Search Results

Search found 9058 results on 363 pages for 'length'.

Page 265/363 | < Previous Page | 261 262 263 264 265 266 267 268 269 270 271 272  | Next Page >

  • Can this method to convert a name to proper case be improved?

    - by Kelsey
    I am writing a basic function to convert millions of names (one time batch process) from their current form, which is all upper case, to a proper mixed case. I came up with the following so far: public string ConvertToProperNameCase(string input) { TextInfo textInfo = new CultureInfo("en-US", false).TextInfo; char[] chars = textInfo.ToTitleCase(input.ToLower()).ToCharArray(); for (int i = 0; i + 1 < chars.Length; i++) { if ((chars[i].Equals('\'')) || (chars[i].Equals('-'))) { chars[i + 1] = Char.ToUpper(chars[i + 1]); } } return new string(chars);; } It works in most cases such as: JOHN SMITH - John Smith SMITH, JOHN T - Smith, John T JOHN O'BRIAN - John O'Brian JOHN DOE-SMITH - John Doe-Smith There are some edge cases that do no work like: JASON MCDONALD - Jason Mcdonald (Correct: Jason McDonald) OSCAR DE LA HOYA - Oscar De La Hoya (Correct: Oscar de la Hoya) MARIE DIFRANCO - Marie Difranco (Correct: Marie DiFranco) These are not captured and I am not sure if I can handle all these odd edge cases. Can anyone think of anything I could change or add to capture more edge case? I am sure there are tons of edge cases I am not even thinking of as well. All casing should following North American conventions too meaning that if certain countries expect a specific capitalization format, and that differs from the North American format, then the North American format takes precedence.

    Read the article

  • Asp.Net MVC 2: How exactly does a view model bind back to the model upon post back?

    - by Dr. Zim
    Sorry for the length, but a picture is worth 1000 words: In ASP.NET MVC 2, the input form field "name" attribute must contain exactly the syntax below that you would use to reference the object in C# in order to bind it back to the object upon post back. That said, if you have an object like the following where it contains multiple Orders having multiple OrderLines, the names would look and work well like this (case sensitive): This works: Order[0].id Order[0].orderDate Order[0].Customer.name Order[0].Customer.Address Order[0].OrderLine[0].itemID // first order line Order[0].OrderLine[0].description Order[0].OrderLine[0].qty Order[0].OrderLine[0].price Order[0].OrderLine[1].itemID // second order line, same names Order[0].OrderLine[1].description Order[0].OrderLine[1].qty Order[0].OrderLine[1].price However we want to add order lines and remove order lines at the client browser. Apparently, the indexes must start at zero and contain every consecutive index number to N. The black belt ninja Phil Haack's blog entry here explains how to remove the [0] index, have duplicate names, and let MVC auto-enumerate duplicate names with the [0] notation. However, I have failed to get this to bind back using a nested object: This fails: Order.id // Duplicate names should enumerate at 0 .. N Order.orderDate Order.Customer.name Order.Customer.Address Order.OrderLine.itemID // And likewise for nested properties? Order.OrderLine.description Order.OrderLine.qty Order.OrderLine.price Order.OrderLine.itemID Order.OrderLine.description Order.OrderLine.qty Order.OrderLine.price I haven't found any advice out there yet that describes how this works for binding back nested ViewModels on post. Any links to existing code examples or strict examples on the exact names necessary to do nested binding with ILists? Steve Sanderson has code that does this sort of thing here, but we cannot seem to get this to bind back to nested objects. Anything not having the [0]..[n] AND being consecutive in numbering simply drops off of the return object. Any ideas?

    Read the article

  • How do I DRY up my CouchDB views?

    - by James A. Rosen
    What can I do to share code among views in CouchDB? Example 1 -- utility methods Jesse Hallett has some good utility methods, including function dot(attr) { return function(obj) { return obj[attr]; } } Array.prototype.map = function(func) { var i, r = [], for (i = 0; i < this.length; i += 1) { r[i] = func(this[i]); } return r; }; ... Where can I put this code so every view can access it? Example 2 -- constants Similarly for constants I use in my application. Where do I put MyApp = { A_CONSTANT = "..."; ANOTHER_CONSTANT = "..."; }; Example 3 -- filter of a filter: What if I want a one view that filters by "is this a rich person?": function(doc) { if (doc.type == 'person' && doc.net_worth > 1000000) { emit(doc.id, doc); } } and another that indexes by last name: function(doc) { if (doc.last_name) { emit(doc.last_name, doc); } } How can I combine them into a "rich people by last name" view? I sort of want the equivalent of the Ruby my_array.select { |x| x.person? }.select { |x| x.net_worth > 1,000,000 }.map { |x| [x.last_name, x] } How can I be DRYer?

    Read the article

  • send Image from J2ME to SERVLET

    - by Akash
    Hi, I want to send Image from J2ME to SERVLET. I am able to convert image into Byte Array, and send by Http POST. I have coded as : - From Mobile : conn = (HttpConnection)Connector.open(url,Connector.READ_WRITE,true); conn.setRequestMethod(HttpConnection.POST); conn.setRequestProperty("Content-Type", "application/x-www-form-urlencoded"); os.write(bytes, 0, bytes.length);//bytes = byte array of image At servlet : String line; BufferedReader r1 = new BufferedReader(new InputStreamReader(in)); while ((line = r1.readLine()) != null) { System.out.println("line=" + line); buf.append(line); } String s = buf.toString(); byte[] img_byte = s.getBytes(); Now d problem I found is, when I send Bytes from Mob App, some bytes are LOST , whose value is 0A and 0D-Hex ... Exactly, Cr- Carriage Return & Lf- Line Feed... It means, POST method OR readLine() not able to accept 0A & 0D value... And so I come to know that, LOST bytes are 0A and 0D occurrence in image's byte array.... Any one have any idea, how to do this, or how to use any another method..... Thanks -Akash

    Read the article

  • Problems with jQuery load and getJSON only when using Chrome

    - by leftend
    I'm having an issue with two jQuery calls. The first is a "load" that retrieves HTML and displays it on the page (it does include some Javascript and CSS in the code that is returned). The second is a "getJSON" that returns JSON - the JSON returned is valid. Everything works fine in every other browser I've tried - except Chrome for either Windows or Mac. The page in question is here: http://urbanistguide.com/category/Contemporary.aspx When you click on a Restaurant name in IE/FF, you should see that item expand with more info - and a map displayed to the right. However, if you do this in Chrome all you get is the JSON data printed to the screen. The first problem spot is when the "load" function is called here: var fulllisting = top.find(".listingfull"); fulllisting.load(href2, function() { fulllisting.append("<div style=\"width:99%;margin-top:10px;text-align:right;\"><a href=\"#\" class=\"" + obj.attr("id") + "\">X</a>"); itemId = fulllisting.find("a.listinglink").attr("id"); ... In the above code, the callback function doesn't seem to get invoked. The second problem spot is when the "getJSON" function is called: $.getJSON(href, function(data) { if (data.error.length > 0) { //display error message } else { ... } In this case - it just seems to follow the link instead of performing the callback... and yes, I am doing a "return false;" at the end of all of this to prevent the link from executing. All of the rest of the code is inline on that page if you want to view the source code. Any ideas?? Thanks

    Read the article

  • C# Client to Consume Google App Engine RESTful Webservice (rpc XML)

    - by Ngu Soon Hui
    I think I hit a problem when using C# client to consume Google App Engine Webservice. The Google App Engine code I use is here. This is how the python script on server would look like: from google.appengine.ext import webapp from google.appengine.ext.webapp.util import run_wsgi_app import logging from StringIO import StringIO import traceback import xmlrpclib from xmlrpcserver import XmlRpcServer class Application: def __init__(self): pass def getName(self,meta): return 'example' class XMLRpcHandler(webapp.RequestHandler): rpcserver = None def __init__(self): self.rpcserver = XmlRpcServer() app = Application() self.rpcserver.register_class('app',app) def post(self): request = StringIO(self.request.body) request.seek(0) response = StringIO() try: self.rpcserver.execute(request, response, None) except Exception, e: logging.error('Error executing: '+str(e)) for line in traceback.format_exc().split('\n'): logging.error(line) finally: response.seek(0) rstr = response.read() self.response.headers['Content-type'] = 'text/xml' self.response.headers['Content-length'] = "%d"%len(rstr) self.response.out.write(rstr) application = webapp.WSGIApplication( [('/xmlrpc/', XMLRpcHandler)], debug=True) def main(): run_wsgi_app(application) if __name__ == "__main__": main() The client side ( in Python) is this: import xmlrpclib s = xmlrpclib.Server('http://localhost:8080/xmlrpc/') print s.app.getName() I have no problem in using Python client to retrieve values from Google App Engine, but I do have difficulties in using a C# client to retrieve the values. The error I got was 404 method not found when I am trying to GetResponse from the web request. This is my code var request = (HttpWebRequest)WebRequest.Create("http://localhost:8080/xmlrpc/app"); request.Method = "GET"; request.ContentLength = 0; request.ContentType = "text/xml"; using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) //404 method not found error here. { } I think it must be that the url is wrong, but I don't know how to get it right. Any idea?

    Read the article

  • Castle ActiveRecord / NHibernate Linq Querys with ValueTypes

    - by Thomas Schreiner
    Given the following code for our Active Record Entites and ValueTypes Linq is not working for us. [ActiveRecord("Person")] public class PersonEntity : ActiveRecordLinqBase<PersonEntity> { string _name; [Property("Name", Length = 20, ColumnType = "string", Access = PropertyAccess.FieldCamelcaseUnderscore)] public Name Name { get { return NameValue.Create(_name);} set { _name = value.DataBaseValue; } } ... } public abstract class Name : IValueType { string DataBaseValue {get;set;} ... } public class Namevalue : Name { string _name; private NameValue(string name) { _name = name; } public static NameValue Create(string name) { return new NameValue(name); } ... } We tried to use linq in the following way so far with no success: var result = from PersonEntity p in PersonEntity.Queryable where p.Name == "Thomas" select p; return result.First(); // throws exception Cannot convert string into Name We tried and implemented a TypeConverter for Name, but the converter never got called. Is there a way to have linq working with this ValueTypes? Update: Using NHibernate.UserTypes.IUserType it sortof works. I Implemented the Interface as described here: http://stackoverflow.com/questions/1565056/how-to-implement-correctly-iusertype I still had to add a ConversionOperator from string to Name and had to call it Explicitly in the linq Statement, even though it was defined as implicit. var result = from PersonEntity p in PersonEntity.Queryable where p.Name == (Name)"Thomas" select p; return result.First(); //Now works

    Read the article

  • Asp.net Login Status Question: It Aint Working

    - by contactmatt
    I'm starting to use Role Management in my website, and I'm current following along on the tutorial from http://www.asp.net/Learn/Security/tutorial-02-vb.aspx . I'm having a problem with the asp:LoginStatus control. It is not telling me that I am currently logged in after a successful login. This can't be true because after successfully logging in, my LoggedInTemplate is shown. The username and passwords are simply stored in a array. Heres the Login.aspx page code. Protected Sub btnLogin_Click(ByVal sender As Object, ByVal e As System.EventArgs) _ Handles btnLogin.Click ' Three valid username/password pairs: Scott/password, Jisun/password, and Sam/password. Dim users() As String = {"Scott", "Jisun", "Sam"} Dim passwords() As String = {"password", "password", "password"} For i As Integer = 0 To users.Length - 1 Dim validUsername As Boolean = (String.Compare(txtUserName.Text, users(i), True) = 0) Dim validPassword As Boolean = (String.Compare(txtPassword.Text, passwords(i), False) = 0) If validUsername AndAlso validPassword Then FormsAuthentication.RedirectFromLoginPage(txtUserName.Text, chkRemember.Checked) End If Next ' If we reach here, the user's credentials were invalid lblInvalid.Visible = True End Sub Here is the content place holder on the master page specifically designed to hold Login Information. On successfull login, the page is redirected to '/Default.aspx', and the LoggedIn Template below is shown...but the status says Log In. <asp:ContentPlaceHolder Id="LoginContent" runat="server"> <asp:LoginView ID="LoginView1" runat="server"> <LoggedInTemplate> Welcome back, <asp:LoginName ID="LoginName1" runat="server" />. </LoggedInTemplate> <AnonymousTemplate> Hello, stranger. </AnonymousTemplate> </asp:LoginView> <br /> <asp:LoginStatus ID="LoginStatus1" runat="server" LogoutAction="Redirect" LogoutPageUrl="~/Logout.aspx" /> </asp:ContentPlaceHolder> Forms authentication is enabled. I'm not sure what to do about this :o.

    Read the article

  • BitmapFrame in another thread

    - by Lasse Lindström
    Hi I am using a WPF BackgroundWorker to create thumbnails. My worker function looks like: private void work(object sender, DoWorkEventArgs e) { try { var paths = e.Argument as string[]; var boxList = new List(); foreach (string path in paths) { if (!string.IsNullOrEmpty(path)) { FileInfo info = new FileInfo(path); if (info.Exists && info.Length 0) { BitmapImage bi = new BitmapImage(); bi.BeginInit(); bi.DecodePixelWidth = 200; bi.CacheOption = BitmapCacheOption.OnLoad; bi.UriSource = new Uri(info.FullName); bi.EndInit(); var item = new BoxItem(); item.FilePath = path; MemoryStream ms = new MemoryStream(); PngBitmapEncoder encoder = new PngBitmapEncoder(); encoder.Frames.Add(BitmapFrame.Create(bi)); encoder.Save(ms); item.ThumbNail = ms.ToArray(); ms.Close(); boxList.Add(item); } } } e.Result = boxList; } catch (Exception ex) { //nerver comes here } } When this fuction is finnished and before the BackgroundWorker "Completed" function is started, I can see on the output window on Vs2008, that a exception is generated. It looks like: A first chance exception of type 'System.NotSupportedException' occurred in PresentationCore.dll The number of exceptions generates equals the number of thumbnails to be generated. Using "trial and error" I have isolated the problem to: BitmapFrame.Create(bi) Removing that line (makes my function useless) also removes the exception. I have not found any explanation to this,,, or a better method to create thumbnails i a background thread. Can anyone help me? //lasse

    Read the article

  • How to delete a large cookie that causes Apache to 400

    - by jakemcgraw
    I've come across an issue where a web application has managed to create a cookie on the client, which, when submitted by the client to Apache, causes Apache to return the following: HTTP/1.1 400 Bad Request Date: Mon, 08 Mar 2010 21:21:21 GMT Server: Apache/2.2.3 (Red Hat) Content-Length: 7274 Connection: close Content-Type: text/html; charset=iso-8859-1 <!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML 2.0//EN"> <html><head> <title>400 Bad Request</title> </head><body> <h1>Bad Request</h1> <p>Your browser sent a request that this server could not understand.<br /> Size of a request header field exceeds server limit.<br /> <pre> Cookie: ::: A REALLY LONG COOKIE ::: </pre> </p> <hr> <address>Apache/2.2.3 (Red Hat) Server at www.foobar.com Port 80</address> </body></html> After looking into the issue, it would appear that the web application has managed to create a really long cookie, over 7000 characters. Now, don't ask me how the web application was able to do this, I was under the impression browsers were supposed to prevent this from happening. I've managed to come up with a solution to prevent the cookies from growing out of control again. The issue I'm trying to tackle is how do I reset the large cookie on the client if every time the client tries to submit a request to Apache, Apache returns a 400 client error? I've tried using the ErrorDocument directive, but it appears that Apache bails on the request before reaching any custom error handling.

    Read the article

  • Java: volatile guarantees and out-of-order execution

    - by WizardOfOdds
    Note that this question is solely about the volatile keyword and the volatile guarantees: it is not about the synchronized keyword (so please don't answer "you must use synchronize" for I don't have any issue to solve: I simply want to understand the volatile guarantees (or lack of guarantees) regarding out-of-order execution). Say we have an object containing two volatile String references that are initialized to null by the constructor and that we have only one way to modify the two String: by calling setBoth(...) and that we can only set their references afterwards to non-null reference (only the constructor is allowed to set them to null). For example (it's just an example, there's no question yet): public class SO { private volatile String a; private volatile String b; public SO() { a = null; b = null; } public void setBoth( @NotNull final String one, @NotNull final String two ) { a = one; b = two; } public String getA() { return a; } public String getB() { return b; } } In setBoth(...), the line assigning the non-null parameter "a" appears before the line assigning the non-null parameter "b". Then if I do this (once again, there's no question, the question is coming next): if ( so.getB() != null ) { System.out.println( so.getA().length ); } Am I correct in my understanding that due to out-of-order execution I can get a NullPointerException? In other words: there's no guarantee that because I read a non-null "b" I'll read a non-null "a"? Because due to out-of-order (multi)processor and the way volatile works "b" could be assigned before "a"? volatile guarantees that reads subsequent to a write shall always see the last written value, but here there's an out-of-order "issue" right? (once again, the "issue" is made on purpose to try to understand the semantics of the volatile keyword and the Java Memory Model, not to solve a problem).

    Read the article

  • Clustering on WebLogic exception on Failover

    - by Markos Fragkakis
    Hi all, I deploy an application on a WebLogic 10.3.2 cluster with two nodes, and a load balancer in front of the cluster. I have set the <core:init distributable="true" debug="true" /> My Session and Conversation classes implement Serializable. I start using the application being served by the first node. The console shows that the session replication is working. <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> <Jun 17, 2010 11:43:50 AM EEST> <Info> <Cluster> <BEA-000128> <Updating 5903057688359791237S:xxx.yyy.gr:[7002,7002,-1,-1,-1,-1,-1]:xxx.yyy.gr:7002,xxx.yyy.gr:7002:prs_domain:PRS_Server_2 in the cluster.> When I shutdown the first node from the Administration console, I get this in the other node: <Jun 17, 2010 11:23:46 AM EEST> <Error> <Kernel> <BEA-000802> <ExecuteRequest failed java.lang.NullPointerException. java.lang.NullPointerException at org.jboss.seam.intercept.JavaBeanInterceptor.callPostActivate(JavaBeanInterceptor.java:165) at org.jboss.seam.intercept.JavaBeanInterceptor.invoke(JavaBeanInterceptor.java:73) at com.myproj.beans.SortingFilteringBean_$$_javassist_seam_2.sessionDidActivate(SortingFilteringBean_$$_javassist_seam_2.java) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2258) at weblogic.servlet.internal.session.SessionData.notifyActivated(SessionData.java:2222) at weblogic.servlet.internal.session.ReplicatedSessionData.becomePrimary(ReplicatedSessionData.java:231) at weblogic.cluster.replication.WrappedRO.changeStatus(WrappedRO.java:142) at weblogic.cluster.replication.WrappedRO.ensureStatus(WrappedRO.java:129) at weblogic.cluster.replication.LocalSecondarySelector$ChangeSecondaryInfo.run(LocalSecondarySelector.java:542) at weblogic.work.SelfTuningWorkManagerImpl$WorkAdapterImpl.run(SelfTuningWorkManagerImpl.java:516) at weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) at weblogic.work.ExecuteThread.run(ExecuteThread.java:173) > What am I doing wrong? This is the SortingFilteringBean: import java.util.HashMap; import java.util.LinkedHashMap; import org.jboss.seam.ScopeType; import org.jboss.seam.annotations.Name; import org.jboss.seam.annotations.Scope; import com.myproj.model.crud.Filtering; import com.myproj.model.crud.Sorting; import com.myproj.model.crud.SortingOrder; /** * Managed bean aggregating the sorting and filtering values for all the * application's lists. A light-weight bean to always keep in the session with * minimum impact. */ @Name("sortingFilteringBean") @Scope(ScopeType.SESSION) public class SortingFilteringBean extends BaseManagedBean { private static final long serialVersionUID = 1L; private Sorting applicantProductListSorting; private Filtering applicantProductListFiltering; private Sorting homePageSorting; private Filtering homePageFiltering; /** * Creates a new instance of SortingFilteringBean. */ public SortingFilteringBean() { // ********************** // Applicant Product List // ********************** // Sorting LinkedHashMap<String, SortingOrder> applicantProductListSortingValues = new LinkedHashMap<String, SortingOrder>(); applicantProductListSortingValues.put("applicantName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("applicantEmail", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productName", SortingOrder.ASCENDING); applicantProductListSortingValues.put("productEmail", SortingOrder.ASCENDING); applicantProductListSorting = new Sorting( applicantProductListSortingValues); // Filtering HashMap<String, String> applicantProductListFilteringValues = new HashMap<String, String>(); applicantProductListFilteringValues.put("applicantName", ""); applicantProductListFilteringValues.put("applicantEmail", ""); applicantProductListFilteringValues.put("productName", ""); applicantProductListFilteringValues.put("productEmail", ""); applicantProductListFiltering = new Filtering( applicantProductListFilteringValues); // ********* // Home page // ********* // Sorting LinkedHashMap<String, SortingOrder> homePageSortingValues = new LinkedHashMap<String, SortingOrder>(); homePageSortingValues.put("productName", SortingOrder.ASCENDING); homePageSortingValues.put("productId", SortingOrder.ASCENDING); homePageSortingValues.put("productAtcCode", SortingOrder.UNSORTED); homePageSortingValues.put("productEmaNumber", SortingOrder.UNSORTED); homePageSortingValues.put("productOrphan", SortingOrder.UNSORTED); homePageSortingValues.put("productRap", SortingOrder.UNSORTED); homePageSortingValues.put("productCorap", SortingOrder.UNSORTED); homePageSortingValues.put("applicationTypeDescription", SortingOrder.ASCENDING); homePageSortingValues.put("applicationId", SortingOrder.ASCENDING); homePageSortingValues .put("applicationEmaNumber", SortingOrder.UNSORTED); homePageSortingValues .put("piVersionImportDate", SortingOrder.ASCENDING); homePageSortingValues.put("piVersionId", SortingOrder.ASCENDING); homePageSorting = new Sorting(homePageSortingValues); // Filtering HashMap<String, String> homePageFilteringValues = new HashMap<String, String>(); homePageFilteringValues.put("productName", ""); homePageFilteringValues.put("productAtcCode", ""); homePageFilteringValues.put("productEmaNumber", ""); homePageFilteringValues.put("applicationTypeId", ""); homePageFilteringValues.put("applicationEmaNumber", ""); homePageFilteringValues.put("piVersionImportDate", ""); homePageFiltering = new Filtering(homePageFilteringValues); } /** * @return the applicantProductListFiltering */ public Filtering getApplicantProductListFiltering() { return applicantProductListFiltering; } /** * @param applicantProductListFiltering * the applicantProductListFiltering to set */ public void setApplicantProductListFiltering( Filtering applicantProductListFiltering) { this.applicantProductListFiltering = applicantProductListFiltering; } /** * @return the applicantProductListSorting */ public Sorting getApplicantProductListSorting() { return applicantProductListSorting; } /** * @param applicantProductListSorting * the applicantProductListSorting to set */ public void setApplicantProductListSorting( Sorting applicantProductListSorting) { this.applicantProductListSorting = applicantProductListSorting; } /** * @return the homePageSorting */ public Sorting getHomePageSorting() { return homePageSorting; } /** * @param homePageSorting * the homePageSorting to set */ public void setHomePageSorting(Sorting homePageSorting) { this.homePageSorting = homePageSorting; } /** * @return the homePageFiltering */ public Filtering getHomePageFiltering() { return homePageFiltering; } /** * @param homePageFiltering * the homePageFiltering to set */ public void setHomePageFiltering(Filtering homePageFiltering) { this.homePageFiltering = homePageFiltering; } /** * For convenience to view in the Seam Debug page. * * @see java.lang.Object#toString() */ @Override public String toString() { StringBuilder sb = new StringBuilder(""); sb.append("\n\n"); sb.append("applicantProductListSorting"); sb.append(applicantProductListSorting); sb.append("\n\n"); sb.append("applicantProductListFiltering"); sb.append(applicantProductListFiltering); sb.append("\n\n"); sb.append("homePageSorting"); sb.append(homePageSorting); sb.append("\n\n"); sb.append("homePageFiltering"); sb.append(homePageFiltering); return sb.toString(); } } And this is the BaseManagedBean, inheriting the AbstractMutable. import java.io.IOException; import java.io.OutputStream; import java.util.List; import javax.faces.application.FacesMessage; import javax.faces.application.FacesMessage.Severity; import javax.faces.context.FacesContext; import javax.servlet.http.HttpServletResponse; import org.apache.commons.lang.ArrayUtils; import org.jboss.seam.core.AbstractMutable; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.myproj.common.exceptions.WebException; import com.myproj.common.util.FileUtils; import com.myproj.common.util.StringUtils; import com.myproj.web.messages.Messages; public abstract class BaseManagedBean extends AbstractMutable { private static final Logger logger = LoggerFactory .getLogger(BaseManagedBean.class); private FacesContext facesContext; /** * Set a message to be displayed for a specific component. * * @param resourceBundle * the resource bundle where the message appears. Either base or * id may be used. * @param summaryResourceId * the id of the resource to be used as summary. For the detail * of the element, the element to be used will be the same with * the suffix {@code _detail}. * @param parameters * the parameters, in case the string is parameterizable * @param severity * the severity of the message * @param componentId * the component id for which the message is destined. Note that * an appropriate JSF {@code <h:message for="myComponentId">} tag * is required for the to appear, or alternatively a {@code * <h:messages>} tag. */ protected void setMessage(String resourceBundle, String summaryResourceId, List<Object> parameters, Severity severity, String componentId, Messages messages) { FacesContext context = getFacesContext(); FacesMessage message = messages.getMessage(resourceBundle, summaryResourceId, parameters); if (severity != null) { message.setSeverity(severity); } context.addMessage(componentId, message); } /** * Copies a byte array to the response output stream with the appropriate * MIME type and content disposition. The response output stream is closed * after this method. * * @param response * the HTTP response * @param bytes * the data * @param filename * the suggested file name for the client * @param mimeType * the MIME type; will be overridden if the filename suggests a * different MIME type * @throws IllegalArgumentException * if the data array is <code>null</code>/empty or both filename * and mimeType are <code>null</code>/empty */ protected void printBytesToResponse(HttpServletResponse response, byte[] bytes, String filename, String mimeType) throws WebException, IllegalArgumentException { if (response.isCommitted()) { throw new WebException("HTTP response is already committed"); } if (ArrayUtils.isEmpty(bytes)) { throw new IllegalArgumentException("Data buffer is empty"); } if (StringUtils.isEmpty(filename) && StringUtils.isEmpty(mimeType)) { throw new IllegalArgumentException( "Filename and MIME type are both null/empty"); } // Set content type (mime type) String calculatedMimeType = FileUtils.getMimeType(filename); // not among the known ones String newMimeType = mimeType; if (calculatedMimeType == null) { // given mime type passed if (mimeType == null) { // none available put default mime-type newMimeType = "application/download"; } else { if ("application/octet-stream".equals(mimeType)) { // small modification newMimeType = "application/download"; } } } else { // calculated mime type has precedence over given mime type newMimeType = calculatedMimeType; } response.setContentType(newMimeType); // Set content disposition and other headers String contentDisposition = "attachment;filename=\"" + filename + "\""; response.setHeader("Content-Disposition", contentDisposition); response.setHeader("Expires", "0"); response.setHeader("Cache-Control", "max-age=30"); response.setHeader("Pragma", "public"); // Set content length response.setContentLength(bytes.length); // Write bytes to response OutputStream out = null; try { out = response.getOutputStream(); out.write(bytes); } catch (IOException e) { throw new WebException("Error writing data to HTTP response", e); } finally { try { out.close(); } catch (Exception e) { logger.error("Error closing HTTP stream", e); } } } /** * Retrieve a session-scoped managed bean. * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected Object getSessionBean(String sessionBeanName) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { throw new IllegalArgumentException("No such object in Session"); } else { return sessionScopedBean; } } /** * Set a session-scoped managed bean * * @param sessionBeanName * the session-scoped managed bean name * @return the session-scoped managed bean */ protected boolean setSessionBean(String sessionBeanName, Object sessionBean) { Object sessionScopedBean = FacesContext.getCurrentInstance() .getExternalContext().getSessionMap().get(sessionBeanName); if (sessionScopedBean == null) { FacesContext.getCurrentInstance().getExternalContext() .getSessionMap().put(sessionBeanName, sessionBean); } else { throw new IllegalArgumentException( "This session-scoped bean was already initialized"); } return true; } /** * For testing (enables mock of FacesContext) * * @return the faces context */ public FacesContext getFacesContext() { if (facesContext == null) { return FacesContext.getCurrentInstance(); } return facesContext; } /** * For testing (enables mocking of FacesContext). * * @param aFacesContext * a - possibly mock - faces context. */ public void setFacesContext(FacesContext aFacesContext) { this.facesContext = aFacesContext; } }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • how to read image uri in to byte conversion in android image upload in sdcard

    - by satyamurthy
    public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Button b1 = (Button) findViewById(R.id.Button01); b1.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { // TODO Auto-generated method stub startActivityForResult(new Intent(Intent.ACTION_PICK,android.provider.MediaStore.Images.Media.INTERNAL_CONTENT_URI), 1); } }); } public void onActivityResult(int requestCode,int resultCode,Intent data) { super.onActivityResult(requestCode, resultCode, data); if (resultCode == Activity.RESULT_OK) { Uri selectedImage = data.getData(); Cursor cur = PhotoImage.this.managedQuery(selectedImage, null, null, null, null); if(cur.moveToFirst()) { File Img = new File(selectedImage+inFileType); try { FileInputStream fis = new FileInputStream(Img); Bitmap bi = BitmapFactory.decodeStream(fis); ByteArrayOutputStream baos = new ByteArrayOutputStream(); bi.compress(Bitmap.CompressFormat.JPEG, 100, baos); byte[] data1 = baos.toByteArray(); for (int i = 0; i < data1.length; i++) { System.out.print(""+data1[i]); } } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } } } } } this code not i am implementing file not found error please help some suggition

    Read the article

  • Unable to load images into each MC?

    - by Hwang
    The images only loads into the last MC, how to make it load into each MC? private function imageHandler():void { imageBox=new MovieClip(); imageBox.graphics.lineStyle(5, 0xFFFFFF); imageBox.graphics.beginFill(0xFF0000); imageBox.graphics.drawRect(0,0,150,225); imageBox.graphics.endFill(); allImage.addChild(imageBox); } private function getPhoto():void { for (i=0; i<myXMLList.length(); i++) { placePhoto(); imageHandler(); imagesArray.push(imageBox); imagesArray[i].x=20+(200*i); } addChild(allImage); allImage.x=-(allImage.width+20); allImage.y=-(allImage.height+50); } private function placePhoto():void { loadedPic=myXMLList[i].@PIC; galleryLoader = new Loader(); galleryLoader.load(new URLRequest(loadedPic)); galleryLoader.contentLoaderInfo.addEventListener(Event.COMPLETE,picLoaded); } private function picLoaded(event:Event):void { bmp=new Bitmap(event.target.content.bitmapData); bmp.smoothing=true; imageBox.addChild(bmp); }

    Read the article

  • Use jquery to create a multidimensional array

    - by Simon M White
    I'd like to use jquery and a multidemensional array to show a random quote plus the name of the individual who wrote it as a separate item. I'll then be able to use css to style them differently. The quote will change upon page refresh. So far i have this code which combines the quote and the name and person who wrote it: $(document).ready(function(){ var myQuotes = new Array(); myQuotes[0] = "Lorem ipsum dolor sit amet, consectetur adipiscing elit. Donec in tortor mauris. Peter Jones, Dragons Den"; myQuotes[1] = "Curabitur interdum, nibh et fringilla facilisis, lacus ipsum pulvinar mauris, eu facilisis justo arcu eget diam. Duis id sagittis elit. Theo Pathetis, Dragons Den"; myQuotes[2] = "Vivamus purus purus, tincidunt et porttitor et, euismod sit amet urna. Etiam sollicitudin eros nec metus pretium scelerisque. James Caan, Dragons Den"; var myRandom = Math.floor(Math.random()*myQuotes.length); $('.quote-holder blockquote span').html(myQuotes[myRandom]); }); any help would be greatly appreciated.

    Read the article

  • Custom Validation Attribute with Custom Model Binder in MVC 2

    - by griegs
    I apologise for the amount of code I have included. I've tried to keep it to a minimum. I'm trying to have a Custom Validator Attribute on my model as well as a Custom Model binder. The Attribute and the Binder work great seperately but if I have both, then the Validation Attribute no longer works. Here is my code snipped for readability. If I leave out the code in global.asax the custom validation fires but not if I have the custom binder enabled. Validation Attribute; public class IsPhoneNumberAttribute : ValidationAttribute { public override bool IsValid(object value) { //do some checking on 'value' here return true; } } Useage of the attribute in my model; [Required(ErrorMessage = "Please provide a contact number")] [IsPhoneNumberAttribute(ErrorMessage = "Not a valid phone number")] public string Phone { get; set; } Custom Model Binder; public class CustomContactUsBinder : DefaultModelBinder { protected override void OnModelUpdated(ControllerContext controllerContext, ModelBindingContext bindingContext) { ContactFormViewModel contactFormViewModel = bindingContext.Model as ContactFormViewModel; if (!String.IsNullOrEmpty(contactFormViewModel.Phone)) if (contactFormViewModel.Phone.Length > 10) bindingContext.ModelState.AddModelError("Phone", "Phone is too long."); } } Global asax; System.Web.Mvc.ModelBinders.Binders[typeof(ContactFormViewModel)] = new CustomContactUsBinder();

    Read the article

  • How to mmap the stack for the clone() system call on linux?

    - by Joseph Garvin
    The clone() system call on Linux takes a parameter pointing to the stack for the new created thread to use. The obvious way to do this is to simply malloc some space and pass that, but then you have to be sure you've malloc'd as much stack space as that thread will ever use (hard to predict). I remembered that when using pthreads I didn't have to do this, so I was curious what it did instead. I came across this site which explains, "The best solution, used by the Linux pthreads implementation, is to use mmap to allocate memory, with flags specifying a region of memory which is allocated as it is used. This way, memory is allocated for the stack as it is needed, and a segmentation violation will occur if the system is unable to allocate additional memory." The only context I've ever heard mmap used in is for mapping files into memory, and indeed reading the mmap man page it takes a file descriptor. How can this be used for allocating a stack of dynamic length to give to clone()? Is that site just crazy? ;) In either case, doesn't the kernel need to know how to find a free bunch of memory for a new stack anyway, since that's something it has to do all the time as the user launches new processes? Why does a stack pointer even need to be specified in the first place if the kernel can already figure this out?

    Read the article

  • Why am I getting 'Heap Corruption'?

    - by fneep
    Please don't crucify me for this one. I decided it might be good to use a char* because the string I intended to build was of a known size. I am also aware that if timeinfo-tm_hour returns something other than 2 digits, things are going to go badly wrong. That said, when this function returns VIsual Studio goes ape at me about HEAP CORRUPTION. What's going wrong? (Also, should I just use a stringbuilder?) void cLogger::_writelogmessage(std::string Message) { time_t rawtime; struct tm* timeinfo = 0; time(&rawtime); timeinfo = localtime(&rawtime); char* MessageBuffer = new char[Message.length()+11]; char* msgptr = MessageBuffer; _itoa(timeinfo->tm_hour, msgptr, 10); msgptr+=2; strcpy(msgptr, "::"); msgptr+=2; _itoa(timeinfo->tm_min, msgptr, 10); msgptr+=2; strcpy(msgptr, "::"); msgptr+=2; _itoa(timeinfo->tm_sec, msgptr, 10); msgptr+=2; strcpy(msgptr, " "); msgptr+=1; strcpy(msgptr, Message.c_str()); _file << MessageBuffer; delete[] MessageBuffer; }

    Read the article

  • funny behavior of jquery code

    - by user253530
    Funny thing is that if i delete the comment for alert(data[i].id) the code works. As it is in the example, the string is not concatenated thus i have no options in the select box. Hints? Help? var bookmarkingSites = ''; $.getJSON("php/socialbookmark-get-bookmarking-sites.php",function(data){ for(var i = 0; i < data.length; i++){ //alert( data[i].id); bookmarkingSites += '<option value = \"' + data[i].id + '\">' + data[i].title + '</option>'; } }); <some more code> -------> toAppend += '<td><select name="sb2" id="sb2">'+ '<option value="'+ data.results[i].bookmark +'">' + data.results[i].bookmark +'</option>' + bookmarkingSites + '</select></td>'; <some more code>

    Read the article

  • Using jQuery to parse an RSS feed, having trouble in firefox and chrome.

    - by sjmarshy
    I used a jQuery library called jFeed to parse and display my blogs rss feed on my personal website. It worked perfectly well at first, but upon checking later it simply displays nothing, except in Internet Explorer, where it seems to work fine. After checking the javascript console using Firebug in Firefox, it shows an error in the 'XML' tab as follows: XML Parsing Error: no element found Location: moz-nullprincipal:{3f8a0c62-32b4-4f63-b69c- 9ef402b40b64} Line Number 1, Column 1: ^ Though I have no idea what to do with this information. Here is the code I used to get the rss feed and display it (it is almost exactly the same as the example provided by the jFeed website): jQuery.getFeed({ url: 'http://sammarshalldesign.co.uk/blog/wordpress/?feed=rss2', success: function(feed) { var html = ''; for(var i = 0; i < feed.items.length && i < 5; i++) { var item = feed.items[i]; html += '<h3>' + '<a href="' + item.link + '">' + item.title + '</a>' + '</h3>'; html += '<div>' + item.description + '</div>'; }//end for jQuery('#feed').append(html); }//end feed function });//end getfeed Any help would be really appreciated.

    Read the article

  • MooTools/JavaScript variable scope

    - by 827
    I am trying to make each number displayed clickable. "1" should alert() 80, "2" should produce 60, etc. However, when the alert(adjust) is called, it only shows 0, not the correct numbers. However, if the commented out alert(adjust) is uncommented, it produces the correct number on page load, but not on clicking. I was wondering why the code inside addEvents cannot access the previously defined variable adjust. <html> <head> <script type="text/javascript" charset="utf-8" src="mootools.js"></script> <script type="text/javascript" charset="utf-8"> window.addEvent('domready', function() { var id_numbers = [1,2,3,4,5]; for(var i = 0; i<id_numbers.length; i++) { var adjust = (20 * (5 - id_numbers[i])); // alert(adjust); $('i_' + id_numbers[i]).addEvents({ 'click': function() { alert(adjust); } }); } }); </script> </head> <body> <div id="i_1">1</div> <div id="i_2">2</div> <div id="i_3">3</div> <div id="i_4">4</div> <div id="i_5">5</div> </body> </html> Thanks.

    Read the article

  • changing background on JLabel shifts components

    - by Aly
    Hi, The code I am using is: public class Test extends JFrame implements ActionListener{ private static final Color TRANSP_WHITE = new Color(new Float(1), new Float(1), new Float(1), new Float(0.5)); private static final Color TRANSP_RED = new Color(new Float(1), new Float(0), new Float(0), new Float(0.1)); private static final Color[] COLORS = new Color[]{ TRANSP_RED, TRANSP_WHITE}; private int index = 0; private JLabel label; private JButton button; public Test(){ super(); setLayout(new BoxLayout(getContentPane(), BoxLayout.Y_AXIS)); label = new JLabel("hello world"); label.setOpaque(true); label.setBackground(TRANSP_WHITE); getContentPane().add(label); button = new JButton("Click Me"); button.addActionListener(this); getContentPane().add(button); pack(); setVisible(true); } @Override public void actionPerformed(ActionEvent e) { if(e.getSource().equals(button)){ label.setBackground(COLORS[index % (COLORS.length )]); index ++; } } public static void main(String[] args) { new Test(); } } When I click the button to change the labales color the GUI looks like this: Before: After: Any ideas why?

    Read the article

  • jquery newbie: combine validate with hidding submit button.

    - by Jeffb
    I'm new a jQuery. I have gotten validate to work with my form (MVC 1.0 / C#) with this: <script type="text/javascript"> if (document.forms.length > 0) { document.forms[0].id = "PageForm"; document.forms[0].name = "PageForm"; } $(document).ready(function() { $("#PageForm").validate({ rules: { SigP: { required: true } }, messages: { SigP: "<font color='red'><b>A Sig Value is required. </b></font>" } }); }); </script> I also want to hide the Submit button to prevent twitchy mouse syndrome from causing duplicate entry before the controller completes and redirects (I'm using an GPR pattern). The following works for this purpose: <script type="text/javascript"> // // prevent double-click on submit // jQuery('input[type=submit]').click(function() { if (jQuery.data(this, 'clicked')) { return false; } else { jQuery.data(this, 'clicked', true); return true; } }); </script> However, I can't get the two to work together. Specifically, if validate fails after the Submit button is clicked (which happens given how the form works), then I can't get the form submitted again unless I do a browser refresh that resets the 'clicked' property. How can I rewrite the second method above to not set the clicked property unless the form validates? Thx.

    Read the article

  • Silverlight: how to use a scroll viewer to wrap a list view without specifying height?

    - by John Nicholas
    I have a control that has a list that varies in length greatly. This control appears in various places meaning that i cannot calculate its position and desired height easily. Moreover all I want is for the scrollviewer to simply size itself according to its parent. currently it insists on sizing itself according to the content. currently when i have a list that exceeds the height of the screen the whole control extends off the bottom and the scrollviewer shows no bar (because it has stretched to the heigth of the contents and so thinks it is not required). I've not included code as the object graph is fairly deep. What i am looking for is a set of conditions that would cause the scrollviewer to resize itself according to its content rather than its parent. I have it working in a similar situation involving grids and datagrids, the unique part of this control is that there is a list containing controls. Any ideas? I would prefer solutions that don't require use of code behind - but im really not in a position to be choosey.

    Read the article

< Previous Page | 261 262 263 264 265 266 267 268 269 270 271 272  | Next Page >