Search Results

Search found 12558 results on 503 pages for 'publish location'.

Page 26/503 | < Previous Page | 22 23 24 25 26 27 28 29 30 31 32 33  | Next Page >

  • SkyDrive broken after upgrade to Windows 8.1: "This location can't be found, please try later"

    - by avo
    Upgrading from Windows 8 to Windows 8.1 via the Store upgrade path has screwed my SkyDrive. The C:\Users\<user name>\SkyDrive folder is empty (it only has single file desktop.ini). When I open the native (Store) SkyDrive app, I see "This location can't be found, please try later". I'm glad to still have my files alive online in my SkyDrive account. I tried disconneting from / reconnecting to my Microsoft Account with no luck. Anyone has an idea on how to fix this without reinstalling/refreshing Windows 8.1? From Event Viewer: Faulting application name: skydrive.exe, version: 6.3.9600.16412, time stamp: 0x5243d370 Faulting module name: unknown, version: 0.0.0.0, time stamp: 0x00000000 Exception code: 0x00000000 Fault offset: 0x0000000000000000 Faulting process ID: 0x4e8 Faulting application start time: 0x01cece256589c7ee Faulting application path: C:\Windows\System32\skydrive.exe Faulting module path: unknown Report ID: {...} Faulting package full name: Faulting package-relative application ID: Also: The machine-default permission settings do not grant Local Activation permission for the COM Server application with CLSID {C2F03A33-21F5-47FA-B4BB-156362A2F239} and APPID {316CDED5-E4AE-4B15-9113-7055D84DCC97} to the user NT AUTHORITY\LOCAL SERVICE SID (S-1-5-19) from address LocalHost (Using LRPC) running in the application container Unavailable SID (Unavailable). This security permission can be modified using the Component Services administrative tool. Never was a big fan of in-place upgrade anyway, but this time it was a machine which I use for work, with a lot of stuff already installed on it. Shouldn't have tried to upgrade it in the first place, but was convinced Windows 8.1 is a solid update. Another lesson learnt.

    Read the article

  • Default /server-status location not inheriting in Apache

    - by rmalayter
    I'm having a problem getting /server-status to work Apache 2.2.14 on Ubuntu Server 10.04.1. The default symlinks for status.load and status.conf are present in /etc/apache2/mods-enabled. The status.conf does include the location /server-status and appropriate allow/deny directives. However, the only vhost I have in sites-enabled looks like this. The idea is to proxy anything with a Tomcat URL to a cluster of tomcats, and anything else to an IIS box. However, this seems to result in requests to /server-status being sent to IIS. Copying the /server-status in explicitly to the Vhost configuration doesn't seem to help, no matter what order I use. Is it possible to include /server-status do this within a vhost configuration that has a "default" proxy rule?: <VirtualHost *:80> ServerAdmin webmaster@localhost DocumentRoot /var/www Header add Set-Cookie "ROUTEID=.%{BALANCER_WORKER_ROUTE}e; path=/" env=BALANCER_ROUTE_CHANGED <Proxy balancer://tomcatCluster> BalancerMember ajp://qa-app1:8009 route=1 BalancerMember ajp://qa-app2:8009 route=2 ProxySet stickysession=ROUTEID </Proxy> <ProxyMatch "^/(mytomcatappA|mytomcatappB)/(.*)" > ProxyPassMatch balancer://tomcatCluster/$1/$2 </ProxyMatch> #proxy anything that's not a tomcat URL to IIS on port 80 <Proxy /> ProxyPass http://qa-web1/ </Proxy>

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • CI Deployment Of Azure Web Roles Using TeamCity

    - by srkirkland
    After recently migrating an important new website to use Windows Azure “Web Roles” I wanted an easier way to deploy new versions to the Azure Staging environment as well as a reliable process to rollback deployments to a certain “known good” source control commit checkpoint.  By configuring our JetBrains’ TeamCity CI server to utilize Windows Azure PowerShell cmdlets to create new automated deployments, I’ll show you how to take control of your Azure publish process. Step 0: Configuring your Azure Project in Visual Studio Before we can start looking at automating the deployment, we should make sure manual deployments from Visual Studio are working properly.  Detailed information for setting up deployments can be found at http://msdn.microsoft.com/en-us/library/windowsazure/ff683672.aspx#PublishAzure or by doing some quick Googling, but the basics are as follows: Install the prerequisite Windows Azure SDK Create an Azure project by right-clicking on your web project and choosing “Add Windows Azure Cloud Service Project” (or by manually adding that project type) Configure your Role and Service Configuration/Definition as desired Right-click on your azure project and choose “Publish,” create a publish profile, and push to your web role You don’t actually have to do step #4 and create a publish profile, but it’s a good exercise to make sure everything is working properly.  Once your Windows Azure project is setup correctly, we are ready to move on to understanding the Azure Publish process. Understanding the Azure Publish Process The actual Windows Azure project is fairly simple at its core—it builds your dependent roles (in our case, a web role) against a specific service and build configuration, and outputs two files: ServiceConfiguration.Cloud.cscfg: This is just the file containing your package configuration info, for example Instance Count, OsFamily, ConnectionString and other Setting information. ProjectName.Azure.cspkg: This is the package file that contains the guts of your deployment, including all deployable files. When you package your Azure project, these two files will be created within the directory ./[ProjectName].Azure/bin/[ConfigName]/app.publish/.  If you want to build your Azure Project from the command line, it’s as simple as calling MSBuild on the “Publish” target: msbuild.exe /target:Publish Windows Azure PowerShell Cmdlets The last pieces of the puzzle that make CI automation possible are the Azure PowerShell Cmdlets (http://msdn.microsoft.com/en-us/library/windowsazure/jj156055.aspx).  These cmdlets are what will let us create deployments without Visual Studio or other user intervention. Preparing TeamCity for Azure Deployments Now we are ready to get our TeamCity server setup so it can build and deploy Windows Azure projects, which we now know requires the Azure SDK and the Windows Azure PowerShell Cmdlets. Installing the Azure SDK is easy enough, just go to https://www.windowsazure.com/en-us/develop/net/ and click “Install” Once this SDK is installed, I recommend running a test build to make sure your project is building correctly.  You’ll want to setup your build step using MSBuild with the “Publish” target against your solution file.  Mine looks like this: Assuming the build was successful, you will now have the two *.cspkg and *cscfg files within your build directory.  If the build was red (failed), take a look at the build logs and keep an eye out for “unsupported project type” or other build errors, which will need to be addressed before the CI deployment can be completed. With a successful build we are now ready to install and configure the Windows Azure PowerShell Cmdlets: Follow the instructions at http://msdn.microsoft.com/en-us/library/windowsazure/jj554332 to install the Cmdlets and configure PowerShell After installing the Cmdlets, you’ll need to get your Azure Subscription Info using the Get-AzurePublishSettingsFile command. Store the resulting *.publishsettings file somewhere you can get to easily, like C:\TeamCity, because you will need to reference it later from your deploy script. Scripting the CI Deploy Process Now that the cmdlets are installed on our TeamCity server, we are ready to script the actual deployment using a TeamCity “PowerShell” build runner.  Before we look at any code, here’s a breakdown of our deployment algorithm: Setup your variables, including the location of the *.cspkg and *cscfg files produced in the earlier MSBuild step (remember, the folder is something like [ProjectName].Azure/bin/[ConfigName]/app.publish/ Import the Windows Azure PowerShell Cmdlets Import and set your Azure Subscription information (this is basically your authentication/authorization step, so protect your settings file Now look for a current deployment, and if you find one Upgrade it, else Create a new deployment Pretty simple and straightforward.  Now let’s look at the code (also available as a gist here: https://gist.github.com/3694398): $subscription = "[Your Subscription Name]" $service = "[Your Azure Service Name]" $slot = "staging" #staging or production $package = "[ProjectName]\bin\[BuildConfigName]\app.publish\[ProjectName].cspkg" $configuration = "[ProjectName]\bin\[BuildConfigName]\app.publish\ServiceConfiguration.Cloud.cscfg" $timeStampFormat = "g" $deploymentLabel = "ContinuousDeploy to $service v%build.number%"   Write-Output "Running Azure Imports" Import-Module "C:\Program Files (x86)\Microsoft SDKs\Windows Azure\PowerShell\Azure\*.psd1" Import-AzurePublishSettingsFile "C:\TeamCity\[PSFileName].publishsettings" Set-AzureSubscription -CurrentStorageAccount $service -SubscriptionName $subscription   function Publish(){ $deployment = Get-AzureDeployment -ServiceName $service -Slot $slot -ErrorVariable a -ErrorAction silentlycontinue   if ($a[0] -ne $null) { Write-Output "$(Get-Date -f $timeStampFormat) - No deployment is detected. Creating a new deployment. " } if ($deployment.Name -ne $null) { #Update deployment inplace (usually faster, cheaper, won't destroy VIP) Write-Output "$(Get-Date -f $timeStampFormat) - Deployment exists in $servicename. Upgrading deployment." UpgradeDeployment } else { CreateNewDeployment } }   function CreateNewDeployment() { write-progress -id 3 -activity "Creating New Deployment" -Status "In progress" Write-Output "$(Get-Date -f $timeStampFormat) - Creating New Deployment: In progress"   $opstat = New-AzureDeployment -Slot $slot -Package $package -Configuration $configuration -label $deploymentLabel -ServiceName $service   $completeDeployment = Get-AzureDeployment -ServiceName $service -Slot $slot $completeDeploymentID = $completeDeployment.deploymentid   write-progress -id 3 -activity "Creating New Deployment" -completed -Status "Complete" Write-Output "$(Get-Date -f $timeStampFormat) - Creating New Deployment: Complete, Deployment ID: $completeDeploymentID" }   function UpgradeDeployment() { write-progress -id 3 -activity "Upgrading Deployment" -Status "In progress" Write-Output "$(Get-Date -f $timeStampFormat) - Upgrading Deployment: In progress"   # perform Update-Deployment $setdeployment = Set-AzureDeployment -Upgrade -Slot $slot -Package $package -Configuration $configuration -label $deploymentLabel -ServiceName $service -Force   $completeDeployment = Get-AzureDeployment -ServiceName $service -Slot $slot $completeDeploymentID = $completeDeployment.deploymentid   write-progress -id 3 -activity "Upgrading Deployment" -completed -Status "Complete" Write-Output "$(Get-Date -f $timeStampFormat) - Upgrading Deployment: Complete, Deployment ID: $completeDeploymentID" }   Write-Output "Create Azure Deployment" Publish   Creating the TeamCity Build Step The only thing left is to create a second build step, after your MSBuild “Publish” step, with the build runner type “PowerShell”.  Then set your script to “Source Code,” the script execution mode to “Put script into PowerShell stdin with “-Command” arguments” and then copy/paste in the above script (replacing the placeholder sections with your values).  This should look like the following:   Wrap Up After combining the MSBuild /target:Publish step (which creates the necessary Windows Azure *.cspkg and *.cscfg files) and a PowerShell script step which utilizes the Azure PowerShell Cmdlets, we have a fully deployable build configuration in TeamCity.  You can configure this step to run whenever you’d like using build triggers – for example, you could even deploy whenever a new master branch deploy comes in and passes all required tests. In the script I’ve hardcoded that every deployment goes to the Staging environment on Azure, but you could deploy straight to Production if you want to, or even setup a deployment configuration variable and set it as desired. After your TeamCity Build Configuration is complete, you’ll see something that looks like this: Whenever you click the “Run” button, all of your code will be compiled, published, and deployed to Windows Azure! One additional enormous benefit of automating the process this way is that you can easily deploy any specific source control changeset by clicking the little ellipsis button next to "Run.”  This will bring up a dialog like the one below, where you can select the last change to use for your deployment.  Since Azure Web Role deployments don’t have any rollback functionality, this is a critical feature.   Enjoy!

    Read the article

  • How to get location of sprite placed on rotating circle in cocos2d android?

    - by Real_steel4819
    I am developing a game using cocos2d and i got stuck here when finding location of sprite placed on rotating circle on background, so that when i hit at certain position on circle its not getting hit at wanted position,but its going away from it and placing target there.I tried printing the position of hit on spriteMoveFinished() and ccTouchesEnded(). Its giving initial position and not rotated position. CGPoint location = CCDirector.sharedDirector().convertToGL(CGPoint.ccp(event.getX(), event.getY())); This is what i am using to get location.

    Read the article

  • Is there a way to publish IOS app from windows/Linux?

    - by user65760
    So I have been using Linux(especially, ubuntu) and windows(windows 7) for a long time . But i dont have a MAC, neither do i have an iphone. I do not actually want to buy them either . So the problem here is :how do i publish my app from windows or linux ? Kindly do understand i am not speaking about jailbroken programs(for jail broken i phones), i do not have any one near me who will lend me a MAC to publish my app . I started learning objective C some time ago. However, whenever i search the internet i get this information that there is no full proof way of publishing an app from windows or Linux . I also do intend to make it a paid app, meaning i dont wanna make it free. It will be very helpful if someone can suggest a way to overcome this problem .

    Read the article

  • How to create Large resumable download from a secured location .NET

    - by Kelvin H
    I need to preface I'm not a .NET coder at all, but to get partial functionality, I modified a technet chunkedfilefetch.aspx script that uses chunked Data Reading and writing Streamed method of doing file transfer, to get me half-way. iStream = New System.IO.FileStream(path, System.IO.FileMode.Open, _ IO.FileAccess.Read, IO.FileShare.Read) dataToRead = iStream.Length Response.ContentType = "application/octet-stream" Response.AddHeader("Content-Length", file.Length.ToString()) Response.AddHeader("Content-Disposition", "attachment; filename=" & filedownload) ' Read and send the file 16,000 bytes at a time. ' While dataToRead 0 If Response.IsClientConnected Then length = iStream.Read(buffer, 0, 16000) Response.OutputStream.Write(buffer, 0, length) Response.Flush() ReDim buffer(16000) ' Clear the buffer ' dataToRead = dataToRead - length Else ' Prevent infinite loop if user disconnects ' dataToRead = -1 End If End While This works great on files up to 2GB and is fully functioning now.. But only one problem it doesn't allow for resume. I took the original code called it fetch.aspx and pass an orderNUM through the URL. fetch.aspx&ordernum=xxxxxxx It then reads the filename/location from the database occording to the ordernumber, and chunks it out from a secured location NOT under the webroot. I need a way to make this resumable, by the nature of the internet and large files people always get disconnected and would like to resume where they left off. But any resumable articles i've read, assume the file is within the webroot.. ie. http://www.devx.com/dotnet/Article/22533/1954 Great article and works well, but I need to stream from a secured location. I'm not a .NET coder at all, at best i can do a bit of coldfusion, if anyone could help me modify a handler to do this, i would really appreciate it. Requirements: I Have a working fetch.aspx script that functions well and uses the above code snippet as a base for the streamed downloading. Download files are large 600MB and are stored in a secured location outside of the webroot. Users click on the fetch.aspx to start the download, and would therefore be clicking it again if it was to fail. If the ext is a .ASPX and the file being sent is a AVI, clicking on it would completely bypass an IHTTP handler mapped to .AVI ext, so this confuses me From what I understand the browser will read and match etag value and file modified date to determine they are talking about the same file, then a subsequent accept-range is exchanged between the browser and IIS. Since this dialog happens with IIS, we need to use a handler to intercept and respond accordingly, but clicking on the link would send it to an ASPX file which the handeler needs to be on an AVI fiel.. Also confusing me. If there is a way to request the initial HTTP request header containing etag, accept-range into the normal .ASPX file, i could read those values and if the accept-range and etag exist, start chunking at that byte value somehow? but I couldn't find a way to transfer the http request headers since they seem to get lost at the IIS level. OrderNum which is passed in the URL string is unique and could be used as the ETag Response.AddHeader("ETag", request("ordernum")) Files need to be resumable and chunked out due to size. File extensions are .AVI so a handler could be written around it. IIS 6.0 Web Server Any help would really be appreciated, i've been reading and reading and downloading code, but none of the examples given meet my situation with the original file being streamed from outside of the webroot. Please help me get a handle on these httphandlers :)

    Read the article

  • how to remove location block from $uri in nginx configuration?

    - by Jason
    I have a rewrite in my ngix conf file that works properly except it seems to include the location block as part of the $uri variable. I only want the path after the location block. My current config code is: location /cargo { try_files $uri $uri/ /cargo/index.php?_REWRITE_COMMAND=$uri&args; } Using an example url of http://localhost/cargo/testpage the redirect works, however the value of the "_REWRITE_COMMAND" parameter received by my php file is "/cargo/testpage". I need to strip off the location block and just have "testpage" as the $uri I am pretty sure there is a regex syntax to split the $uri and assign it to a new variable using $1 $2 etc, but I can't find any example to do just a variable assignment using a regex that is not part of a rewrite statement. I've been looking and trying for hours and I just can't seem to get past this last step. I also know I could just strip this out on the application code, but the reason I want to try to fix it in the nginx conf is for compatibility reasons as it also runs on Apache. I also should say that I have figured out a really hacky way to do it, but it involves an "if" statement to check for file existance and the documentation specifically says not to do it that way. -- UPDATE: ANSWERED BY theuni: The regex goes in the location block definition. one note of caution is that php handler location needs to be ABOVE this location, otherwise you will get a server error because it goes into an infinite redirect loop location ~ ^/cargo/(.*) { try_files $1 /cargo/$1/ /cargo/index.php?_REWRITE_COMMAND=$1&args; }

    Read the article

  • Deal with update location for click-once.

    - by Assimilater
    I'm not sure how many people here are experts with visual studios, but I'd imagine a handful (not to raise expectations but to appeal to your egos :P). I'm working primarily in visual basic for now (though I hope to switch to c# in the near future and maybe a java or web app). Basically I'm trying to create an update feature that will work similarly to how common programs such as firefox or itunes update automatically. There is supposed to be provided functionality for this in what is called click once. I carry out the following procedures and get the following errors when trying to change the update url of my program to a password-protected ftp location. Go to project properties Go to publish click updates click browse click FTP Site Under Server put: web###.opentransfer.com Under Port: 21 Under Directory put: CMSOFT Passive mode is selected (which is what filezilla tells me the server is accessed with) Anonymous User is unselected and a username and password are typed in Push Ok Under Update location it shows: ftp://web###.opentransfer.com/CMSOFT I push Ok I see a message box titled Microsoft Visual Basic 2010 Express with an x icon Publish.UpdateUrl: The string must be a fully qualified URL or UNC path, for example "http://www.microsoft.com/myapplication" or "\server\myapplication". I've tried changing the directory to "CMSOFT/PQCM.exe" and the results are the same...hope this was descriptive enough.

    Read the article

  • How mail tracking works?

    - by abc
    whoreadme is the web site that helps to track mail reader's location as well as it acknowledges when reader opens mail. What is the concept of detection behind this?

    Read the article

  • Marking Current Location on Map, Android

    - by deewangan
    Hi every one, i followed some tutorials to create an application that shows the current position of the user on the map with a marking. but for some reasons i can't get to work the marking part? the other parts works well, but whenever i add the marking code the application crashes. i hope someone could help me.here is the code: public class LocationActivity extends MapActivity { /** Called when the activity is first created. */ private MapView mapView; private LocationManager lm; private LocationListener ll; private MapController mc; GeoPoint p = null; Drawable defaultMarker = null; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); mapView = (MapView)findViewById(R.id.mapView); //show zoom in/out buttons mapView.setBuiltInZoomControls(true); //Standard view of the map(map/sat) mapView.setSatellite(false); //get controller of the map for zooming in/out mc = mapView.getController(); // Zoom Level mc.setZoom(18); MyLocationOverlay myLocationOverlay = new MyLocationOverlay(); List<Overlay> list = mapView.getOverlays(); list.add(myLocationOverlay); lm = (LocationManager)getSystemService(Context.LOCATION_SERVICE); ll = new MyLocationListener(); lm.requestLocationUpdates( LocationManager.GPS_PROVIDER, 0, 0, ll); //Get the current location in start-up GeoPoint initGeoPoint = new GeoPoint( (int)(lm.getLastKnownLocation( LocationManager.GPS_PROVIDER) .getLatitude()*1000000), (int)(lm.getLastKnownLocation( LocationManager.GPS_PROVIDER) .getLongitude()*1000000)); mc.animateTo(initGeoPoint); } protected class MyLocationOverlay extends com.google.android.maps.Overlay { @Override public boolean draw(Canvas canvas, MapView mapView, boolean shadow, long when) { Paint paint = new Paint(); super.draw(canvas, mapView, shadow); // Converts lat/lng-Point to OUR coordinates on the screen. Point myScreenCoords = new Point(); mapView.getProjection().toPixels(p, myScreenCoords); paint.setStrokeWidth(1); paint.setARGB(255, 255, 255, 255); paint.setStyle(Paint.Style.STROKE); Bitmap bmp = BitmapFactory.decodeResource(getResources(), R.drawable.push); canvas.drawBitmap(bmp, myScreenCoords.x, myScreenCoords.y, paint); canvas.drawText("I am here...", myScreenCoords.x, myScreenCoords.y, paint); return true; } } private class MyLocationListener implements LocationListener{ public void onLocationChanged(Location argLocation) { // TODO Auto-generated method stub GeoPoint myGeoPoint = new GeoPoint( (int)(argLocation.getLatitude()*1000000), (int)(argLocation.getLongitude()*1000000)); /* * it will show a message on * location change Toast.makeText(getBaseContext(), "New location latitude [" +argLocation.getLatitude() + "] longitude [" + argLocation.getLongitude()+"]", Toast.LENGTH_SHORT).show(); */ mc.animateTo(myGeoPoint); } public void onProviderDisabled(String provider) { // TODO Auto-generated method stub } public void onProviderEnabled(String provider) { // TODO Auto-generated method stub } public void onStatusChanged(String provider, int status, Bundle extras) { // TODO Auto-generated method stub } } protected boolean isRouteDisplayed() { return false; } } here is the logcat: 01-19 05:31:43.011: DEBUG/AndroidRuntime(759): >>>>>>>>>>>>>> AndroidRuntime START <<<<<<<<<<<<<< 01-19 05:31:43.011: DEBUG/AndroidRuntime(759): CheckJNI is ON 01-19 05:31:43.411: DEBUG/AndroidRuntime(759): --- registering native functions --- 01-19 05:31:43.431: INFO/jdwp(759): received file descriptor 19 from ADB 01-19 05:31:43.431: INFO/jdwp(759): Ignoring second debugger -- accepting and dropping 01-19 05:31:44.531: INFO/ActivityManager(583): Starting activity: Intent { flg=0x10000000 cmp=pro.googlemapp/.LocationActivity } 01-19 05:31:44.641: DEBUG/AndroidRuntime(759): Shutting down VM 01-19 05:31:44.641: DEBUG/dalvikvm(759): DestroyJavaVM waiting for non-daemon threads to exit 01-19 05:31:44.641: DEBUG/dalvikvm(759): DestroyJavaVM shutting VM down 01-19 05:31:44.641: DEBUG/dalvikvm(759): HeapWorker thread shutting down 01-19 05:31:44.651: DEBUG/dalvikvm(759): HeapWorker thread has shut down 01-19 05:31:44.651: DEBUG/jdwp(759): JDWP shutting down net... 01-19 05:31:44.651: DEBUG/jdwp(759): +++ peer disconnected 01-19 05:31:44.651: INFO/dalvikvm(759): Debugger has detached; object registry had 1 entries 01-19 05:31:44.661: DEBUG/dalvikvm(759): VM cleaning up 01-19 05:31:44.681: INFO/ActivityManager(583): Start proc pro.googlemapp for activity pro.googlemapp/.LocationActivity: pid=770 uid=10025 gids={3003} 01-19 05:31:44.761: DEBUG/dalvikvm(759): LinearAlloc 0x0 used 676436 of 4194304 (16%) 01-19 05:31:44.801: INFO/jdwp(770): received file descriptor 20 from ADB 01-19 05:31:44.822: INFO/dalvikvm(770): ignoring registerObject request in thread=3 01-19 05:31:44.851: INFO/jdwp(770): Ignoring second debugger -- accepting and dropping 01-19 05:31:44.851: ERROR/jdwp(770): Failed writing handshake bytes: Broken pipe (-1 of 14) 01-19 05:31:44.851: INFO/dalvikvm(770): Debugger has detached; object registry had 0 entries 01-19 05:31:45.320: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.320: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.340: ERROR/ActivityThread(770): Failed to find provider info for com.google.settings 01-19 05:31:45.781: DEBUG/LocationManager(770): Constructor: service = android.location.ILocationManager$Stub$Proxy@4379d9f0 01-19 05:31:45.791: WARN/GpsLocationProvider(583): Duplicate add listener for uid 10025 01-19 05:31:45.791: DEBUG/GpsLocationProvider(583): setMinTime 0 01-19 05:31:45.791: DEBUG/GpsLocationProvider(583): startNavigating 01-19 05:31:45.831: INFO/jdwp(770): received file descriptor 27 from ADB 01-19 05:31:46.001: INFO/MapActivity(770): Handling network change notification:CONNECTED 01-19 05:31:46.001: ERROR/MapActivity(770): Couldn't get connection factory client 01-19 05:31:46.451: DEBUG/dalvikvm(770): GC freed 4539 objects / 298952 bytes in 118ms 01-19 05:31:46.470: DEBUG/AndroidRuntime(770): Shutting down VM 01-19 05:31:46.470: WARN/dalvikvm(770): threadid=3: thread exiting with uncaught exception (group=0x4001aa28) 01-19 05:31:46.481: ERROR/AndroidRuntime(770): Uncaught handler: thread main exiting due to uncaught exception 01-19 05:31:46.541: ERROR/AndroidRuntime(770): java.lang.NullPointerException 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:58) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.PixelConverter.toPixels(PixelConverter.java:48) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at pro.googlemapp.LocationActivity$MyLocationOverlay.draw(LocationActivity.java:101) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.OverlayBundle.draw(OverlayBundle.java:42) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.google.android.maps.MapView.onDraw(MapView.java:476) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6274) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1526) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1524) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6277) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.widget.FrameLayout.draw(FrameLayout.java:352) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1526) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.drawChild(ViewGroup.java:1524) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewGroup.dispatchDraw(ViewGroup.java:1256) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.View.draw(View.java:6277) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.widget.FrameLayout.draw(FrameLayout.java:352) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.policy.impl.PhoneWindow$DecorView.draw(PhoneWindow.java:1883) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.draw(ViewRoot.java:1332) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.performTraversals(ViewRoot.java:1097) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.view.ViewRoot.handleMessage(ViewRoot.java:1613) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.os.Handler.dispatchMessage(Handler.java:99) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.os.Looper.loop(Looper.java:123) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at android.app.ActivityThread.main(ActivityThread.java:4203) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at java.lang.reflect.Method.invokeNative(Native Method) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at java.lang.reflect.Method.invoke(Method.java:521) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:791) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:549) 01-19 05:31:46.541: ERROR/AndroidRuntime(770): at dalvik.system.NativeStart.main(Native Method) 01-19 05:31:46.551: INFO/Process(583): Sending signal. PID: 770 SIG: 3 01-19 05:31:46.581: INFO/dalvikvm(770): threadid=7: reacting to signal 3 01-19 05:31:46.661: INFO/dalvikvm(770): Wrote stack trace to '/data/anr/traces.txt' 01-19 05:31:46.871: INFO/ARMAssembler(583): generated scanline__00000077:03515104_00000000_00000000 [ 27 ipp] (41 ins) at [0x2c69c8:0x2c6a6c] in 973448 ns 01-19 05:31:46.911: INFO/ARMAssembler(583): generated scanline__00000077:03515104_00001001_00000000 [ 64 ipp] (84 ins) at [0x2c6a70:0x2c6bc0] in 1985378 ns 01-19 05:31:49.881: INFO/Process(770): Sending signal. PID: 770 SIG: 9 01-19 05:31:49.931: INFO/ActivityManager(583): Process pro.googlemapp (pid 770) has died. 01-19 05:31:49.941: WARN/GpsLocationProvider(583): Unneeded remove listener for uid 1000 01-19 05:31:49.941: DEBUG/GpsLocationProvider(583): stopNavigating 01-19 05:31:49.951: INFO/WindowManager(583): WIN DEATH: Window{438891c0 pro.googlemapp/pro.googlemapp.LocationActivity paused=false} 01-19 05:31:50.111: WARN/UsageStats(583): Unexpected resume of com.android.launcher while already resumed in pro.googlemapp 01-19 05:31:50.200: WARN/InputManagerService(583): Got RemoteException sending setActive(false) notification to pid 770 uid 10025

    Read the article

  • Distributing IronPython applications - how to detect the location of ipyw.exe

    - by Kragen
    I'm thinking of developing a small application using Iron python, however I want to distribute my app to non-techies and so ideally I want to be able to give them a standard shortcut to my application along with the instructions that they need to install IronPython first. If possible I even want my shortcut to detect if IronPython is not present and display a suitable warning if this is the case (which I can do using a simple VbScript) The trouble is that IronPython doesn't place itself in the %PATH% environment variable, and so if IronPython is installed to a nonstandard location my shortcut don't work. Now I could also tell my users "If you install IronPython to a different location you need to go and edit this shortcut and...", but this is all getting far too technical for my target audience. Is there any foolproof way of distributing my IronPython dependent app?

    Read the article

  • jQuery plugin for Event Driven Architecture?

    - by leeand00
    Are there any Event Driven Architecture jQuery plugins? Step 1: Subscribing The subscribers subscribe to the event handler in the middle, and pass in a callback method, as well as the name of the event they are listening for... i.e. The two green subscribers will be listening for p0 events. And the blue subscriber will be listening for p1 events. Step 2: The p0 event is fired by another component to the Event Handler A p0 event is fired to the Event Handler The event handler notifies it's subscribers of the event, calling the callback methods they specified when they subscribed in Step 1: Subscribing. Note that the blue subscriber is not notified because it was not listening for p0 events. Step 3: The p1 event is fired a component to the Event Handler The p1 event is fired by another component Just as before except that now the blue subscriber receives the event through its callback and the other two green subscribers do not receive the event. Images by leeand00, on Flickr I can't seem to find one, but my guess is that they just call it something else in Javascript/jquery Also is there a name for this pattern? Because it isn't just a basic publisher/subscriber, it has to be called something else I would think.

    Read the article

  • Facebook AS3 API publishPost() problem

    - by Alberto Moura
    I'm trying to finish a facebook app using the AS3 API. Im having trouble when using the publishPost (message, attachment, action_links, target_id, uid) function. I can get it to post on the user's wall setting the uid=user.uid BUT I can't make it post on the user's friends wall! Setting the target_id=friend.uid isnt working for me I've also tried uid=friend.uid / target_id=friend.uid, uid=friend.uid/ I have granted ExtendedPermission(ExtendedPermissionValues.PUBLISH_STREAM) as in the documentation. I repeat: I can make it post on the current user´s wall but not on its friends'. Can someone help me with this?

    Read the article

  • How To find the location of any treeviewitem in silverlight

    - by user312772
    Hi I am new in silverlight 3. I want to find the location of any treeview Item . Although I applied this code GeneralTransform gt = ProjectTree.TransformToVisual(Application.Current.RootVisual as UIElement); Point offset = gt.Transform(new Point(0, 0)); double controlTop = offset.Y; double controlLeft = offset.X; Here Project tree is the root element of the treeview. This code is working But when I applied this for any child TreeViewelement of Treeview then an exception occurs "Value does not fall within the expected range." How to find the location of this child treeview element object

    Read the article

< Previous Page | 22 23 24 25 26 27 28 29 30 31 32 33  | Next Page >