Search Results

Search found 13435 results on 538 pages for 'human capital management'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 254/538 | < Previous Page | 250 251 252 253 254 255 256 257 258 259 260 261  | Next Page >

  • How much do politics/office intrigue interfere with your day to day tasks at work?

    - by Michael Dorgan
    I'm currently blessed to be employed at a location where politics are pretty much non-existant and management overhead is nearly nil. As I've only worked at this one location for my entire, lengthy career, I have very little frame of reference outside of an occasional Dilbert comic or offhand comment from others about just how bad office politics and management interference get in the way of getting your code done elsewhere. While I'm not actively looking for a new job, this one point has made me quite reluctant to even look seriously elsewhere. My question is, just how much are politics a way of life in larger companies - in or out of the game industry and how much does it affect your day to day satisfaction?

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Sorting a list of colors in one dimension?

    - by Ptah- Opener of the Mouth
    I would like to sort a one-dimensional list of colors so that colors that a typical human would perceive as "like" each other are near each other. Obviously this is a difficult or perhaps impossible problem to get "perfectly", since colors are typically described with three dimensions, but that doesn't mean that there aren't some sorting methods that look obviously more natural than others. For example, sorting by RGB doesn't work very well, as it will sort in the following order, for example: (1) R=254 G=0 B=0 (2) R=254 G=255 B=0 (3) R=255 G=0 B=0 (4) R=255 G=255 B=0 That is, it will alternate those colors red, yellow, red, yellow, with the two "reds" being essentially imperceivably different than each other, and the two yellows also being imperceivably different from each other. But sorting by HLS works much better, generally speaking, and I think HSL even better than that; with either, the reds will be next to each other, and the yellows will be next to each other. But HLS/HSL has some problems, too; things that people would perceive as "black" could be split far apart from each other, as could things that people would perceive as "white". Again, I understand that I pretty much have to accept that there will be some splits like this; I'm just wondering if anyone has found a better way than HLS/HSL. And I'm aware that "better" is somewhat arbitrary; I mean "more natural to a typical human". For example, a vague thought I've had, but have not yet tried, is perhaps "L is the most important thing if it is very high or very low", but otherwise it is the least important. Has anyone tried this? Has it worked well? What specifically did you decide "very low" and "very high" meant? And so on. Or has anyone found anything else that would improve upon HSL? I should also note that I am aware that I can define a space-filling curve through the cube of colors, and order them one-dimensionally as they would be encountered while travelling along that curve. That would eliminate perceived discontinuities. However, it's not really what I want; I want decent overall large-scale groupings more than I want perfect small-scale groupings. Thanks in advance for any help.

    Read the article

  • Memory Allocation - Arduino

    - by Joey Arnold Andres
    I'm new to this low level stuff. I'm currently learning arduino. I'm currently using an Arduino Mega 2560 and in our course we are practicing memory management. I'm a pro at memory management in pc but somehow I'm having crazy problems here in arduino. For instance: The arduino have 8192B, I'm trying to overflow it with uint_16 so I made an array of 8192/16 which is 512. so I did uint16_t A[512+1]; Well I expected that to cause an overflow. What is wrong with my concept?

    Read the article

  • Accurev SCM

    - by FlySwat
    Does anyone use Accurev for Source Control Management? We are switching (eventually) from StarTeam to Accurev. My initial impression is that the GUI tool is severely lacking, however the underlying engine, and the branches as streams concept is incredible. The biggest difficulty we are facing is assessing our own DIY tools that interfaced with starteam, and either replacing them with DIY new tools, or finding and purchasing appropriate replacements. Additionally, is anyone using the AccuWork component for Issue management? Starteam had a very nice change request system, and AccuWork does not come close to matching it. We are evaluating either using Accuwork, or buying a 3rd party package such as JIRA. Opinions?

    Read the article

  • What policies are standard for programmers?

    - by Shehket's Apprentice
    My office is about has proposed implementing some extremely strict (I would consider them draconian) policies regarding programmers, and our access due to security concerns (note, we have never had a security breach). While I can theoretically get used to them, I'd like to ask about what is considered good security policy for programmers, specifically in the area of access policies, and what is too much? Any answers to this question are greatly appreciated as they directly relate to my ability to write code, and I can't find anything so far on Google. Edit: Most of the security policies that concern me are about access to my machine and to the code. According to these proposed policies, I'd need management approval to access either, which means that I'd be forced to get management to unlock my computer anytime I leave my desk as my computer is always locked when I'm not at my desk.

    Read the article

  • how to initialize spring bean from database

    - by wavelet
    hi,i use spring security and my config is in database: <sec:http auto-config="true" entry-point-ref="casProcessingFilterEntryPoint"> <sec:remember-me /> <sec:session-management> <sec:concurrency-control max-sessions="1" error-if-maximum-exceeded="true" /> </sec:session-management> <sec:logout logout-success-url="${host.url}/logout/" /> <sec:custom-filter ref="casAuthenticationFilter" after="CAS_FILTER" /> <sec:custom-filter ref="filterInvocationInterceptor" before="FILTER_SECURITY_INTERCEPTOR" /> </sec:http> like ${host.url} is in database how can i initialize ?

    Read the article

  • Does Google punish content duplication across multiple country domains?

    - by Logan Koester
    I like the way Google handles internationalization, with domains such as google.co.uk, google.nl, google.de etc. I'd like to do this for my own site, but I'm concerned that Google will interpret this as content duplication, particularly across countries that speak the same human language, as there won't be any translation to hint that the content is different. My site is a web application, not a content farm, so is this a legitimate concern? Would I be better off with subdomains of my .com? Directories?

    Read the article

  • How do I distinguish files and folders on an FTP server

    - by soulmerge
    I want to list all files on an FTP server using PHP. According to RFC 959 the FTP command LIST is allowed to print arbitrary human-readable information on files/folders, which seems to make it impossible to determine the file type correctly. But how do other FTP clients manage to distinguish files and folders? Is there an unwritten standard or such?

    Read the article

  • Documenting software architectures that serve multiple markets

    - by wsb3383
    Hello, I'm the lead developer/architect wanna-be on a J2EE based system/platform at work that serves both real estate and automotive markets. The systems consists of a set of database back ends, web services and two web clients. The platform ends up serving 3 different products: an internal vehicle inventory system for use by company analysts, an external dealer management system (commercialized product), and a real estate inventory system (commercialized). In other words, it follows a software product lines approach....My question is, I'm having trouble communicating to other technical and some business people how this platform architecture is one system that serves multiple markets (by leveraging some existing assets combined with minor modifications)....Is there a formal modeling language that can simplify communicating this intent? I should note that I haven't read much about software product lines, so I'm not sure if there is actually a standard modeling approach to SPL that i'm not aware of....I'm also interested in knowing if there are special configuration management practices for such systems. thanks,

    Read the article

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Strategy for developing a multi function asp.net web application

    - by user247023
    I'm about to start a new project and want some advice on how to implement. I need a web application which contains a booking module for reserving timeslots, and a time management module which will enable employees to clock in / clock out. If I am writing an update to the time managment module, I don't want to disrupt the booking engine availability by releasing a new solution containing both modules. to make things more difficult, there is some shared functionality like common users, roles and security. Here's a suggestion I've gotten, which sounds a bit cruddy, but may be functional. Write a 'container' web application which consists of basically a frame, and authentication / security features. This then has links which, will load the 2 independantly built and released web applications into the frame. I can see that say, if I wanted to update the time management module, I would only need to build and release this separately, and the rest of the solution would be 'untouched' Any better alternatives?

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • CMS for SmartPhones

    - by dde
    The company I work for has a document management and retrieval system. We are noticing employees use more their smartphones than their laptops, but they cannot access the document management system. So, we are thinking about a CMS, with persistent storage, perhaps developed in Java. I just started looking into Jease and dotCMS, and also checked here those recommendations in questions like "Best Open Source Java CMS", etc I find some CMSs too bulky for simple stuff like what we need which is basically document download/edit/upload, and some simple collaboration and personalization stuff. Smartphones of choice in our workforce are Nokia, Blackberry and IPhone, The question is: are there java based with persistent db CMSs aimed at Smartphones right now? I need replication of the complete database and run website offline.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 250 251 252 253 254 255 256 257 258 259 260 261  | Next Page >