Search Results

Search found 21875 results on 875 pages for 'program launchers'.

Page 263/875 | < Previous Page | 259 260 261 262 263 264 265 266 267 268 269 270  | Next Page >

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Getting local My Documents folder path

  - by smsrecv

  In my C++/WinAPI application I get the My Documents folder path using this code: wchar_t path[MAX_PATH]; SHGetFolderPathW(NULL,CSIDL_PERSONAL,NULL,SHGFP_TYPE_CURRENT,path); One of the users runs my program on a pc connected to his corporate network. He has the My Documents folder on a network. So my code returns something like \paq\user.name$\My Documents Though he says he has a local copy of My Documents. The problem is that when he 'swaps VPN', the online My Documents becomes unavailable and my program crashes with the system error code 64 "The specified network name is no longer available" ( it tries to write to the file opened in the online my docs folder). How can I always get the local My Documents folder path using C++/WinAPI?

  Read the article

• Making commercial Java software

  - by roddik

  Hi. I intend to make some software to be sold over internet. I've only created open-source before, so I have really no idea of how to protect it from being cracked and distributed as warez. Bearing in mind that I know like two programms that aren't either cracked or not really useful I decided that the only more or less reliable way may look like this: Connect to a server and provide licensing info and some sort of hardware summary info If everything is fine, the server returns some crucial missing parts of the program bound to that certain pc along with the usage limit of say 2 days That crucial stuff is not saved to hard drive, so it is downloaded every time the program starts, if the programm runs more than 2 days, data is downloaded again If the same info is used from different computers, suspend the customer account What do you think about this? It may seem a bit to restrictive, but I'd better make less sales at first then eventually see my precious killer app downloaded for free. Anyways, first I need some basic theory/tutorials/guides about how to ensure that user only uses a certain Java app if he has paid for it, so please suggest some. Thanks

  Read the article

• C#, working with files, "Unauthorized Access"?

  - by Rob

  Hi, I'm learning about opening and saving files with C# and it seems that vista won't let my program save to a file on the root of C:\ , unless I run it in administrator mode. Any ideas how to allow my program to play around with whatever files it wants? Thanks! string name; private void button2_Click(object sender, EventArgs e) ///// OPEN ///// { if (openFileDialog1.ShowDialog() == DialogResult.OK) { name = openFileDialog1.FileName; textBox1.Clear(); textBox1.Text = File.ReadAllText(name); textBox2.Text = name; } } private void button1_Click(object sender, EventArgs e) ///// SAVE ///// { File.WriteAllText(name, textBox1.Text); }

  Read the article

• [C++] Needed: A simple C++ container (stack, linked list) that is thread-safe for writing

  - by conradlee

  I am writing a multi-threaded program using OpenMP in C++. At one point my program forks into many threads, each of which need to add "jobs" to some container that keeps track of all added jobs. Each job can just be a pointer to some object. Basically, I just need the add pointers to some container from several threads at the same time. Is there a simple solution that performs well? After some googling, I found that STL containers are not thread-safe. Some stackoverflow threads address this question, but none form a consensus on a simple solution.

  Read the article

• Call external library from PHP. What is faster: exec or extension?

  - by robusta

  Hi, I need to make calls from webpage to external library written in C++ and display the result. Platform is Linux, Apache, PHP. My current idea is to use PHP service which will call my library/program. I found that there are two possible ways to do this: 1) use PHP 'exec' function 2) write PHP extension I am curious what works more effective? Faster? Less load the server? I will probably need to do 4 calls per second, so I want to be as optimal as possible. P.S. If you are aware of some other (more effective) way of calling C++ library or program from webpage, please let me know. Thanks a lot, Robusta

  Read the article

• Page replacement algorithm in Java

  - by SamSol

  Is there utility program for Page replacement algorithm in Java?

  Read the article

• how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

  - by numeric

  Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

  Read the article

• unittest in python: ignore an import from the code I want to test

  - by vaidab

  I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

  Read the article

• How To Parse String File Txt Into Array With C++

  - by Ibnu Syuhada

  I am trying to write a C++ program, but I am not familiar with C++. I have a .txt file, which contains values as follows: 0 0.0146484 0.0292969 0.0439453 0.0585938 0.0732422 0.0878906 What I have done in my C++ code is as follows: #include <iostream> #include <fstream> using namespace std; int main() { string line; ifstream myReadFile; myReadFile.open("Qi.txt"); if(myReadFile.is_open()) { while(myReadFile.good()) { getline(myReadFile,line); cout << line << endl; } myReadFile.close(); } return 0; } I would like to make the output of the program an array, i.e. line[0] = 0 line[1] = 0.0146484 line[2] = 0.0292969 line[3] = 0.0439453 line[4] = 0.0585938 line[5] = 0.0732422 line[6] = 0.0878906

  Read the article

• Delphi 7 get folder name from path

  - by philO

  I have a path say C:\Program Files\Borland what would bet the easiest way to parse that string and just return Borland? thanks

  Read the article

• Highest value datatype can store in c#

  - by user472832

  I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

  Read the article

• just x86 assembly question~~!!

  - by kevin

  this is my assembly program which is just a function to swap *x *y. so first argument from main is address of x which is in 8(%ebp) and second one is address of y is in 12(%ebp). the program does swap x and y. I need 7 lines for doing this. can you make it 6 lines and there is a condition you can use only %eax,%ecx, and %edx 3 registers. I think about it so much.. but.. I can't make it 6 lines...there must be a way.. isn't it? this might be not a big deal.. but if there is a way to get it in 6lines. I want to know.. if you know the way~ help me~ plz~ thank you and have a good and nice day~ movl 8(%ebp), %eax movl (%eax), %ecx movl 12(%ebp), %edx movl (%edx), %eax movl %ecx, (%edx) movl 8(%ebp), %ecx movl %eax, (%ecx)

  Read the article

• Force to reimplement a static function in inherit classes

  - by pacopepe

  Hi, I have a program in C++ with plugins (dynamic libs). In the main program, I want to execute a static function to check if i can create a object of this type. An example without dynamic libs (aren't neccesary to understand the problem): #include "libs/parent.h" #include "libs/one.h" #include "libs/two.h" int main(int argc, char * argv[]) { Parent obj; if (One.match(argv[1])) { obj = new One(); else if (Two.match(argv[1])) { obj = new Two(); } Now, i have a interface class named Parent. All plugins inherit from this class. Ideally, I have a virtual static function in Parent named match, and all the plugins need to reimplement this function. The problem with this code is that i can't do a static virtual function in C++, so i don't know how to solve the problem. Sorry for mi english, i did my best

  Read the article

• Execute a line in a text file

  - by apophis

  Hi I have a program that reads text files filled with code designed to be executed line by line by the program, like a script file. The problem is that I don't no how to do the line executing part. Here is my code, I thought using the \r would fool the console. But it just shows me a list of lines in the file. if (tok[0] == "read" && length == 2) { try { StreamReader tr = new StreamReader(@"C:\Users\Public\"+tok[1]+".txt"); while (!tr.EndOfStream) { Console.WriteLine(tr.ReadLine()); } } catch { Console.WriteLine("No such text file.\n"); } Prompt(); If I knew what to search for to fix my problem in Google, I would have. But I've got no idea. Thanks

  Read the article

• Broadcast message or file to nearby Bluetooth devices

  - by Medjeti

  Hiya, A client of ours is attending a business fair and would like to push some sort of "welcome message" to people visiting their space. I'm not too familiar with Bluetooth, so I have a few questions: What kind of content can you transfer via Bluetooth? (Is it files only or is it possible to send a simple text message?) Is it possible to push content only to recipients within a certain distance? (ie. based on signal strength or similar) Can anybody recommend a piece of software that can do some or all of the above? If necessary we could program a custom solution ourselves (.NET), but I'm sure there must be a program out there that can do the job. I've googled a bit and came across the 32feet.NET framework - does anybody have any experience with this framework? Thanks in advance for any suggestions!

  Read the article

• How do you stop Eclipse from inserting a certain class in Content-Assist?

  - by fletchgqc.mp

  I'm using SpringSource Tool Suite (Eclipse) to program with Grails, and I'm also using JFreechart in the program. In Grails you log by typing log.info("method worked"). Unfortunately JFrechart has a class called "Log" with Static methods like "info". This means that in STS I type log.info and then when I type space or ( Eclipse "assists" me by importing the JFreechart Log class and changing what I've typed to Log.info(message). Very irritating. I reckon I could turn off the Eclipse option to "insert single proposals automatically", but I like this feature. Can I instruct Eclipse not to give me content assist from this particular JFreechart class?

  Read the article

• Python: How to quit CLI when stuck in blocking raw_input?

  - by christianschluchter

  I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

  Read the article

• Adding inheritance to a class programmatically in python?

  - by Timmy

  Can I make a class inherit a class "in-program" in Python?

  Read the article

• Boost Shared Pointers and Memory Management

  - by Izza

  I began using boost rather recently and am impressed by the functionality and APIs provided. In using boost::shared_ptr, when I check the program with Valgrind, I found a considerable number of "Still reachable" memory leaks. As per the documentation of Valgrind, these are not a problem. However, since I used to use the standard C++ library only, I always made sure that any program written is completely free from memory leaks. My question is, are these memory leaks something to worry about? I tried using reset(), however it only decrements the reference count, doesn't deallocate memory. Can I safely ignore these, or any way to forcibly deallocate the memory allocated by boost::shared_ptr? Thank you.

  Read the article

• Count Clicks in excel

  - by rockbala

  Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

  Read the article

• C# Console Application Output to .csv file

  - by Zinn

  I am trying to make a program that will show the numbers: 1, 10 +30 2, 40 (the scale goes up in this pattern by adding 20 to the last number added) 3, 90 +50 4, 160 5, 250 +70 So far I have this code: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO;// namespace Myloop { class Program { static void Main(string[] args) /// </summary> { StreamWriter myOutputStream = new StreamWriter("loopdata.csv"); int forloop; for (forloop = 1; forloop < 21; forloop++) Console.WriteLine(forloop); Console.ReadLine(); myOutputStream.Close(); } } } This is showing the first sequence of numbers 1 - 20, but could anyone give me any guidance how to do the other sequence next to it in the console application and how I can output these to a .csv file, as the information I have so far doesn't appear in the .csv file

  Read the article

• explain this macro

  - by deostroll

  #define __T(x) L ## x Found in code from one of the MFC source header file. It is mostly used for converting strings to ........ (I don't know what). If I am correct it converts strings to LPCTSTR...don't know what that type is either... I can't seem to convert char* into LPCTSTR. While MFC file handling, the following code will always return error while trying to open the file... char* filepath = "C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF"; if( !file.Open((LPCTSTR)filepath , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } But instead if I wrote it this way, it doesn't give error: if( !file.Open( _T("C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF") , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } I am looking at passing a variable as the first argument to the CFile::Open() method.

  Read the article

• Python structure mistake

  - by jaddy123

  I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

  Read the article

• Using a database/index sequential file independently of the Unix distribution

  - by Helper Method

  What I'm planning to do is a) parse a file for some lines matching a regular expression b) store the match in some sort of database / file so I don't have to do the parsing again and again c) call another program passing the matches as arguments While I can imagine how to do a) and c), I'm a little bit unsure about b). The matches are of the form key:attribute1:attribute2:attribute3 where attribute 2 may be optional. I'm thinking of storing the results in a simple database but the problem is the database needs to available on a number of Unix platform for the program to work. Are there any (simple) databases which can be found on any Unix platforms? Or should I use some sort of index-sequential file?

  Read the article

< Previous Page | 259 260 261 262 263 264 265 266 267 268 269 270  | Next Page >