Search Results

Search found 23347 results on 934 pages for 'key storage'.

Page 236/934 | < Previous Page | 232 233 234 235 236 237 238 239 240 241 242 243  | Next Page >

  • WebCenter Customer Spotlight: Guizhou Power Grid Company

    - by me
    Author: Peter Reiser - Social Business Evangelist, Oracle WebCenter  Solution SummaryGuizhou Power Grid Company is responsible for power grid planning, construction, management, and power distribution in Guizhou Province, serving 39 million people. Giuzhou has 49,823 employees and an annual revenue of over $5 Billion. The business objectives were to consolidate information contained in disparate systems into a single knowledge repository and provide a safe and efficient way for staff and managers to access, query, share, manage, and store business information. Guizhou Power Grid Company saved more than US$693,000 in storage costs, reduced  average search times from 180 seconds to 5 seconds and solved 80% to 90% of technology and maintenance issues by searching the Oracle WebCenter Content management system. Company OverviewA wholly owned subsidiary of China Southern Power Grid Company Limited, Guizhou Power Grid Company is responsible for power grid planning, construction, management, and power distribution in Guizhou Province, serving 39 million people. Giuzhou has 49,823 employees and an annual revenue of over $5 Billion. Business ChallengesThe business objectives were to consolidate information contained in disparate systems, such as the customer relationship management and power grid management systems, into a single knowledge repository and provide a safe and efficient way for staff and managers to access, query, share, manage, and store business information. Solution DeployedGuizhou Power Grid Company  implemented Oracle WebCenter Content to build a content management system that enabled the secure, integrated management and storage of information, such as documents, records, images, Web content, and digital assets. The content management solution was integrated with the power grid, customer service, maintenance, and other business systems, as well as the corporate Web site. Business Results Saved more than US$693,000 in storage costs and shortened the material distribution time by integrating the knowledge management solution with the power grid, customer service, maintenance, and other business systems, as well as the corporate Web site Enabled staff to search 31,650 documents using catalogs, multidimensional attributes, and knowledge maps, reducing average search times from 180 seconds to 5 seconds and saving approximately 1,539 hours in annual search time Gained comprehensive document management, format transformation, security, and auditing capabilities Enabled users to upload new documents and supervisors to check the accuracy of these documents online, resulting in improved information quality control Solved 80% to 90% of technology and maintenance issues by searching the Oracle content management system for information, ensuring IT staff can respond quickly to users’ technical problems Improved security by using role-based access controls to restrict access to confidential documents and information Supported the efficient classification of corporate knowledge by using Oracle’s metadata functions to collect, tag, and archive documents, images, Web content, and digital assets “We chose Oracle WebCenter Content, as it is an outstanding integrated content management platform. It has allowed us to establish a system to access, query, share, manage, and store our corporate assets. This has laid a solid foundation for Guizhou Power Grid Company to improve management practices.” Luo Sixi, Senior Information Consultant, Guizhou Power Grid Company Additional Information Guizhou Power Grid Company Customer Snapshot Oracle WebCenter Content

    Read the article

  • MySQL DDL error creating tables

    - by Alexandstein
    I am attempting to create tables for a MySQL database, but I am having some syntactical issues. It would seem that syntax checking is behaving differently between tables for some reason. While I've gotten all the other tables to go through, the table, 'stock' doesn't seem to be working, despite seeming to use the same syntax patterns. CREATE TABLE users ( user_id SMALLINT UNSIGNED NOT NULL AUTO_INCREMENT, username VARCHAR(30) NOT NULL, password CHAR(41) NOT NULL, date_joined DATETIME NOT NULL, funds DOUBLE UNSIGNED NOT NULL, PRIMARY KEY(user_id), UNIQUE KEY(username) ); CREATE TABLE owned_stocks ( id SMALLINT UNSIGNED NOT NULL AUTO_INCREMENT, user_id SMALLINT UNSIGNED NOT NULL, paid_price DOUBLE UNSIGNED NOT NULL, quantity MEDIUMINT UNSIGNED NOT NULL, purchase_date DATETIME NOT NULL, PRIMARY KEY(id) ); CREATE TABLE tracking_stocks ( ticker VARCHAR(5) NOT NULL, user_id SMALLINT UNSIGNED NOT NULL, PRIMARY KEY(ticker) ); CREATE TABLE stocks ( ticker VARCHAR(5) NOT NULL, last DOUBLE UNSIGNED NOT NULL, high DOUBLE UNSIGNED NOT NULL, low DOUBLE UNSIGNED NOT NULL, company_name VARCHAR(30) NOT NULL, last_updated INT UNSIGNED NOT NULL, change DOUBLE NOT NULL, percent_change DOUBLE NOT NULL, PRIMARY KEY(ticker) ); Am I just missing a really obvious syntactical issue? ERROR: #1064 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'change DOUBLE NOT NULL, percent_change DOUBLE NOT NULL, last DOUBLE' at line 4

    Read the article

  • UNIQUE CONSTRAINT on a column from foreign table in SQL Server 2008

    - by bodziec
    I have two tables: create table [dbo].[Main] ( [ID] [int] identity(1,1) primary key not null, [Sign] [char](1) not null ) create table [dbo].[Names] ( [ID_Main][int] primary key not null, [Name][nvarchar](128) not null, constraint [FK_Main_Users] foreign key ([ID_Main]) references [dbo].[Main]([ID]), constraint [CK_Name] unique ([Name], [Sign]) ) The problem is with the second constraint CK_Name Is there a way to make a constraint target column from a foreign table?

    Read the article

  • Hot to get custom http-header in asp.net?

    - by Sirius Lampochkin
    I have an asp.net appliction on the one server. There I've added code on server-side in Page_Load: Response.AddHeader("key", "password-key-from-hotel"); On the client side I have a form: $lt;form ... action="www.link-to-another-domaint" >   <input type="hidden" id="asd" value="fgh" > .... </form> <script type="text/javascript">   document.forms[0].submit(); </script> Then on the other domain - there is also my other application - I'm trying to get the hedaer "key" by this code: Request.Headers["key"].ToString(); But there is no such header. Is there is a desicion? Where is my mistake?

    Read the article

  • Generating short license keys with OpenSSL

    - by Marc Charbonneau
    I'm working on a new licensing scheme for my software, based on OpenSSL public / private key encryption. My past approach, based on this article, was to use a large private key size and encrypt an SHA1 hashed string, which I sent to the customer as a license file (the base64 encoded hash is about a paragraph in length). I know someone could still easily crack my application, but it prevented someone from making a key generator, which I think would hurt more in the long run. For various reasons I want to move away from license files and simply email a 16 character base32 string the customer can type into the application. Even using small private keys (which I understand are trivial to crack), it's hard to get the encrypted hash this small. Would there be any benefit to using the same strategy to generated an encrypted hash, but simply using the first 16 characters as a license key? If not, is there a better alternative that will create keys in the format I want?

    Read the article

  • MSI Installer start auto-repair when service starts

    - by Josh Clark
    I have a WiX based MSI that installs a service and some shortcuts (and lots of other files that don't). The shortcut is created as described in the WiX docs with a registry key under HKCU as the key file. This is an all users install, but to get past ICE38, this registry key has to be under the current user. When the service starts (it runs under the SYSTEM account) it notices that that registry key isn't valid (at least of that user) and runs the install again to "repair". In the Event Log I get MsiInstaller Events 1001 and 1004 showing that "The resource 'HKEY_CURRENT_USER\SOFTWARE\MyInstaller\Foo' does not exist." This isn't surprising since the SYSTEM user wouldn't have this key. I turned on system wide MSI logging and the auto-repair created its log file in the C:\Windows\Temp folder rather than a specific user's TEMP folder which seems to imply the current user was SYSTEM (plus the log file shows the "Calling process" to be my service). Is there something I can do to disable the auto-repair functionality? Am I doing something wrong or breaking some MSI rule? Any hints on where to look next?

    Read the article

  • Python to C# with openSSL requirement

    - by fonix232
    Hey there again! Today I ran into a problem when I was making a new theme creator for chrome. As you may know, Chrome uses a "new" file format, called CRX, to manage it's plugins and themes. It is a basic zip file, but a bit modified: "Cr24" + derkey + signature + zipFile And here comes the problem. There are only two CRX creators, written in Ruby or Python. I don't know neither language too much (had some basic experience in Python though, but mostly with PyS60), so I would like to ask you to help me convert this python app to a C# class. Also, here is the source of crxmake.py: #!/usr/bin/python # Cribbed from http://github.com/Constellation/crxmake/blob/master/lib/crxmake.rb # and http://src.chromium.org/viewvc/chrome/trunk/src/chrome/tools/extensions/chromium_extension.py?revision=14872&content-type=text/plain&pathrev=14872 # from: http://grack.com/blog/2009/11/09/packing-chrome-extensions-in-python/ import sys from array import * from subprocess import * import os import tempfile def main(argv): arg0,dir,key,output = argv # zip up the directory input = dir + ".zip" if not os.path.exists(input): os.system("cd %(dir)s; zip -r ../%(input)s . -x '.svn/*'" % locals()) else: print "'%s' already exists using it" % input # Sign the zip file with the private key in PEM format signature = Popen(["openssl", "sha1", "-sign", key, input], stdout=PIPE).stdout.read(); # Convert the PEM key to DER (and extract the public form) for inclusion in the CRX header derkey = Popen(["openssl", "rsa", "-pubout", "-inform", "PEM", "-outform", "DER", "-in", key], stdout=PIPE).stdout.read(); out=open(output, "wb"); out.write("Cr24") # Extension file magic number header = array("l"); header.append(2); # Version 2 header.append(len(derkey)); header.append(len(signature)); header.tofile(out); out.write(derkey) out.write(signature) out.write(open(input).read()) os.unlink(input) print "Done." if __name__ == '__main__': main(sys.argv) Please could you help me?

    Read the article

  • How to store an inventory using hashtables?

    - by Harm De Weirdt
    Hello everyone. For an assignment in collego we have to make a script in Perl that allows us to manage an inventory for an e-store. (The example given was Amazon) Users can make orders in a fully text-based environment and the inventory must be updated when an order is completed. Every item in the inventory has 3 to 4 attributes: a product code, a title, a price and for some an amount (MP3's for example do not have this attribute) Since this is my first encounter with Perl, i don't really know how to start. My main problem is how i should "implement" the inventory in the program. One of the functions of the program is searching trough the titles. Another is to make an order, where the user should give a product code. My first idea was a hashtable with the productcode as key. But if i wanted to search in the titles that could be a problem because of this: the hashkey would be something like DVD-123, the information belonging to that key could be "The Green Mask 12" (without the ") where the 12 indicates how many of this DVD are currently in stock. So i'd have to find a way to ignore the 12 in the end. Another solution was to use the title as Hashkey, but that would prove cumbersome too I think. Is there a way to make a hashtable with 2 key's, and when I give only one it returns an array with the other values? (Including the other key and the other information) That way I could use another key depending on what info I need from my inventory. We have to read the default inventory from a txt file looking like this: MP3-72|Lady Gaga - Kiss and Run (Fear of Commitment Monster)|0.99 CD-400|Kings of Leon - Only By The Night|14.50|2 MP3-401|Kings of Leon - Closer|0.85 DVD-144|Live Free or Die Hard|14.99|2 SOFT-864|Windows Vista|49.95 Any help would be appreciated very much :) PS: I am sorry for my bad grammar, English isn't my native language.

    Read the article

  • NSFetchedResultsController sections localized sorted

    - by Gerd
    How could I use the NSFetchedResultsController with translated sort key and sectionKeyPath? Problem: I have ID in the property "type" in the database like typeA, typeB, typeC,... and not the value directly because it should be localized. In English typeA=Bird, typeB=Cat, typeC=Dog in German it would be Vogel, Katze, Hund. With a NSFetchedResultController with sort key and sectionKeyPath on "type" I receive the order and sections - typeA - typeB - typeC Next I translate for display and everything is fine in English: - Bird - Cat - Dog Now I switch to German and receive a wrong sort order - Vogel - Katze - Hund because it still sorts by typeA, typeB, typeC So I'm looking for a way to localize the sort for the NSFetchedResultsController. I tried the transient property approach, but this doesn't work for the sort key because the sort key need to be in the entity. I have no other idea. But I can't believe that's not possible to use NSFetchedResultsController on a derived attribute required for localization? There are related discussions like http://stackoverflow.com/questions/1384345/using-custom-sections-with-nsfetchedresultscontroller but the difference is that the custom section names and the sort key have probably the same order. Not in my case and this is the main difference. At the end I would need a sort order for the necessary NSSortDescriptor on a derived attribute, I guess. This sort order has also to serve for the sectionKeyPath. Thanks for any hint.

    Read the article

  • What software analogies have helped you?

    - by Galwegian
    I have often enjoyed the use of analogies in understanding a software scenario or problem. For example, to understand the concept of public key encryption, the 'locked mailbox' analogy or similar is often used as an aid: An analogy for public-key encryption is that of a locked mailbox with a mail slot. The mail slot is exposed and accessible to the public; its location (the street address) is in essence the public key. Anyone knowing the street address can go to the door and drop a written message through the slot; however, only the person who possesses the key can open the mailbox and read the message. My question is: What analogies have you used or heard of in your career that have given you that "Eureka" moment with a complex concept? EDIT: If you have a good one, don't just state the name, please share with the group!

    Read the article

  • Design for tagging system in GAE-J

    - by tempy
    I need a simple tagging system in GAE-J. As I see it, the entity that is being tagged should have a collection of keys referring to the tags with which it's associated. A tag entity should simply contain the tag string itself, and a collection of keys pointing to the entities associated with the tag. When an entity's list of tags is altered, the system will create a new tag if the tag is unknown, and then append the entity's key to that tag's key collection. If the tag already exists, then the entity's key is simply appended to the tag's key collection. This seems relatively straight-forward and uncontroversial to me, but I would like some feedback on this design, just to be sure.

    Read the article

  • Mysql select - improve performance

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated.

    Read the article

  • Rewrite SQL Fulltext Function to return Table only

    - by Alex
    I have a MS SQL Fulltext Function like this: (...) RETURNS TABLE AS RETURN SELECT * FROM fishes INNER JOIN CONTAINSTABLE(fishes, *, @keywords, @limit) AS KEY_TBL ON fishes.id = KEY_TBL.[KEY] When I use this function in LINQ, it generates a special return type which includes all fields of my "fishes" table, plus Key and Rank. How could I rewrite above query, or change something in LINQ, to omit Key and Rank and just return my "fishes" results (and to have the fulltext search result objects be of type Fish, which is what I really care about, so I don't have to cast)?

    Read the article

  • How do I join three tables with SQLalchemy and keeping all of the columns in one of the tables?

    - by jimka
    So, I have three tables: The class defenitions: engine = create_engine('sqlite://test.db', echo=False) SQLSession = sessionmaker(bind=engine) Base = declarative_base() class Channel(Base): __tablename__ = 'channel' id = Column(Integer, primary_key = True) title = Column(String) description = Column(String) link = Column(String) pubDate = Column(DateTime) class User(Base): __tablename__ = 'user' id = Column(Integer, primary_key = True) username = Column(String) password = Column(String) sessionId = Column(String) class Subscription(Base): __tablename__ = 'subscription' userId = Column(Integer, ForeignKey('user.id'), primary_key=True) channelId = Column(Integer, ForeignKey('channel.id'), primary_key=True) And the SQL commands that are executed to create them: CREATE TABLE subscription ( "userId" INTEGER NOT NULL, "channelId" INTEGER NOT NULL, PRIMARY KEY ("userId", "channelId"), FOREIGN KEY("userId") REFERENCES user (id), FOREIGN KEY("channelId") REFERENCES channel (id) ); CREATE TABLE user ( id INTEGER NOT NULL, username VARCHAR, password VARCHAR, "sessionId" VARCHAR, PRIMARY KEY (id) ); CREATE TABLE channel ( id INTEGER NOT NULL, title VARCHAR, description VARCHAR, link VARCHAR, "pubDate" TIMESTAMP, PRIMARY KEY (id) ); NOTE: I know user.username should be unique, need to fix that, and I'm not sure why SQLalchemy creates some row names with the double-quotes. And I'm trying to come up with a way to retrieve all of the channels, as well as an indication on what channels one particular user (identified by user.sessionId together with user.id) has a subscription on. For example, say we have four channels: channel1, channel2, channel3, channel4; a user: user1; who has a subscription on channel1 and channel4. The query for user1 would return something like: channel.id | channel.title | subscribed --------------------------------------- 1 channel1 True 2 channel2 False 3 channel3 False 4 channel4 True This is a best-case result, but since I have absolutely no clue as how to accomplish the subscribed column, I've been instead trying to get the particular users id in the rows where the user has a subscription and where a subscription is missing, just leave it blank. The database engine that I'm using together with SQLalchemy atm. is sqlite3 I've been scratching my head over this for two days now, I've no problem joining together all three by way of the subscription table but then all of the channels where the user does not have a subscription gets omitted. I hope I've managed to describe my problem sufficiently, thanks in advance.

    Read the article

  • atk4 advanced crud?

    - by thindery
    I have the following tables: -- ----------------------------------------------------- -- Table `product` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `product` ( `id` INT NOT NULL AUTO_INCREMENT , `productName` VARCHAR(255) NULL , `s7location` VARCHAR(255) NULL , PRIMARY KEY (`id`) ) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `pages` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `pages` ( `id` INT NOT NULL AUTO_INCREMENT , `productID` INT NULL , `pageName` VARCHAR(255) NOT NULL , `isBlank` TINYINT(1) NULL , `pageOrder` INT(11) NULL , `s7page` INT(11) NULL , PRIMARY KEY (`id`) , INDEX `productID` (`productID` ASC) , CONSTRAINT `productID` FOREIGN KEY (`productID` ) REFERENCES `product` (`id` ) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `field` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `field` ( `id` INT NOT NULL AUTO_INCREMENT , `pagesID` INT NULL , `fieldName` VARCHAR(255) NOT NULL , `fieldType` VARCHAR(255) NOT NULL , `fieldDefaultValue` VARCHAR(255) NULL , PRIMARY KEY (`id`) , INDEX `id` (`pagesID` ASC) , CONSTRAINT `pagesID` FOREIGN KEY (`pagesID` ) REFERENCES `pages` (`id` ) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; I have gotten CRUD to work on the 'product' table. //addproduct.php class page_addproduct extends Page { function init(){ parent::init(); $crud=$this->add('CRUD')->setModel('Product'); } } This works. but I need to get it so that when a new product is created it basically allows me to add new rows into the pages and field tables. For example, the products in the tables are a print product(like a greeting card) that has multiple pages to render. Page 1 may have 2 text fields that can be customized, page 2 may have 3 text fields, a slider to define text size, and a drop down list to pick a color, and page 3 may have five text fields that can all be customized. All three pages (and all form elements, 12 in this example) are associated with 1 product. So when I create the product, could i add a button to create a page for that product, then within the page i can add a button to add a new form element field? I'm still somewhat new to this, so my db structure may not be ideal. i'd appreciate any suggestions and feedback! Could someone point me toward some information, tutorials, documentation, ideas, suggestions, on how I can implement this?

    Read the article

  • CodePlex Daily Summary for Wednesday, June 26, 2013

    CodePlex Daily Summary for Wednesday, June 26, 2013Popular ReleasesNaked Objects: Naked Objects Release 5.5.0: This release includes a number of significant improvements to the usability of the UI, some of which involve new programming conventions or attributes: Action dialogs now appear as pop-up modal dialogs instead of as a new page; query-only actions have an Apply as well as an OK button. See https://nakedobjects.codeplex.com/workitem/175 When a reference object is expanded in-line there is a button to jump straight to an Edit view of that object see https://nakedobjects.codeplex.com/workitem/1...VeraCrypt: VeraCrypt version 1.0b: Changes since version 1.0a :Enhance RIPEMD160 implementation in BootLoaded by using the compiler uint32 type Don't position legacy flag in volume header for newer VeraCrypt releasesPlayer Framework by Microsoft: Player Framework for Windows 8 and WP8 (v1.3 beta): Preview: New MPEG DASH adaptive streaming plugin for WAMS. Preview: New Ultraviolet CFF plugin. Preview: New WP7 version with WP8 compatibility. (source code only) Source code is now available via CodePlex Git Misc bug fixes and improvements: WP8 only: Added optional fullscreen and mute buttons to default xaml JS only: protecting currentTime from returning infinity. Some videos would cause currentTime to be infinity which could cause errors in plugins expecting only finite values. (...SSIS DQS Matching Transformation: SSIS DQS Matching Transformation 1.0: Initial release of the SSIS DQS Matching Component.AssaultCube Reloaded: 2.5.8: SERVER OWNERS: note that the default maprot has changed once again. Linux has Ubuntu 11.10 32-bit precompiled binaries and Ubuntu 10.10 64-bit precompiled binaries, but you can compile your own as it also contains the source. If you are using Mac or other operating systems, please wait while we continue to try to package for those OSes. Or better yet, try to compile it. If it fails, download a virtual machine. The server pack is ready for both Windows and Linux, but you might need to compi...Compare .NET Objects: Version 1.7.2.0: If you like it, please rate it. :) Performance Improvements Fix for deleted row in a data table Added ability to ignore the collection order Fix for Ignoring by AttributesMicrosoft Ajax Minifier: Microsoft Ajax Minifier 4.95: update parser to allow for CSS3 calc( function to nest. add recognition of -pponly (Preprocess-Only) switch in AjaxMinManifestTask build task. Fix crashing bug in EXE when processing a manifest file using the -xml switch and an error message needs to be displayed (like a missing input file). Create separate Clean and Bundle build tasks for working with manifest files (AjaxMinManifestCleanTask and AjaxMinBundleTask). Removed the IsCleanOperation from AjaxMinManifestTask -- use AjaxMinMan...VG-Ripper & PG-Ripper: VG-Ripper 2.9.44: changes NEW: Added Support for "ImgChili.net" links FIXED: Auto UpdaterDocument.Editor: 2013.25: What's new for Document.Editor 2013.25: Improved Spell Check support Improved User Interface Minor Bug Fix's, improvements and speed upsStyleMVVM: 3.0.2: This is a minor feature and bug fix release Features: ExportWhenDebuggerIsAttacedAttribute - new attribute that marks an attribute to only be exported when the debugger is attahced InjectedFilterAttributeFilterProvider - new Attribute Filter provider for MVC that injects the attributes Performance Improvements - minor speed improvements all over, and Import collections is now 50% faster Bug Fixes: Open Generic Constraints are now respected when finding exports Fix for fluent registrat...WPF Composites: Version 4.3.0: In this Beta release, I broke my code out into two separate projects. There is a core FasterWPF.dll with the minimal required functionality. This can run with only the Aero.dll and the Rx .dll's. Then, I have a FasterWPFExtras .dll that requires and supports the Extended WPF Toolkit™ Community Edition V 1.9.0 (including Xceed DataGrid) and the Thriple .dll. This is for developers who want more . . . Finally, you may notice the other OPTIONAL .dll's available in the download such as the Dyn...Channel9's Absolute Beginner Series: Windows Phone 8: Entire source code for the Channel 9 series, Windows Phone 8 Development for Absolute Beginners.Indent Guides for Visual Studio: Indent Guides v13: ImportantThis release does not support Visual Studio 2010. The latest stable release for VS 2010 is v12.1. Version History Changed in v13 Added page width guide lines Added guide highlighting options Fixed guides appearing over collapsed blocks Fixed guides not appearing in newly opened files Fixed some potential crashes Fixed lines going through pragma statements Various updates for VS 2012 and VS 2013 Removed VS 2010 support Changed in v12.1: Fixed crash when unable to start...Fluent Ribbon Control Suite: Fluent Ribbon Control Suite 2.1.0 - Prerelease d: Fluent Ribbon Control Suite 2.1.0 - Prerelease d(supports .NET 3.5, 4.0 and 4.5) Includes: Fluent.dll (with .pdb and .xml) Showcase Application Samples (not for .NET 3.5) Foundation (Tabs, Groups, Contextual Tabs, Quick Access Toolbar, Backstage) Resizing (ribbon reducing & enlarging principles) Galleries (Gallery in ContextMenu, InRibbonGallery) MVVM (shows how to use this library with Model-View-ViewModel pattern) KeyTips ScreenTips Toolbars ColorGallery *Walkthrough (do...Magick.NET: Magick.NET 6.8.5.1001: Magick.NET compiled against ImageMagick 6.8.5.10. Breaking changes: - MagickNET.Initialize has been made obsolete because the ImageMagick files in the directory are no longer necessary. - MagickGeometry is no longer IDisposable. - Renamed dll's so they include the platform name. - Image profiles can now only be accessed and modified with ImageProfile classes. - Renamed DrawableBase to Drawable. - Removed Args part of PathArc/PathCurvetoArgs/PathQuadraticCurvetoArgs classes. The...Keyboard Image Viewer: 1.5.4: Upgraded folder picker dialog to better version on Win7+ Fixed bug that stopped slideshow from looping back to the start of the list. Added crash dialog that allows you to see and copy exception stack traces for fixing.DependencyAnalysis (Egg and Gherkin): 0.9.4: - Create Visual Studio 2012 Addin for ad-hoc analysis of your project - Display metrics in a grid - Adequate performing serialization between Addin (Visual Studio process) and AnalysisHost process - Display dependencies as graph (proximity graph) - Create a logo for the project - Constructors of anonymous types no longer hide constructors of the declaring type during "build dependencies" phase - Type descriptors were added multiple times to SubmoduleDescriptor. Types collection, same instanc...Bloomberg API Emulator: Bloomberg API Emulator (v 1.0.5): This version contains the full Java port of my original C# code. I just finished the MarketDataSubscription request type. I will start working on a C++ port of my C# code.Three-Dimensional Maneuver Gear for Minecraft: TDMG 1.1.0.0 for 1.5.2: CodePlex???(????????) ?????????(???1/4) ??????????? ?????????? ???????????(??????????) ??????????????????????? ↑????、?????????????????????(???????) ???、??????????、?????????????????????、????????1.5?????????? Shift+W(????)??????????????????10°、?10°(?????????)???Hyper-V Management Pack Extensions 2012: HyperVMPE2012 (v1.0.1.126): Hyper-V Management Pack Extensions 2012 Beta ReleaseNew Projects.Net Encryption App: This is a C#.Net desktop application that will let users encrypt and de-crypt files with the algorithm of their choosing.AutoSPDocumenter: AutoSPDocumenter utilises PowerShell to document SharePoint farms and provide output in usable formats.Azure Storage Redirector: Azure Storage Redirector. Redirects requests to Global Azure Storage to China Azure Storage. ?????Azure Storage?request??????Azure storagebrownbag: Simple project to show branching, merging, and shelvingChannel9's Absolute Beginner Series: Channel 9's absolute beginner series source code. From Windows Phone 7, Windows Phone 8, Windows Store applications, one stop area for all the seriesFAST for Sharepoint 2010 Query Tool (.NET 3.5): .NET 3.5 version of the FAST Search for SharePoint MOSS 2010 Query Tool (https://fastforsharepoint.codeplex.com/). For environments without .NET 4.0HAOest Framework: HAOest????ListManager: ListManager????? by HADB of HAOestMyPS: mypsNNRel: NNRelO - BV - 2: TestOpen XML SDK for JavaScript: Small JavaScript library that enables you to implement Open XML functionality anywhere you can use JavaScript.Orchard Prefix free: Provides a script manifest for the Prefix free script libraries.PVDesktop: PVDesktop is an application for designing and analyzing specific solar energy sites.Red the sound TowePlay: School project at ISEN Lille. Creation of a collaborative music creation software in C# using.NETScience Kits for Kids: This project is the service for Childhood Education which aged 4 - 8.SharePoint ULS for PowerShell: Allows PowerShell to log to the SharePoint ULS.SSIS DQS Matching Transformation: The SSIS DQS Matching Transformation uses Data Quality Services (DQS) to find duplicate data within the SSIS data flow.TARVOS Computer Networks Simulator: Discrete event-based network simulator, supports simulating MPLS architecture, several RSVP-TE protocol functionalities and fast recovery.Web API Explorer 4 DNN: Web API Explorer for DNN(R) aids module development allowing you to examine the Routing Table entries for a DotNetNuke(R) portal.

    Read the article

  • A scheme for expiring downloaded content?

    - by Chad Johnson
    I am going to offer a web API service that allows users to download and "rent" content for a monthly subscription fee. The API will either be open to everyone or possibly just select parties (not sure yet). Each developer must agree to a license, and they receive a developer key for their person. Each software application will have its own key as well. So then end-users will download the software which will interact with my service's API. Each user will have a key for each application as well (probably using OAuth). Content will be cached on first download and accessible offline via just the third-party application that cached the content. If a user cancels their subscription, I plan on doing the following: Deactivate the user's OAuth key for all applications. Do not allow the user's account to download new content via the API (and subsequently any software that uses the API). Now, the big question is: how do I make content expire if they cancel their subscription? If they cancel, they should not have access to content anymore. Here are ideas I've thought of (some of these are half-solutions, not yet fully fleshed out): Require that applications encrypt downloaded content using the user's OAuth key, making it available to only the application. This will prevent most users from going to the cache directory and just copying and keeping files. Update the user's key once a month, forcing content to re-cache on a monthly basic. Users could then access content for a month after they cancel their subscription. Require applications to "phone home" [to the service] periodically and check whether the user's subscription has terminated. If so, require in the API developer license that applications expire cache. If it is found that applications do not comply, their keys (and possibly keys for all developers) are permanently deactivated as a consequence. One major worry is that some applications may blatantly ignore constraints of the license. Is it generally acceptable to rely on applications abiding by the licensing constraints? Bad idea? Any other ideas? Maybe a way to make content auto-expire after x days? Something else? I'm open to out-of-the-box ideas.

    Read the article

  • SQLIO Writes

    - by Grant Fritchey
    SQLIO is a fantastic utility for testing the abilities of the disks in your system. It has a very unfortunate name though, since it's not really a SQL Server testing utility at all. It really is a disk utility. They ought to call it DiskIO because they'd get more people using I think. Anyway, branding is not the point of this blog post. Writes are the point of this blog post. SQLIO works by slamming your disk. It performs as mean reads as it can or it performs as many writes as it can depending on how you've configured your tests. There are much smarter people than me who will get into all the various types of tests you should run. I'd suggest reading a bit of what Jonathan Kehayias (blog|twitter) has to say or wade into Denny Cherry's (blog|twitter) work. They're going to do a better job than I can describing all the benefits and mechanisms around using this excellent piece of software. My concerns are very focused. I needed to set up a series of tests to see how well our product SQL Storage Compress worked. I wanted to know the effects it would have on a system, the disk for sure, but also memory and CPU. How to stress the system? SQLIO of course. But when I set it up and ran it, following the documentation that comes with it, I was seeing better than 99% compression on the files. Don't get me wrong. Our product is magnificent, wonderful, all things great and beautiful, gets you coffee in the morning and is made mostly from bacon. But 99% compression. No, it's not that good. So what's up? Well, it's the configuration. The default mechanism is to load up a file, something large that will overwhelm your disk cache. You're instructed to load the file with a character 0x0. I never got a computer science degree. I went to film school. Because of this, I didn't memorize ASCII tables so when I saw this, I thought it was zero's or something. Nope. It's NULL. That's right, you're making a very large file, but you're filling it with NULL values. That's actually ok when all you're testing is the disk sub-system. But, when you want to test a compression and decompression, that can be an issue. I got around this fairly quickly. Instead of generating a file filled with NULL values, I just copied a database file for my tests. And to test it with SQL Storage Compress, I used a database file that had already been run through compression (about 40% compression on that file if you're interested). Now the reads were taken care of. I am seeing very realistic performance from decompressing the information for reads through SQLIO. But what about writes? Well, the issue is, what does SQLIO write? I don't have access to the code. But I do have access to the results. I did two different tests, just to be sure of what I was seeing. First test, use the .DAT file as described in the documentation. I opened the .DAT file after I was done with SQLIO, using WordPad. Guess what? It's a giant file full of air. SQLIO writes NULL values. What does that do to compression? I did the test again on a copy of an uncompressed database file. Then I ran the original and the SQLIO modified copy through ZIP to see what happened. I got better than 99% compression out of the SQLIO modified file (original file of 624,896kb went to 275,871kb compressed, after SQLIO it went to 608kb compressed). So, what does SQLIO write? It writes air. If you're trying to test it with compression or maybe some other type of file storage mechanism like dedupe, you need to know this because your tests really won't be valid. Should I find some other mechanism for testing? Yeah, if all I'm interested in is establishing performance to my own satisfaction, yes. But, I want to be able to compare my results with other people's results and we all need to be using the same tool in order for that to happen. SQLIO is the common mechanism that most people I know use to establish disk performance behavior. It'd be better if we could get SQLIO to do writes in some other fashion. Oh, and before I go, I get to brag a bit. Measuring IOPS, SQL Storage Compress outperforms my disk alone by about 30%.

    Read the article

  • Database Modelling - Conceptually different entities but with near identical fields

    - by Andrew Shepherd
    Suppose you have two sets of conceptual entities: MarketPriceDataSet which has multiple ForwardPriceEntries PoolPriceForecastDataSet which has multiple PoolPriceForecastEntry Both different child objects have near identical fields: ForwardPriceEntry has MarketPriceDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForwardPrice PoolPriceForecastEntry has PoolPriceForecastDataSetId (foreign key to parent table) StartDate EndDate SimulationItemId ForecastPoolPrice If I modelled them as separate tables, the only difference would be the foreign key, and the name of the price field. There has been a debate as to whether the two near identical tables should be merged into one. Options I've thought of to model this is: Just keep them as two independent, separate tables Have both sets in the one table with an additional "type" field, and a parent_id equalling a foreign key to either parent table. This would sacrifice referential integrity checks. Have both sets in the one table with an additional "type" field, and create a complicated sequence of joining tables to maintain referential integrity. What do you think I should do, and why?

    Read the article

  • #OOW 2012 : IaaS, Private Cloud, Multitenant Database, and X3H2M2

    - by Eric Bezille
    The title of this post is a summary of the 4 announcements made by Larry Ellison today, during the opening session of Oracle Open World 2012... To know what's behind X3H2M2, you will have to wait a little, as I will go in order, beginning with the IaaS - Infrastructure as a Service - announcement. Oracle IaaS goes Public... and Private... Starting in 2004 with Fusion development, Oracle Cloud was launch last year to provide not only SaaS Application, based on standard development, but also the underlying PaaS, required to build the specifics, and required interconnections between applications, in and outside of the Cloud. Still, to cover the end-to-end Cloud  Services spectrum, we had to provide an Infrastructure as a Service, leveraging our Servers, Storage, OS, and Virtualization Technologies, all "Engineered Together". This Cloud Infrastructure, was already available for our customers to build rapidly their own Private Cloud either on SPARC/Solaris or x86/Linux... The second announcement made today bring that proposition a big step further : for cautious customers (like Banks, or sensible industries) who would like to benefits from the Cloud value of "as a Service", but don't want their Data out in the Cloud... We propose to them to operate the same systems, Exadata, Exalogic & SuperCluster, that are providing our Public Cloud Infrastructure, behind their firewall, in a Private Cloud model. Oracle 12c Multitenant Database This is also a major announcement made today, on what's coming with Oracle Database 12c : the ability to consolidate multiple databases with no extra additional  cost especially in terms of memory needed on the server node, which is often THE consolidation limiting factor. The principle could be compare to Solaris Zones, where, you will have a Database Container, who is "owning" the memory and Database background processes, and "Pluggable" Database in this Database Container. This particular feature is a strong compelling event to evaluate rapidly Oracle Database 12c once it will be available, as this is major step forward into true Database consolidation with Multitenancy on a shared (optimized) infrastructure. X3H2M2, enabling the new Exadata X3 in-Memory Database Here we are :  X3H2M2 stands for X3 (the new version of Exadata announced also today) Heuristic Hierarchical Mass Memory, providing the capability to keep most if not all the Data in the memory cache hierarchy. Of course, this is the major software enhancement of the new X3 Exadata machine, but as this is a software, our current customers would be able to benefit from it on their existing systems by upgrading to the new release. But that' not the only thing that we did with X3, at the same time we have upgraded everything : the CPUs, adding more cores per server node (16 vs. 12, with the arrival of Intel E5 / Sandy Bridge), the memory with 512GB memory as well per node,  and the new Flash Fire card, bringing now up to 22 TB of Flash cache. All of this 4TB of RAM + 22TB of Flash being use cleverly not only for read but also for write by the X3H2M2 algorithm... making a very big difference compare to traditional storage flash extension. But what does those extra performances brings to you on an already very efficient system: double your performances compare to the fastest storage array on the market today (including flash) and divide you storage price x10 at the same time... Something to consider closely this days... Especially that we also announced the availability of a new Exadata X3-2 8th rack : a good starting point. As you have seen a major opening for this year again with true innovation. But that was not the only thing that we saw today, as before Larry's talk, Fujitsu did introduce more in deep the up coming new SPARC processor, that they are co-developing with us. And as such Andrew Mendelsohn - Senior Vice President Database Server Technologies came on stage to explain that the next step after I/O optimization for Database with Exadata, was to accelerate the Database at execution level by bringing functions in the SPARC processor silicium. All in all, to process more and more Data... The big theme of the day... and of the Oracle User Groups Conferences that were also happening today and where I had the opportunity to attend some interesting sessions on practical use cases of Big Data one in Finances and Fraud profiling and the other one on practical deployment of Oracle Exalytics for Data Analytics. In conclusion, one picture to try to size Oracle Open World ... and you can understand why, with such a rich content... and this only the first day !

    Read the article

  • how to change string values in dictionary to int values

    - by tom smith
    I have a dictionary such as: {'Sun': {'Satellites': 'Mercury,Venus,Earth,Mars,Jupiter,Saturn,Uranus,Neptune,Ceres,Pluto,Haumea,Makemake,Eris', 'Orbital Radius': '0', 'Object': 'Sun', 'RootObject': 'Sun', 'Radius': '20890260'}, 'Earth': {'Period': '365.256363004', 'Satellites': 'Moon', 'Orbital Radius': '77098290', 'Radius': '63710.41000.0', 'Object': 'Earth'}, 'Moon': {'Period': '27.321582', 'Orbital Radius': '18128500', 'Radius': '1737000.10', 'Object': 'Moon'}} I am wondering how to change just the number values to ints instead of strings. def read_next_object(file): obj = {} for line in file: if not line.strip(): continue line = line.strip() key, val = line.split(": ") if key in obj and key == "Object": yield obj obj = {} obj[key] = val yield obj planets = {} with open( "smallsolar.txt", 'r') as f: for obj in read_next_object(f): planets[obj["Object"]] = obj print(planets)

    Read the article

  • Disable Internet Explorer 8 Developer Tools

    - by Steve Brouillard
    Is there a way to either disable Internet Explorer 8 Developer Tools, or at least change the shortcut key mapping? I'm working on an ASP.NET AJAX app that has used the F12 key for a function for years (it's actually a hold over from the original DOS app). Customers have used this key for the sam function for nearly 15 years and we'd really like to avoid having to move that function. Cheers

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • DataGridView Cell Validating only when 'Enter' is pressed

    - by Eldad
    Hi, I want to validate and commit the value entered in the DataGridViewCell ONLY when the user presses the 'Enter' key. If the users presses any other key or mouse button (Arrow keys, Pressing a different cell using the mouse...), I want the behavior to be similar to the 'ESC' key: Move the focus to the new cell and revert the edited cell value to its previous value.

    Read the article

< Previous Page | 232 233 234 235 236 237 238 239 240 241 242 243  | Next Page >