know whether PHP will eventually be run under mod_php, FastCGI or IIS or whether a maximum execution time is enforced at the server level.

    Read the article

  • HLSL: Enforce Constant Register Limit at Compile Time

    - by Andrew Russell
    In HLSL, is there any way to limit the number of constant registers that the compiler uses? Specifically, if I have something like: float4 foobar[300]; In a vs_2_0 vertex shader, the compiler will merrily generate the effect with more than 256 constant registers. But a 2.0 vertex shader is only guaranteed to have access to 256 constant registers, so when I try to use the effect, it fails in an obscure and GPU-dependent way at runtime. I would much rather have it fail at compile time. This problem is especially annoying as the compiler itself allocates constant registers behind the scenes, on top of the ones I am asking for. I have to check the assembly to see if I'm over the limit. Ideally I'd like to do this in HLSL (I'm using the XNA content pipeline), but if there's a flag that can be passed to the compiler that would also be interesting.

    Read the article

  • How to limit choice field options based on another choice field in django admin

    - by umnik700
    I have the following models: class Category(models.Model): name = models.CharField(max_length=40) class Item(models.Model): name = models.CharField(max_length=40) category = models.ForeignKey(Category) class Demo(models.Model): name = models.CharField(max_length=40) category = models.ForeignKey(Category) item = models.ForeignKey(Item) In the admin interface when creating a new Demo, after user picks category from the dropdown, I would like to limit the number of choices in the "items" drop-down. If user selects another category then the item choices should update accordingly. I would like to limit item choices right on the client, before it even hits the form validation on the server. This is for usability, because the list of items could be 1000+ being able to narrow it down by category would help to make it more manageable. Is there a "django-way" of doing it or is custom JavaScript the only option here?

    Read the article

  • php nl2br limit x amount

    - by Joshua Anderson
    Hi this is fairly simple I want to know how to use nl2br(); in php, but limit the amount of <br/>'s that are allowed at one time. //For Example: A user enters hi Im a jerk and made 16 more lines. or I could make as many as i want Is there anyway to have php limit the <br/>'s to no more than x amount of numbers at at time so if we only allowed 4 <br>'s at a time the output would be hi Im a jerk I tried to make 9 lines and it made it 4

    Read the article

  • Will being self-taught limit me?

    - by Isaiah
    I'm 21 and am pretty efficient in html/css, python, and javascript. I also know my way around lisp languages and enjoy programing in them. My problem is that I'm extremely self-taught and not quite confident that I could land a job programing, but I really need a job soon as I've just become a father. I haven't even created a resume yet because I'm not really sure what to put on it except my lone experience. So I wanted to ask, will being primarily self-taught with some experience on small projects I've done for a few clients limit me too much? I mean I know I need some kind of education so I've enrolled part time in a community college to work on a degree in computer science, but it's years till then. And if it will limit me a lot, what kind of skills would be good to work on to make my chances any better? Thank You

    Read the article

  • Python ValueError: not allowed to raise maximum limit

    - by Ricky Bobby
    I'm using python 2.7.2 on mac os 10.7.3 I'm doing a recursive algorithm in python with more than 50 000 recursion levels. I tried to increase the maximum recursion level to 1 000 000 but my python shell still exit after 18 000 recursion levels. I tried to increase the resources available : import resource resource.setrlimit(resource.RLIMIT_STACK, (2**29,-1)) sys.setrecursionlimit(10**6) and I get this error : Traceback (most recent call last): File "<pyshell#58>", line 1, in <module> resource.setrlimit(resource.RLIMIT_STACK,(2**29,-1)) ValueError: not allowed to raise maximum limit I don't know why I cannot raise the maximum limit ? thanks for your suggestions .

    Read the article

  • Using :limit and :order in the associated model

    - by r2b2
    Hello, Is there any way i can limit the results of an associated model? This what i was trying to do : <ul> <% account.logins.slice(0,5).sort_by(&:login_date).reverse.each do |login| -%> <li><%=h login.login_date.strftime("%d.%m.%Y")%></li> <% end -%> </ul> I'm trying to get the last five logins of the account. I cant seem to do it with account.logins(:limit=5) Thanks !

    Read the article

  • Drupal limit number of menu items in primary links

    - by ninusik
    Is there a way to set a limit on how many menu items users can add to Primary Links menu? I'm working on a Drupal site and I have a horizontal primary links nav bar. There is only room for no more than 7-8 links in the nav bar. I don't want the future maintainer of the site to add more than 8 items to the menu. Is there a way I can set a limit on that? Some module or override function? Thanks,

    Read the article

< Previous Page | 19 20 21 22 23 24 25 26 27 28 29 30  | Next Page >