Search Results

Search found 6880 results on 276 pages for 'argument dependent lookup'.

Page 260/276 | < Previous Page | 256 257 258 259 260 261 262 263 264 265 266 267  | Next Page >

  • How to design a data model that deals with (real) contracts?

    - by Geoffrey
    I was looking for some advice on designing a data model for contract administration. The general life cycle of a contract is thus: Contract is created and in a "draft" state. It is viewable internally and changes may be made. Contract goes out to vendor, status is set to "pending" Contract is rejected by vendor. At this state, nothing can be done to the contract. No statuses may be added to the collection. Contract is accepted by vendor. At this state, nothing can be done to the contract. No statuses may be added to the collection. I obviously want to avoid a situation where the contract is accepted and, say, the amount is changed. Here are my classes: [EnforceNoChangesAfterDraftState] public class VendorContract { public virtual Vendor Vendor { get; set; } public virtual decimal Amount { get; set; } public virtual VendorContact VendorContact { get; set; } public virtual string CreatedBy { get; set; } public virtual DateTime CreatedOn { get; set; } public virtual FileStore Contract { get; set; } public virtual IList<VendorContractStatus> ContractStatus { get; set; } } [EnforceCorrectWorkflow] public class VendorContractStatus { public virtual VendorContract VendorContract { get; set; } public virtual FileStore ExecutedDocument { get; set; } public virtual string Status { get; set; } public virtual string Reason { get; set; } public virtual string CreatedBy { get; set; } public virtual DateTime CreatedOn { get; set; } } I've omitted the filestore class, which is basically a key/value lookup to find the document based on its guid. The VendorContractStatus is mapped as a many-to-one in Nhibernate. I then use a custom validator as described here. If anything but draft is returned in the VendorContractStatus collection, no changes are allowed. Furthermore the VendorContractStatus must follow the correct workflow (you can add a rejected after a pending, but you can't add anything else to the collection if a reject or accepted exists, etc.). All sounds alright? Well a colleague has argued that we should simply add an "IsDraft" bool property to VendorContract and not accept updates if IsDraft is false. Then we should setup a method inside of VendorContractStatus for updating the status, if something gets added after a draft, it sets the IsDraft property of VendorContract to false. I do not like this as it feels like I'm dirtying up the POCOs and adding logic that should persist in the validation area, that no rules should really exist in these classes and they shouldn't be aware of their states. Any thoughts on this and what is the better practice from a DDD perspective? From my view, if in the future we want more complex rules, my way will be more maintainable over the long run. Say we have contracts over a certain amount to be approved by a manager. I would think it would be better to have a one-to-one mapping with a VendorContractApproval class, rather than adding IsApproved properties, but that's just speculation. This might be splitting hairs, but this is the first real gritty enterprise software project we've done. Any advice would be appreciated!

    Read the article

  • which way is correct to retrive data from oracle??

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Self-updating collection concurrency issues

    - by DEHAAS
    I am trying to build a self-updating collection. Each item in the collection has a position (x,y). When the position is changed, an event is fired, and the collection will relocate the item. Internally the collection is using a “jagged dictionary”. The outer dictionary uses the x-coordinate a key, while the nested dictionary uses the y-coordinate a key. The nested dictionary then has a list of items as value. The collection also maintains a dictionary to store the items position as stored in the nested dictionaries – item to stored location lookup. I am having some trouble making the collection thread safe, which I really need. Source code for the collection: public class PositionCollection<TItem, TCoordinate> : ICollection<TItem> where TItem : IPositionable<TCoordinate> where TCoordinate : struct, IConvertible { private readonly object itemsLock = new object(); private readonly Dictionary<TCoordinate, Dictionary<TCoordinate, List<TItem>>> items; private readonly Dictionary<TItem, Vector<TCoordinate>> storedPositionLookup; public PositionCollection() { this.items = new Dictionary<TCoordinate, Dictionary<TCoordinate, List<TItem>>>(); this.storedPositionLookup = new Dictionary<TItem, Vector<TCoordinate>>(); } public void Add(TItem item) { if (item.Position == null) { throw new ArgumentException("Item must have a valid position."); } lock (this.itemsLock) { if (!this.items.ContainsKey(item.Position.X)) { this.items.Add(item.Position.X, new Dictionary<TCoordinate, List<TItem>>()); } Dictionary<TCoordinate, List<TItem>> xRow = this.items[item.Position.X]; if (!xRow.ContainsKey(item.Position.Y)) { xRow.Add(item.Position.Y, new List<TItem>()); } xRow[item.Position.Y].Add(item); if (this.storedPositionLookup.ContainsKey(item)) { this.storedPositionLookup[item] = new Vector<TCoordinate>(item.Position); } else { this.storedPositionLookup.Add(item, new Vector<TCoordinate>(item.Position)); // Store a copy of the original position } item.Position.PropertyChanged += (object sender, PropertyChangedEventArgs eventArgs) => this.UpdatePosition(item, eventArgs.PropertyName); } } private void UpdatePosition(TItem item, string propertyName) { lock (this.itemsLock) { Vector<TCoordinate> storedPosition = this.storedPositionLookup[item]; this.RemoveAt(storedPosition, item); this.storedPositionLookup.Remove(item); } } } I have written a simple unit test to check for concurrency issues: [TestMethod] public void TestThreadedPositionChange() { PositionCollection<Crate, int> collection = new PositionCollection<Crate, int>(); Crate crate = new Crate(new Vector<int>(5, 5)); collection.Add(crate); Parallel.For(0, 100, new Action<int>((i) => crate.Position.X += 1)); Crate same = collection[105, 5].First(); Assert.AreEqual(crate, same); } The actual stored position varies every time I run the test. I appreciate any feedback you may have.

    Read the article

  • Imitate Google suggest with Ajax and php

    - by phil
    I want to imitate Google suggest with the following code, which means: step 1: When user types in search box, the query string will be processed by a server php file and query suggestion string is returned(using Ajax object). step 2:When user clicks on a query suggestion, it will fill into the search box (autocomplete). Step 1 is achieved while step 2 is not. I think the problem lies in the .click() method. My intention is to use .click() binding a onclick event to the dynamically created <li> element. Any idea? <script src="jquery-1.4.2.js"> </script> <style> #search,#suggest,ul,li{margin: 0; padding:0; width: 200px;} ul{ list-style-type: none;} .border{border: solid red 1px; } </style> <p>My first language is:</p> <input type="text" width="200px" id="search" onkeyup="main(this.value)" value="" /> <ul id="suggest"></ul> <script type="text/javascript"> function main(str) { //setup Ajax object var request=new XMLHttpRequest(); request.open("GET","language.php?q="+str,true) //core function request.onreadystatechange=function() { if ( request.readyState==4 && request.status==200) { if (str=="") {$('li').remove(); $('ul').removeClass('border');return;} $('li').remove(); array=request.responseText.split(","); for (i=0;i<array.length;i++) { //create HTML element of <li> $('#suggest').append($('<li>',{id: 'li'+i, html: array[i]})); //style ul $('ul').addClass('border'); //I THINK HERE IS THE PROBLEM! $('li'+i).click(function(){ $("#search").html(array[i]);}); } } } request.send(); } </script> PHP: <?php $q=$_GET[q]; $a[]='english'; $a[]='chinese'; $a[]='japanese'; $a[]='eeeeee'; //lookup all hints from array if length of q>0 if (strlen($q) > 0) { $hint=""; for($i=0; $i<count($a); $i++) { if (strtolower($q)==strtolower(substr($a[$i],0,strlen($q)))) { if ($hint=="") { $hint=$a[$i]; } else { $hint=$hint." , ".$a[$i]; } } } } // Set output to "no suggestion" if no hint were found // or to the correct values if ($hint == "") { $response="no suggestion"; } else { $response=$hint; } //output the response echo $response; ?>

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • How do you return a pointer to a base class with a virtual function?

    - by Nick Sweet
    I have a base class called Element, a derived class called Vector, and I'm trying to redefine two virtual functions from Element in Vector. //element.h template <class T> class Element { public: Element(); virtual Element& plus(const Element&); virtual Element& minus(const Element&); }; and in another file //Vector.h #include "Element.h" template <class T> class Vector: public Element<T> { T x, y, z; public: //constructors Vector(); Vector(const T& x, const T& y = 0, const T& z =0); Vector(const Vector& u); ... //operations Element<T>& plus(const Element<T>& v) const; Element<T>& minus(const Element<T>& v) const; ... }; //sum template <class T> Element<T>& Vector<T>::plus(const Element<T>& v) const { Element<T>* ret = new Vector((x + v.x), (y + v.y), (z + v.z)); return *ret; } //difference template <class T> Element<T>& Vector<T>::minus(const Element<T>& v) const { Vector<T>* ret = new Vector((x - v.x), (y - v.y), (z - v.z)); return *ret; } but I always get error: 'const class Element' has no member named 'getx' So, can I define my virtual functions to take Vector& as an argument instead, or is there a way for me to access the data members of Vector through a pointer to Element? I'm still fairly new to inheritance polymorphism, fyi.

    Read the article

  • C#/.NET Project - Am I setting things up correctly?

    - by JustLooking
    1st solution located: \Common\Controls\Controls.sln and its project: \Common\Controls\Common.Controls\Common.Controls.csproj Description: This is a library that contains this class: public abstract class OurUserControl : UserControl { // Variables and other getters/setters common to our UserControls } 2nd solution located: \AControl\AControl.sln and its project: \AControl\AControl\AControl.csproj Description: Of the many forms/classes, it will contain this class: using Common.Controls; namespace AControl { public partial class AControl : OurUserControl { // The implementation } } A note about adding references (not sure if this is relevant): When I add references (for projects I create), using the names above: 1. I add Common.Controls.csproj to AControl.sln 2. In AControl.sln I turn off the build of Common.Controls.csproj 3. I add the reference to Common.Controls (by project) to AControl.csproj. This is the (easiest) way I know how to get Debug versions to match Debug References, and Release versions to match Release References. Now, here is where the issue lies (the 3rd solution/project that actually utilizes the UserControl): 3rd solution located: \MainProj\MainProj.sln and its project: \MainProj\MainProj\MainProj.csproj Description: Here's a sample function in one of the classes: private void TestMethod<T>() where T : Common.Controls.OurUserControl, new() { T TheObject = new T(); TheObject.OneOfTheSetters = something; TheObject.AnotherOfTheSetters = something_else; // Do stuff with the object } We might call this function like so: private void AnotherMethod() { TestMethod<AControl.AControl>(); } This builds, runs, and works. No problem. The odd thing is after I close the project/solution and re-open it, I have red squigglies everywhere. I bring up my error list and I see tons of errors (anything that deals with AControl will be noted as an error). I'll see errors such as: The type 'AControl.AControl' cannot be used as type parameter 'T' in the generic type or method 'MainProj.MainClass.TestMethod()'. There is no implicit reference conversion from 'AControl.AControl' to 'Common.Controls.OurUserControl'. or inside the actual method (the properties located in the abstract class): 'AControl.AControl' does not contain a definition for 'OneOfTheSetters' and no extension method 'OneOfTheSetters' accepting a first argument of type 'AControl.AControl' could be found (are you missing a using directive or an assembly reference?) Meanwhile, I can still build and run the project (then the red squigglies go away until I re-open the project, or close/re-open the file). It seems to me that I might be setting up the projects incorrectly. Thoughts?

    Read the article

  • asp.net mvc radio button state

    - by Josh Bush
    I'm trying out asp.net mvc for a new project, and I ran across something odd. When I use the MVC UI helpers for textboxes, the values get persisted between calls. But, when I use a series of radio buttons, the checked state doesn't get persisted. Here's an example from my view. <li> <%=Html.RadioButton("providerType","1")%><label>Hospital</label> <%=Html.RadioButton("providerType","2")%><label>Facility</label> <%=Html.RadioButton("providerType","3")%><label>Physician</label> </li> When the form gets posted back, I build up an object with "ProviderType" as one of it's properties. The value on the object is getting set, and then I RedirectToAction with the provider as a argument. All is well, and I end up at a URL like "http://localhost/Provider/List?ProviderType=1" with ProviderType showing. The value gets persisted to the URL, but the UI helper isn't picking up the checked state. I'm having this problem with listbox, dropdownlist, and radiobutton. Textboxes pick up the values just fine. Do you see something I'm doing wrong? I'm assuming that the helpers will do this for me, but maybe I'll just have to take care of this on my own. I'm just feeling my way through this, so your input is appreciated. Edit: I just found the override for the SelectList constructor that takes a selected value. That took care of my dropdown issue I mentioned above. Edit #2: I found something that works, but it pains me to do it this way. I feel like this should be inferred. <li> <%=Html.RadioButton("ProviderType","1",Request["ProviderType"]=="1")%><label>Hospital</label> <%=Html.RadioButton("ProviderType", "2", Request["ProviderType"] == "2")%><label>Facility</label> <%=Html.RadioButton("ProviderType", "3", Request["ProviderType"] == "3")%><label>Physician</label> </li> Hopefully someone will come up with another way.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

    - by ltech
    Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

  • Can I make a LaTeX macro 'return' a filename?

    - by drfrogsplat
    I'm writing my thesis/dissertation and since its an on-going work I don't always have the actual images ready for the figures I put into my document, but for various reasons want to automatically have it substitute a dummy figure in place when the included graphics file doesn't exist. E.g. I can do something like \includegraphics[width=8cm]{\chapdir/figures/fluxcapacitor} (where \chapdir is a macro for my 'current' chapter directory, e.g. \def\chapdir{./ch_timetravel} and if there's no ./ch_timetravel/figures/fluxcapacitor.jpg it'll insert ./commands/dummy.jpg instead. I've structured my macros (perhaps naïvely?) so that I have a macro (\figFileOrDummy) that determines the appropriate file to include by checking if the argument provided to it exists, so that I can call \includegraphics[properties]{\figFileOrDummy{\chapdir/figures/fluxcapacitor}}. Except I'm getting various errors depending on how I try to call this, which seem to suggest that I'm approaching the problem in a fundamentally flawed way as far as 'good LaTeX programming' goes. Here's the macro to check if the file exists (and 'return' either filename or the dummy filename): \newcommand{\figFileOrDummy}[1]{% % Figure base name (no extension) to be used if the file exists \def\fodname{#1}% \def\dummyfig{commands/dummy}% % Check if output is PS (.EPS) or PDF (.JPG/.PDF/.PNG/...) figures \ifx\pdfoutput\undefined% % EPS figures only \IfFileExists{\fodname.eps}{}{\def\fodname{\dummyfig}}% \else% % Check existence of various extensions: PDF, TIF, TIFF, JPG, JPEG, PNG, MPS \def\figtest{0}% flag below compared to this value \IfFileExists{\fodname.pdf}{\def\figfilenamefound{1}}{\def\figfilenamefound{0}}% \IfFileExists{\fodname.jpg}{\def\figfilenamefound{1}}{}% \IfFileExists{\fodname.png}{\def\figfilenamefound{1}}{}% % and so on... % If no files found matching the filename (flag is 0) then use the dummy figure \ifx\figfilenamefound\figtest% \def\fodname{\dummyfig}% \fi% \fi% % 'return' the filename \fodname% }% Alternatively, here's a much simpler version which seems to have similar problems: \newcommand{\figFileOrDummy}[1]{% \def\dummyfig{commands/dummy}% \dummyfig% } The \def commands seems to be processed after the expansion of the macro they're trying to define, so it ends up being \def {commands/dummy}... (note the space after \def) and obviously complains. Also it seems to treat the literal contents of the macro as the filename for \includegraphics, rather than resolving/expanding it first, so complains that the file '\def {commands/dummy}... .png' doesn't exist.. I've tried also doing something like \edef\figfilename{\figFileOrDummy{\chapdir/figures/fluxcapacitor}} to try to force it to make \figfilename hold just the value rather than the full macro, but I get an Undefined control sequence error complaining the variables I'm trying to \def in the \figFileOrDummy macro are undefined. So my question is either How do I make this macro expand properly?; or If this is the wrong way of structuring my macros, how should I actually structure such a macro, in order to be able to insert dummy/real figures automatically?; or Is there a package that already handles this type of thing nicely that I've overlooked? I feel like I'm missing something pretty fundamental here...

    Read the article

  • Haskell type classes and type families (cont'd)

    - by Giuseppe Maggiore
    I need some help in figuring a compiler error which is really driving me nuts... I have the following type class: infixl 7 --> class Selectable a s b where type Res a s b :: * (-->) :: (CNum n) => (Reference s a) -> (n,(a->b),(a->b->a)) -> Res a s b which I instance twice. First time goes like a charm: instance Selectable a s b where type Res a s b = Reference s b (-->) (Reference get set) (_,read,write) = (Reference (\s -> let (v,s') = get s in (read v,s')) (\s -> \x -> let (v,s') = get s v' = write v x (_,s'') = set s' v' in (x,s''))) since the type checker infers (-->) :: Reference s a -> (n,a->b,a->b->a) -> Reference s b and this signature matches with the class signature for (--) since Res a s b = Reference s b Now I add a second instance and everything breaks: instance (Recursive a, Rec a ~ reca) => Selectable a s (Method reca b c) where type Res a s (Method reca b c) = b -> Reference s c (-->) (Reference get set) (_,read,write) = \(x :: b) -> from_constant( Constant(\(s :: s)-> let (v,s') = get s :: (a,s) m = read v ry = m x :: Reference (reca) c (y,v') = getter ry (cons v) :: (c,reca) v'' = elim v' (_,s'') = set s' v'' in (y,s''))) :: Reference s c the compiler complains that Couldn't match expected type `Res a s (Method reca b c)' against inferred type `b -> Reference s c' The lambda expression `\ (x :: b) -> ...' has one argument, which does not match its type In the expression: \ (x :: b) -> from_constant (Constant (\ (s :: s) -> let ... in ...)) :: Reference s c In the definition of `-->': --> (Reference get set) (_, read, write) = \ (x :: b) -> from_constant (Constant (\ (s :: s) -> ...)) :: Reference s c reading carefully the compiler is telling me that it has inferred the type of (--) thusly: (-->) :: Reference s a -> (n,a->(Method reca b c),a->(Method reca b c)->a) -> (b -> Reference s c) which is correct since Res a s (Method reca b c) = b -> Reference s c but why can't it match the two definitions? Sorry for not offering a more succint and standalone example, but in this case I cannot figure how to do it...

    Read the article

  • passing a class method as opposed to a function in std::sort

    - by memC
    hi, Within a class, I am trying to sort a vector, by passing a method of the same class. But it gives errors at the time of compilation. Can anyone tell what the problem is? Thank you! it gives the following error: argument of type bool (Sorter::)(D&, D&)' does not matchbool (Sorter::*)(D&, D&)' I have also tried using sortBynumber(D const& d1, D const& d2) #include<vector> #include<stdio.h> #include<iostream> #include<algorithm> class D { public: int getNumber(); D(int val); ~D(){}; private: int num; }; D::D(int val){ num = val; }; int D::getNumber(){ return num; }; class Sorter { public: void doSorting(); bool sortByNumber(D& d1, D& d2); std::vector<D> vec_D; Sorter(); ~Sorter(){}; private: int num; }; Sorter::Sorter(){ int i; for ( i = 0; i < 10; i++){ vec_D.push_back(D(i)); } }; bool Sorter::sortByNumber(D& d1, D& d2){ return d1.getNumber() < d2.getNumber(); }; void Sorter::doSorting(){ std::sort(vec_D.begin(), vec_D.end(), this->sortByNumber); }; int main(){ Sorter s; s.doSorting(); std::cout << "\nPress RETURN to continue..."; std::cin.get(); return 0; }

    Read the article

  • Which is the "best" data access framework/approach for C# and .NET?

    - by Frans
    (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

    Read the article

  • many-to-many-to-many, incl alignment of data from diff sources

    - by JefeCoon
    Re-factoring dbase to support many:many:many. At the second and third levels we need to preserve end-user 'mapping' or aligning of data from different sources, e.g. Order 17 FirstpartyOrderID => aha LineItem_for_BigShinyThingy => AA-1 # maps to 77-a LineItem_for_BigShinyThingy => AA-2 # maps to 77-b, 77-c LineItem_for_LittleWidget => AA-x # maps to 77-zulu, 77-alpha, 99-foxtrot LineItem_for_LittleWidget => AA-y # maps to 77-zulu, 99-foxtrot LineItem_for_LittleWidget => AA-z # maps to 77-alpha ThirdpartyOrderID => foo LineItem_for_BigShinyThingy => 77-a LineItem_for_BigShinyThingy => 77-b LineItem_for_BigShinyThingy => 77-c LineItem_for_LittleWidget => 77-zulu LineItem_for_LittleWidget => 77-alpha ThirdpartyOrderID => bar LineItem_for_LittleWidget => 99-foxtrot Each LineItem has daily datapoints reported from its own source (Firstparty|Thirdparty). In our UI & app we provide tools to align these, then we'd like to save them into the cleanest possible schema for querying, enabling us to diff the reported daily datapoints, and perform other daily calculations (which we'll store in the dbase also, fortunately that should be cake once we've nailed this). We need to map related [firstparty|thirdparty]line_items which have their own respective datapoints. We'll be using the association to pull each line_items collection of datapoints for summary and discrepancy calculations. I'm considering two options, std has_many,through x2 --or-- possibly (scary) ubermasterjoin table OptionA: order<<-->> order_join_table[id,order_id,firstparty_order_id,thirdparty_order_id] <<-->>line_item order_join_table[firstparty_order_id]-->raw_order[id] order_join_table[thirdparty_order_id]-->raw_order[id] raw_order-->raw_line_items[raw_order_id] line_item<<-->> line_item_join[id,LI_join_id,firstparty_LI,thirdparty_LI <<-->>raw_line_items line_item_join[firstparty_LI]-->raw_line_item[id] line_item_join[thirdparty_LI]-->raw_line_item[id] raw_line_item<<-->>datapoints = we rely upon join to store all mappings of first|third orders & line_items = keys to raw_* enable lookup of these order & line_item details = concerns about circular references and/or lack of correct mapping logic, e.g order--line_item--raw_line_items vs. order--raw_order--raw_line_items OptionB: order<<-->> join_master[id,order_id,FP_order_id,TP_order_id,FP_line_item_id,TP_line_item_id] join_master[FP_order_id & TP_order_id]-->raw_order[id] join_master[FP_line_item_id & TP_line_item_id]-->raw_line_item[id] = every combo of FP_line_item + TP_line_item writes a record into the join_master table = "theoretically" queries easy/fast/flexible/sexy At long last, my questions: a) any learnings from painful firsthand experience about how best to implement/tune/optimize many-to-many-to-many relationships b) in rails? c) any painful gotchas (circular references, slow queries, spaghetti-monsters) to watch out for? d) any joy & goodness in Rails3 that makes this magically easy & joyful? e) anyone written the "how to do many-to-many-to-many schema in Rails and make it fast & sexy?" tutorial that I somehow haven't found? If not, I'll follow up with our learnings in the hope it's helpful.. Thanks in advance- --Jeff

    Read the article

  • Maps with a nested vector

    - by wawiti
    For some reason the compiler won't let me retrieve the vector of integers from the map that I've created, I want to be able to overwrite this vector with a new vector. The error the compiler gives me is ridiculous. Thanks for your help!! The compiler didn't like this part of my code: line_num = miss_words[word_1]; Error: [Wawiti@localhost Lab2]$ g++ -g -Wall *.cpp -o lab2 main.cpp: In function ‘int main(int, char**)’: main.cpp:156:49: error: no match for ‘operator=’ in ‘miss_words.std::map<_Key, _Tp, _Compare, _Alloc>::operator[]<std::basic_string<char>, std::vector<int>, std::less<std::basic_string<char> >, std::allocator<std::pair<const std::basic_string<char>, std::vector<int> > > >((*(const key_type*)(& word_1))) = line_num.std::vector<_Tp, _Alloc>::push_back<int, std::allocator<int> >((*(const value_type*)(& line)))’ main.cpp:156:49: note: candidate is: In file included from /usr/lib/gcc/x86_64-redhat->linux/4.7.2/../../../../include/c++/4.7.2vector:70:0, from header.h:19, from main.cpp:15: /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: std::vector<_Tp, _Alloc>& std::vector<_Tp, _Alloc>::operator=(const std::vector<_Tp, _Alloc>&) [with _Tp = int; _Alloc = std::allocator<int>] /usr/lib/gcc/x86_64-redhat-linux/4.7.2/../../../../include/c++/4.7.2/bits/vector.tcc:161:5: note: no known conversion for argument 1 from ‘void’ to ‘const std::vector<int>&’ CODE: map<string, vector<int> > miss_words; // Creates a map for misspelled words string word_1; // String for word; string sentence; // To store each line; vector<int> line_num; // To store line numbers ifstream file; // Opens file to be spell checked file.open(argv[2]); int line = 1; while(getline(file, sentence)) // Reads in file sentence by sentence { sentence=remove_punct(sentence); // Removes punctuation from sentence stringstream pars_sentence; // Creates stringstream pars_sentence << sentence; // Places sentence in a stringstream while(pars_sentence >> word_1) // Picks apart sentence word by word { if(dictionary.find(word_1)==dictionary.end()) { line_num = miss_words[word_1]; //Compiler doesn't like this miss_words[word_1] = line_num.push_back(line); } } line++; // Increments line marker }

    Read the article

  • Returning JSON in CFFunction and appending it to layer is causing an error

    - by Mel
    I'm using the qTip jQuery plugin to generate a dynamic tooltip. I'm getting an error in my JS, and I'm unsure if its source is the JSON or the JS. The tooltip calls the following function: (sorry about all this code, but it's necessary) <cffunction name="fGameDetails" access="remote" returnType="any" returnformat="JSON" output="false" hint="This grabs game details for the games.cfm page"> <!---Argument, which is the game ID---> <cfargument name="gameID" type="numeric" required="true" hint="CFC will look for GameID and retrieve its details"> <!---Local var---> <cfset var qGameDetails = ""> <!---Database query---> <cfquery name="qGameDetails" datasource="#REQUEST.datasource#"> SELECT titles.titleName AS tName, titles.titleBrief AS tBrief, games.gameID, games.titleID, games.releaseDate AS rDate, genres.genreName AS gName, platforms.platformAbbr AS pAbbr, platforms.platformName AS pName, creviews.cReviewScore AS rScore, ratings.ratingName AS rName FROM games Inner Join platforms ON platforms.platformID = games.platformID Inner Join titles ON titles.titleID = games.titleID Inner Join genres ON genres.genreID = games.genreID Inner Join creviews ON games.gameID = creviews.gameID Inner Join ratings ON ratings.ratingID = games.ratingID WHERE (games.gameID = #ARGUMENTS.gameID#); </cfquery> <cfreturn qGameDetails> </cffunction> This function returns the following JSON: { "COLUMNS": [ "TNAME", "TBRIEF", "GAMEID", "TITLEID", "RDATE", "GNAME", "PABBR", "PNAME", "RSCORE", "RNAME" ], "DATA": [ [ "Dark Void", "Ancient gods known as 'The Watchers,' once banished from our world by superhuman Adepts, have returned with a vengeance.", 154, 54, "January, 19 2010 00:00:00", "Action & Adventure", "PS3", "Playstation 3", 3.3, "14 Anos" ] ] } The problem I'm having is every time I try to append the JSON to the layer #catalog, I get a syntax error that says "missing parenthetical." This is the JavaScript I'm using: $(document).ready(function() { $('#catalog a[href]').each(function() { $(this).qtip( { content: { url: '/gamezilla/resources/components/viewgames.cfc?method=fGameDetails', data: { gameID: $(this).attr('href').match(/gameID=([0-9]+)$/)[1] }, method: 'get' }, api: { beforeContentUpdate: function(content) { var json = eval('(' + content + ')'); content = $('<div />').append( $('<h1 />', { html: json.TNAME })); return content; } }, style: { width: 300, height: 300, padding: 0, name: 'light', tip: { corner: 'leftMiddle', size: { x: 40, y : 40 } } }, position: { corner: { target: 'rightMiddle', tooltip: 'leftMiddle' } } }); }); }); Any ideas where I'm going wrong? I tried many things for several days and I can't find the issue. Many thanks!

    Read the article

  • Applying styles to a GridView matching certain criteria

    - by NickK
    Hi everyone. I'm fairly new to ASP.Net so it's probably just me being a bit stupid, but I just can't figure out why this isn't working. Basically, I have a GridView control (GridView1) on a page which is reading from a database. I already have a CSS style applied to the GridView and all I want to do is change the background image applied in the style depending on if a certain cell has data in it or not. The way I'm trying to handle this change is updating the CSS class applied to each row through C#. I have the code below doing this: protected void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { GridViewRow row = e.Row; string s = row.Cells[7].Text; if (s.Length > 0) { row.CssClass = "newRowBackground"; } else { row.CssClass = "oldRowBackground"; } } In theory, the data from Cell[7] will either be null or be a string (in this case, likely a person's name). The problem is that when the page loads, every row in the GridView has the new style applied to it, whether it's empty or not. However, when I change it to use hard coded examples, it works fine. So for example, the below would work exactly how I want it to: protected void GridView1_RowDataBound(object sender, GridViewRowEventArgs e) { GridViewRow row = e.Row; string s = row.Cells[7].Text; if (s == "Smith") //Matching a name in one of the rows { row.CssClass = "newRowBackground"; } else { row.CssClass = "oldRowBackground"; } } It seems as if the top piece of code is always returning the string with a value greater than 0, but when I check the database the fields are all null (except for my test record of "Smith"). I'm probably doing something very simple that's wrong here, but I can't see what. Like I said, I'm still very new to this. One thing I have tried is changing the argument in the if statement to things like: if (s != null), if (s != "") and if (s == string.empty) all with no luck. Any help is greatly appreciated and don't hesitate to tell me if I'm just being stupid here. :)

    Read the article

  • Error With Sending mail (kSKPSMTPPartMessageKey is nil)

    - by user1553381
    I'm trying to send mail in iPhone using "SKPSMTPMessage" and I added the libraries, In my class I added the following code: - (IBAction)sendMail:(id)sender { // if there are a connection if ([theConnection isEqualToString:@"true"]) { if ([fromEmail.text isEqualToString:@""] || [toEmail.text isEqualToString:@""]) { UIAlertView *warning = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ??? ????? ???? ????????" delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [warning show]; }else { SKPSMTPMessage *test_smtp_message = [[SKPSMTPMessage alloc] init]; test_smtp_message.fromEmail = fromEmail.text; test_smtp_message.toEmail = toEmail.text; test_smtp_message.relayHost = @"smtp.gmail.com"; test_smtp_message.requiresAuth = YES; test_smtp_message.login = @"[email protected]"; test_smtp_message.pass = @"myPass"; test_smtp_message.wantsSecure = YES; NSString *subject= @"Suggest a book for you"; test_smtp_message.subject = [NSString stringWithFormat:@"%@ < %@ > ",fromEmail.text, subject]; test_smtp_message.delegate = self; NSMutableArray *parts_to_send = [NSMutableArray array]; NSDictionary *plain_text_part = [NSDictionary dictionaryWithObjectsAndKeys: @"text/plain\r\n\tcharset=UTF-8;\r\n\tformat=flowed", kSKPSMTPPartContentTypeKey, [messageBody.text stringByAppendingString:@"\n"], kSKPSMTPPartMessageKey, @"quoted-printable", kSKPSMTPPartContentTransferEncodingKey, nil]; [parts_to_send addObject:plain_text_part]; // to send attachment NSString *image_path = [[NSBundle mainBundle] pathForResource:BookCover ofType:@"jpg"]; NSData *image_data = [NSData dataWithContentsOfFile:image_path]; NSDictionary *image_part = [NSDictionary dictionaryWithObjectsAndKeys: @"inline;\r\n\tfilename=\"image.png\"",kSKPSMTPPartContentDispositionKey, @"base64",kSKPSMTPPartContentTransferEncodingKey, @"image/png;\r\n\tname=Success.png;\r\n\tx-unix-mode=0666",kSKPSMTPPartContentTypeKey, [image_data encodeWrappedBase64ForData],kSKPSMTPPartMessageKey, nil]; [parts_to_send addObject:image_part]; test_smtp_message.parts = parts_to_send; Spinner.hidden = NO; [Spinner startAnimating]; ProgressBar.hidden = NO; HighestState = 0; [test_smtp_message send]; } }else { UIAlertView *alertNoconnection = [[UIAlertView alloc] initWithTitle:@"?????" message:@"?? ???? ???? " delegate:self cancelButtonTitle:@"?????" otherButtonTitles:nil, nil]; [alertNoconnection show]; } } but when I tried to send it gives me the following Exception: *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[NSCFString appendString:]: nil argument' and it highlighted this line in SKPSMTPMessage.m [message appendString:[part objectForKey:kSKPSMTPPartMessageKey]]; and I Can't understand what is nil exactly Can Anyone help me in this issue? Thanks in Advance.

    Read the article

  • jQuery encoding values differently than expected for jQuery.ajax data elements

    - by Adam Tuttle
    I'm using jQuery.ajax() to make a PUT request to a REST web service, but seeing some really strange serialization behavior. (Before you say it: Yes, I know that not all browsers support PUT -- this is just an example implementation for an api/framework, and ultimately will not be called by a browser, but rather by a server-side library that does support the extra http verbs.) Here's the form: <form action="/example/api/artist" method="put" id="update"> First Name: <input type="text" name="firstname" /><br/> Last Name: <input type="text" name="lastname" /><br/> Address: <input type="text" name="address" /><br/> City: <input type="text" name="city" /><br/> State: <input type="text" name="state" /><br/> Postal Code: <input type="text" name="postalcode" /><br/> Email: <input type="text" name="email" /><br/> Phone: <input type="text" name="phone" /><br/> Fax: <input type="text" name="fax" /><br/> Password: <input type="text" name="thepassword" /><br/> <input type="hidden" name="debug" value="true" /> <input type="submit" value="Update Artist" /> <input type="reset" value="Cancel" id="updateCancel" /> </form> And the JS: $("#update").submit(function(e){ e.preventDefault(); var frm = $(this); $.ajax({ url: frm.attr('action'), data:{ firstname: $("#update input[name=firstname]").val(), lastname: $("#update input[name=lastname]").val(), address: $("#update input[name=address]").val(), city: $("#update input[name=city]").val(), state: $("#update input[name=state]").val(), postalcode: $("#update input[name=postalcode]").val(), email: $("#update input[name=email]").val(), phone: $("#update input[name=phone]").val(), fax: $("#update input[name=fax]").val(), thepassword: $("#update input[name=thepassword]").val() }, type: frm.attr('method'), dataType: "json", contentType: "application/json", success: function (data, textStatus, xhr){ console.log(data); reloadData(); }, error: function (xhr, textStatus, err){ console.log(textStatus); console.log(err); } }); }); When using FireBug, I see the request go through as this: firstname=Austin&lastname=Weber&address=25463+Main+Street%2C+Suite+C&city=Berkeley&state=CA&postalcode=94707-4513&email=austin%40life.com&phone=555-513-4318&fax=510-513-4888&thepassword=nopolyes That's not horrible, but ideally I'd rather get %20 instead of + for spaces. I tried wrapping each field value lookup in an escape: firstname: escape($("#update input[name=firstname]").val()) But that makes things worse: firstname=Austin&lastname=Weber&address=25463%2520Main%2520Street%252C%2520Suite%2520C&city=Berkeley&state=CA&postalcode=94707-4513&email=austin%40life.com&phone=555-513-4318&fax=510-513-4888&thepassword=nopolyes In this case, the value is being escaped twice; so first the space is encoded to %20, and then the % sign is escaped to %25 resulting in the %2520 for spaces, and %252C for the comma in the address field. What am I doing wrong here?

    Read the article

  • Damaged data when gzipping

    - by RadiantHeart
    This is the script I hva written for gzipping content on my site, which is located in 'gzip.php'. The way i use it is that on pages where I want to enable gzipping i include the file at the top and at the bottom i call the output function like this: print_gzipped_page('javascript') If the file is a css-file i use 'css' as the $type-argument and if its a php file i call the function without declaring any arguments. The script works fine in all browsers except Opera which gives an error saying it could not decode the page due to damaged data. Can anyone tell me what I have done wrong? <?php function print_gzipped_page($type = false) { if(headers_sent()){ $encoding = false; } elseif( strpos($_SERVER['HTTP_ACCEPT_ENCODING'], 'x-gzip') !== false ){ $encoding = 'x-gzip'; } elseif( strpos($_SERVER['HTTP_ACCEPT_ENCODING'],'gzip') !== false ){ $encoding = 'gzip'; } else{ $encoding = false; } if ($type!=false) { $type_header_array = array("css" => "Content-Type: text/css", "javascript" => "Content-Type: application/x-javascript"); $type_header = $type_header_array[$type]; } $contents = ob_get_contents(); ob_end_clean(); $etag = '"' . md5($contents) . '"'; $etag_header = 'Etag: ' . $etag; header($etag_header); if ($type!=false) { header($type_header); } if (isset($_SERVER['HTTP_IF_NONE_MATCH']) and $_SERVER['HTTP_IF_NONE_MATCH']==$etag) { header("HTTP/1.1 304 Not Modified"); exit(); } if($encoding){ header('Content-Encoding: '.$encoding); print("\x1f\x8b\x08\x00\x00\x00\x00\x00"); $size = strlen($contents); $contents = gzcompress($contents, 9); $contents = substr($contents, 0, $size); } echo $contents; exit(); } ob_start(); ob_implicit_flush(0); ?> Additional info: The script works if the length og the document beeing compressed is only 10-15 characters.

    Read the article

  • Passing enums to functions in C++

    - by rocknroll
    Hi all, I have a header file with all the enums listed (#ifndef #define #endif construct has been used to avoid multiple inclusion of the file) that I use in multiple cpp files in my application.One of the enums in the files is enum StatusSubsystem {ENABLED,INCORRECT_FRAME,INVALID_DATA,DISABLED}; There are functions in the application delcared as ShowStatus(const StatusSubsystem&); Earlier in the application when I made calls to the above function like ShowStatus(INCORRECT_FRAME); my application used to compile perfectly. But after some code was added The compilation halts giving the following error: File.cpp:71: error: invalid conversion from `int' to `StatusSubsystem' File.cpp:71: error: initializing argument 1 of `void Class::ShowStatus(const StatusSubsystem&) I checked the code for any conflicting enums in the new code and it looked fine. My Question is what is wrong with the function call that compiler shows as erroneous? For your reference the function definition is: void Class::ShowStatus(const StatusSubsystem& eStatus) { QPalette palette; mStatus=eStatus;//store current Communication status of system if(eStatus==DISABLED) { //select red color for label, if it is to be shown disabled palette.setColor(QPalette::Window,QColor(Qt::red)); mLabel->setText("SYSTEM"); } else if(eStatus==ENABLED) { //select green color for label,if it is to be shown enabled palette.setColor(QPalette::Window,QColor(Qt::green)); mLabel->setText("SYSTEM"); } else if(eStatus==INCORRECT_FRAME) { //select yellow color for label,to show that it is sending incorrect frames palette.setColor(QPalette::Window,QColor(Qt::yellow)); mLabel->setText("SYSTEM(I)"); } //Set the color on the Label mLabel->setPalette(palette); } A strange side effect of this situation is it compiles when I cast all the calls to ShowStatus() as ShowStatus((StatusSubsystem)INCORRECT_FRAME); Though this removes any compilation error, but a strange thing happens. Though I make call to INCORRECT_FRAME above but in function definition it matches with ENABLED. How on earth is that possible? Its like while passing INCORRECT_FRAME by reference, it magically converts to ENABLED, which should be impossible. This is driving me nuts. Can you find any flaw in what I am doing? or is it something else? The application is made using C++,Qt-4.2.1 on RHEL4. Thanks.

    Read the article

  • No method error in controller create action

    - by user2799827
    I have read a number of Q&As on SO in search of some help on this but have so far not solved my issue. I am trying to teach myself ruby/rails, and as a test project, I want to create a list of tvshows and a list of characters where each tvshow has_many characters and each character belongs_to a specific show. I am sure I am doing something basic incorrectly. Any assistance would be greatly appreciated. here is the characters controller: class CharactersController < ApplicationController before_action :set_character, only: [:show, :edit, :update, :destroy] # GET /characters # GET /characters.json def index @characters = Character.all end # GET /characters/1 # GET /characters/1.json def show end # GET /characters/new def new @character = Character.new end # GET /characters/1/edit def edit end # POST /characters # POST /characters.json def create @character = @tvshow.characters.create(params[:character]) respond_to do |format| if @character.save format.html { redirect_to @character, notice: 'Character was successfully created.' } format.json { render action: 'show', status: :created, location: @character } else format.html { render action: 'new' } format.json { render json: @character.errors, status: :unprocessable_entity } end end end # PATCH/PUT /characters/1 # PATCH/PUT /characters/1.json def update respond_to do |format| if @character.update(character_params) format.html { redirect_to @character, notice: 'Character was successfully updated.' } format.json { head :no_content } else format.html { render action: 'edit' } format.json { render json: @character.errors, status: :unprocessable_entity } end end end # DELETE /characters/1 # DELETE /characters/1.json def destroy @character.destroy respond_to do |format| format.html { redirect_to characters_url } format.json { head :no_content } end end private # Use callbacks to share common setup or constraints between actions. def set_character @character = Character.find(params[:id]) end # Never trust parameters from the scary internet, only allow the white list through. def character_params params.require(:character).permit(:first_name, :last_name, :bio) end end character model: class Character < ActiveRecord::Base belongs_to :tvshow default_scope -> { order('created_at DESC') } validates :tvshow_id, presence: true end tvshow model: class Tvshow < ActiveRecord::Base has_many :characters, dependent: :destroy end error gets returned when I attempt to create a character. here is the full trace: app/controllers/characters_controller.rb:27:in `create' actionpack (4.0.0) lib/action_controller/metal/implicit_render.rb:4:in `send_action' actionpack (4.0.0) lib/abstract_controller/base.rb:189:in `process_action' actionpack (4.0.0) lib/action_controller/metal/rendering.rb:10:in `process_action' actionpack (4.0.0) lib/abstract_controller/callbacks.rb:18:in `block in process_action' activesupport (4.0.0) lib/active_support/callbacks.rb:413:in `_run__1211653665462320621__process_action__callbacks' activesupport (4.0.0) lib/active_support/callbacks.rb:80:in `run_callbacks' actionpack (4.0.0) lib/abstract_controller/callbacks.rb:17:in `process_action' actionpack (4.0.0) lib/action_controller/metal/rescue.rb:29:in `process_action' actionpack (4.0.0) lib/action_controller/metal/instrumentation.rb:31:in `block in process_action' activesupport (4.0.0) lib/active_support/notifications.rb:159:in `block in instrument' activesupport (4.0.0) lib/active_support/notifications/instrumenter.rb:20:in `instrument' activesupport (4.0.0) lib/active_support/notifications.rb:159:in `instrument' actionpack (4.0.0) lib/action_controller/metal/instrumentation.rb:30:in `process_action' actionpack (4.0.0) lib/action_controller/metal/params_wrapper.rb:245:in `process_action' activerecord (4.0.0) lib/active_record/railties/controller_runtime.rb:18:in `process_action' actionpack (4.0.0) lib/abstract_controller/base.rb:136:in `process' actionpack (4.0.0) lib/abstract_controller/rendering.rb:44:in `process' actionpack (4.0.0) lib/action_controller/metal.rb:195:in `dispatch' actionpack (4.0.0) lib/action_controller/metal/rack_delegation.rb:13:in `dispatch' actionpack (4.0.0) lib/action_controller/metal.rb:231:in `block in action' actionpack (4.0.0) lib/action_dispatch/routing/route_set.rb:80:in `call' actionpack (4.0.0) lib/action_dispatch/routing/route_set.rb:80:in `dispatch' actionpack (4.0.0) lib/action_dispatch/routing/route_set.rb:48:in `call' actionpack (4.0.0) lib/action_dispatch/journey/router.rb:71:in `block in call' actionpack (4.0.0) lib/action_dispatch/journey/router.rb:59:in `each' actionpack (4.0.0) lib/action_dispatch/journey/router.rb:59:in `call' actionpack (4.0.0) lib/action_dispatch/routing/route_set.rb:655:in `call' rack (1.5.2) lib/rack/etag.rb:23:in `call' rack (1.5.2) lib/rack/conditionalget.rb:35:in `call' rack (1.5.2) lib/rack/head.rb:11:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/params_parser.rb:27:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/flash.rb:241:in `call' rack (1.5.2) lib/rack/session/abstract/id.rb:225:in `context' rack (1.5.2) lib/rack/session/abstract/id.rb:220:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/cookies.rb:486:in `call' activerecord (4.0.0) lib/active_record/query_cache.rb:36:in `call' activerecord (4.0.0) lib/active_record/connection_adapters/abstract/connection_pool.rb:626:in `call' activerecord (4.0.0) lib/active_record/migration.rb:369:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/callbacks.rb:29:in `block in call' activesupport (4.0.0) lib/active_support/callbacks.rb:373:in `_run__2792846465963916895__call__callbacks' activesupport (4.0.0) lib/active_support/callbacks.rb:80:in `run_callbacks' actionpack (4.0.0) lib/action_dispatch/middleware/callbacks.rb:27:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/reloader.rb:64:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/remote_ip.rb:76:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/debug_exceptions.rb:17:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/show_exceptions.rb:30:in `call' railties (4.0.0) lib/rails/rack/logger.rb:38:in `call_app' railties (4.0.0) lib/rails/rack/logger.rb:21:in `block in call' activesupport (4.0.0) lib/active_support/tagged_logging.rb:67:in `block in tagged' activesupport (4.0.0) lib/active_support/tagged_logging.rb:25:in `tagged' activesupport (4.0.0) lib/active_support/tagged_logging.rb:67:in `tagged' railties (4.0.0) lib/rails/rack/logger.rb:21:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/request_id.rb:21:in `call' rack (1.5.2) lib/rack/methodoverride.rb:21:in `call' rack (1.5.2) lib/rack/runtime.rb:17:in `call' activesupport (4.0.0) lib/active_support/cache/strategy/local_cache.rb:83:in `call' rack (1.5.2) lib/rack/lock.rb:17:in `call' actionpack (4.0.0) lib/action_dispatch/middleware/static.rb:64:in `call' railties (4.0.0) lib/rails/engine.rb:511:in `call' railties (4.0.0) lib/rails/application.rb:97:in `call' rack (1.5.2) lib/rack/lock.rb:17:in `call' rack (1.5.2) lib/rack/content_length.rb:14:in `call' rack (1.5.2) lib/rack/handler/webrick.rb:60:in `service' /Users/dariusgoore/.rvm/rubies/ruby-1.9.3-p194/lib/ruby/1.9.1/webrick/httpserver.rb:138:in `service' /Users/dariusgoore/.rvm/rubies/ruby-1.9.3-p194/lib/ruby/1.9.1/webrick/httpserver.rb:94:in `run' /Users/dariusgoore/.rvm/rubies/ruby-1.9.3-p194/lib/ruby/1.9.1/webrick/server.rb:191:in `block in start_thread'

    Read the article

< Previous Page | 256 257 258 259 260 261 262 263 264 265 266 267  | Next Page >