Search Results

Search found 7110 results on 285 pages for 'community faq proposed'.

Page 268/285 | < Previous Page | 264 265 266 267 268 269 270 271 272 273 274 275  | Next Page >

  • Square Peg Web: Gets you the traffic to where it matters most: Your Website!

    - by demetriusalwyn
    Have you decided to start your business online or is your business not reaching the targeted audience? Come to Square Peg Web; where you will find what you want to make your business reach new heights. The team at Square Peg Web is professionals who understand what you want and make sure you get it right. Our confidence stems from the fact of thousands of satisfied clients who keep referring friends and business associates to us and we do not let our clients down. Many companies promise the sky but how far is does their work live up to the promises? We do not know about the others however, we are sure that we strive to put together all our ideas and thoughts to make your website rank among the top. Web hosting is something that needs to have a personal touch; Square Peg Web customizes everything to suit your requirements so that you do not have to look further. With Square Peg Web you have a host of features to make your Business go viral. Some of the product details that are offered with Square Peg Web are unlimited product options/ variants/ properties giving you an option on price modifiers. You get unlimited customized input fields for your products and you can also Customer-define the prices. Square Peg Web provides you an option of using multiple product images with zoom features and one can also list a particular product in several categories. There are other aspects which make Square Peg Web the best choice for your website needs; every sale of yours’ is important to you and to us. We make sure that each sale is tracked by the product and also the list of bestsellers that appeal to the audience. Other comprehensive statistics of Square Peg Web includes searchable order data, an interface for shipments and order fulfillments, export sales & customer data for usage in a spreadsheet and the ability to export orders to QuickBooks format. With Square Peg Web; Admin Panel is a lot simpler. Administrative access is completely password protected and any changes done are all in real-time. You can have absolute control on the cart from anywhere around the world using your web browser and the topping on the cake is the unlimited amount of admin accounts that can be created for you. Square Peg Web offers you a world of experience with the options of choosing from marketing websites to e-commerce and from customized applications to community oriented sites. Some of the projects which appear in the portfolio of Square Peg Web are Online Marketing Web Sites, E-Commerce Web Sites, customized web applications, Blog designing and programming, video sharing and the option of downloading web sites, online advertisements, flash animation, customer and product support web sites, web site re-designing and planning and complete information architecture.

    Read the article

  • java.util.zip - ZipInputStream v.s. ZipFile

    - by lucho
    Hello, community! I have some general questions regarding the java.util.zip library. What we basically do is an import and an export of many small components. Previously these components were imported and exported using a single big file, e.g.: <component-type-a id="1"/> <component-type-a id="2"/> <component-type-a id="N"/> <component-type-b id="1"/> <component-type-b id="2"/> <component-type-b id="N"/> Please note that the order of the components during import is relevant. Now every component should occupy its own file which should be externally versioned, QA-ed, bla, bla. We decided that the output of our export should be a zip file (with all these files in) and the input of our import should be a similar zip file. We do not want to explode the zip in our system. We do not want opening separate streams for each of the small files. My current questions: Q1. May the ZipInputStream guarantee that the zip entries (the little files) will be read in the same order in which they were inserted by our export that uses ZipOutputStream? I assume reading is something like: ZipInputStream zis = new ZipInputStream(new BufferedInputStream(fis)); ZipEntry entry; while((entry = zis.getNextEntry()) != null) { //read from zis until available } I know that the central zip directory is put at the end of the zip file but nevertheless the file entries inside have sequential order. I also know that relying on the order is an ugly idea but I just want to have all the facts in mind. Q2. If I use ZipFile (which I prefer) what is the performance impact of calling getInputStream() hundreds of times? Will it be much slower than the ZipInputStream solution? The zip is opened only once and ZipFile is backed by RandomAccessFile - is this correct? I assume reading is something like: ZipFile zipfile = new ZipFile(argv[0]); Enumeration e = zipfile.entries();//TODO: assure the order of the entries while(e.hasMoreElements()) { entry = (ZipEntry) e.nextElement(); is = zipfile.getInputStream(entry)); } Q3. Are the input streams retrieved from the same ZipFile thread safe (e.g. may I read different entries in different threads simultaneously)? Any performance penalties? Thanks for your answers!

    Read the article

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • Learn C# now or finish up with Java and then learn C#?

    - by Sahat
    Ok here is my situation. I've studied Java in my college for 2 semesters. But you know they teach you jack in there, just the basics. We skipped half of our textbook and even then our professors don't teach from section to section of each chapter. I don't blame them. It's hard as it is for new students to understand even the basic concepts of programming. Now this is a community college we are talking about and not Stanford, MIT or Berkeley. So like I said I've done 2 semester of Java. I really like our textbook because it has some challenging projects to do at the end of each chapter. This textbook is pretty clear and i have no problem understanding it (although 2-D and 3-D Arrays have given me some trouble). I have tried reading a few C# books such as Pro C# 2008 and .NET 3.5 and C# 4.0 in a Nutshell. I found these books to be dry and overloaded with information that put me to sleep (No offense to the authors of those 2 wonderful, according to amazon ratings, books). Would you suggest I finish my Java textbook, brush up my knowledge of Arrays, Polymorphism, and etc that are universal to most programming languages. And then switch to C#, plus the syntax is very similar so it should be easy to switch. Or should I just start learning C# right now from the very beginning? If it's the latter then could you recommend some free online resources that will keep me engaged and at the same time teach me everything I need to know about C#. Someone has recommended me to learn .NET first, but I found it to be not the brightest idea. .NET is just a big monster full of libraries. How am I going to apply it if I don't even know the C# or VB!? Anyway back to my question: Master Java and switch to C# or just go with C#? DISCLAIMER: I don't want to start .NET vs J2EE or C# vs Java flame war. I am going with C#. I've decided that I want to work in a Microsoft shop in the future. .NET is what I want to learn. Thanks! Will be waiting for the answers.

    Read the article

  • Migrating from hand-written persistence layer to ORM

    - by Sergey Mikhanov
    Hi community, We are currently evaluating options for migrating from hand-written persistence layer to ORM. We have a bunch of legacy persistent objects (~200), that implement simple interface like this: interface JDBC { public long getId(); public void setId(long id); public void retrieve(); public void setDataSource(DataSource ds); } When retrieve() is called, object populates itself by issuing handwritten SQL queries to the connection provided using the ID it received in the setter (this usually is the only parameter to the query). It manages its statements, result sets, etc itself. Some of the objects have special flavors of retrive() method, like retrieveByName(), in this case a different SQL is issued. Queries could be quite complex, we often join several tables to populate the sets representing relations to other objects, sometimes join queries are issued on-demand in the specific getter (lazy loading). So basically, we have implemented most of the ORM's functionality manually. The reason for that was performance. We have very strong requirements for speed, and back in 2005 (when this code was written) performance tests has shown that none of mainstream ORMs were that fast as hand-written SQL. The problems we are facing now that make us think of ORM are: Most of the paths in this code are well-tested and are stable. However, some rarely-used code is prone to result set and connection leaks that are very hard to detect We are currently squeezing some additional performance by adding caching to our persistence layer and it's a huge pain to maintain the cached objects manually in this setup Support of this code when DB schema changes is a big problem. I am looking for an advice on what could be the best alternative for us. As far as I know, ORMs has advanced in last 5 years, so it might be that now there's one that offers an acceptable performance. As I see this issue, we need to address those points: Find some way to reuse at least some of the written SQL to express mappings Have the possibility to issue native SQL queries without the necessity to manually decompose their results (i.e. avoid manual rs.getInt(42) as they are very sensitive to schema changes) Add a non-intrusive caching layer Keep the performance figures. Is there any ORM framework you could recommend with regards to that?

    Read the article

  • Patterns: Local Singleton vs. Global Singleton?

    - by Mike Rosenblum
    There is a pattern that I use from time to time, but I'm not quite sure what it is called. I was hoping that the SO community could help me out. The pattern is pretty simple, and consists of two parts: A singleton factory, which creates objects based on the arguments passed to the factory method. Objects created by the factory. So far this is just a standard "singleton" pattern or "factory pattern". The issue that I'm asking about, however, is that the singleton factory in this case maintains a set of references to every object that it ever creates, held within a dictionary. These references can sometimes be strong references and sometimes weak references, but it can always reference any object that it has ever created. When receiving a request for a "new" object, the factory first searches the dictionary to see if an object with the required arguments already exits. If it does, it returns that object, if not, it returns a new object and also stores a reference to the new object within the dictionary. This pattern prevents having duplicative objects representing the same underlying "thing". This is useful where the created objects are relatively expensive. It can also be useful where these objects perform event handling or messaging - having one object per item being represented can prevent multiple messages/events for a single underlying source. There are probably other reasons to use this pattern, but this is where I've found this useful. My question is: what to call this? In a sense, each object is a singleton, at least with respect to the data it contains. Each is unique. But there are multiple instances of this class, however, so it's not at all a true singleton. In my own personal terminology, I tend to call the factory method a "global singleton". I then call the created objects "local singletons". I sometimes also say that the created objects have "reference equality", meaning that if two variables reference the same data (the same underlying item) then the reference they each hold must be to the same exact object, hence "reference equality". But these are my own invented terms, and I am not sure that they are good ones. Is there standard terminology for this concept? And if not, could some naming suggestions be made? Thanks in advance...

    Read the article

  • Rails learn's confusion

    - by Steve
    This is a beginner's rails learning confusion. When I learn rails, from time to time, I feel frustrated on rails' principle "Convention over Configuration". Rails uses heavily on conventions. A lot of them are just naming conventions. If I forget a convention, I will either use the wrong naming and get unexpected result or get things magically done but don't understand how. Sometimes, I think of configuration. At least configuration lists everything clearly and nothing is in fog. In rails, there seems a hidden, dark contract between you and the machine. If you follow the contract, you communicate well. But a beginner usually forgets items listed on the contract and this usually leads to confusion. That's why when I first pick up rails, I feel like it is somehow difficult to learn. Besides, there are many other things that could be new to a learner, such as using git, using plugins from community, using RESTful routing style, using RSpec. All these are new and come together in learning ruby and rails. This definitely adds up difficulties for a beginner. In contrast, if you learn php, it wouldn't be that bad. You can forget many things and focus on learning php itself. You don't need to learn database handling if you know SQL already(in rails, you need to learn a whole new concept migration), you don't have to learn a new decent unit test(in rails, usually they teach RSpec along the way because rails is agile and you should learn test-driven development in the early learning stage), you don't have to learn a new version control(in rails, you will be taught about git anyway), you don't have to use complicated plugins(in rails, they usually use third-party plugins in textbook examples! what the hell? why not teach how to do a simplified similar thing in rails?), you don't have to worry RESTful style. All in all, when I learn php, I learn it quick and soon I start to write things myself. Learning php is similar to learning C/java. It tastes like those traditional languages. When I learn rails, it is more difficult. And I need to learn ruby as well (I believe many of you learn ruby just because of rails). Does anyone have the similar feeling as I have? How do you overcome it and start to master rails? Hints will be welcomed. Thank you.

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • Sitecore E-Commerce Module - Discount/Promotional Codes

    - by Zachary Kniebel
    I am working on a project for which I must use Sitecore's E-Commerce Module (and Sitecore 6.5 rev. 120706 - aka 'Update 5') to create a web-store. One of the features that I am trying to implement is a generic promotional/discount code system - customer enters a code at checkout which grants a discount like 'free shipping', '20% off', etc. At the moment, I am looking for some guidance (a high-level solution, a few pseudo-ideas, some references to review, etc) as to how this can be accomplished. Summary: What I am looking for is a way to detect whether or not the user entered a promo code at a previous stage in the checkout line, and to determine what that promo code is, if they did. Progress Thus Far: I have thoroughly reviewed all of the Sitecore E-Commerce Services (SES) documentation, especially "SES Order Line Extension" documentation (which I believe will have to be modified/extended in order to accomplish this task). Additionally, I have thoroughly reviewed the Sitecore Community article Extending Sitecore E-Commerce - Pricing and believe that it may be a useful guide for applying a discount statically, but does not say much in the way of applying a discount dynamically. After reviewing these documents, I have come up with the following possible high-level solution to start from: I create a template to represent a promotional code, which holds all data relevant to the promotion (percent off, free shipping, code, etc). I then create another template (based on the Product Search Group template) that holds a link to an item within a global "Promotional Code" items folder. Next, I use the Product Search Group features of my new template to choose which products to apply the discount to. In the source code for the checkout I create a class that checks if a code has been entered and, if so, somehow carry it through the rest of the checkout process. This is where I get stuck. More Details: No using cookies No GET requests No changing/creating/deleting items in the Sitecore Database during the checkout process (e.g., no manipulation of fields of a discount item during checkout to signal that the discount has been applied) must stay within the scope of C# Last Notes: I will update this post with any more information that I find/progress that I make. I upgrade all answers that are relevant and detailed, thought-provoking, or otherwise useful to me and potentially useful to others, in addition to any high-level answers that serve as a feasible solution to this problem; even if your idea doesn't help me, if I think it will help someone else I will still upgrade it. Thanks, in advance, for all your help! :)

    Read the article

  • HTML-like GUI Framework in Java

    - by wintermute
    I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Commitment to Zend Framework - any arguments against?

    - by Pekka
    I am refurbishing a big CMS that I have been working on for quite a number of years now. The product itself is great, but some components, the Database and translation classes for example, need urgent replacing - partly self-made as far back as 2002, grown into a bit of a chaos over time, and might have trouble surviving a security audit. So, I've been looking closely at a number of frameworks (or, more exactly, component Libraries, as I do not intend to change the basic structure of the CMS) and ended up with liking Zend Framework the best. They offer a solid MVC model but don't force you into it, and they offer a lot of professional components that have obviously received a lot of attention (Did you know there are multiple plurals in Russian, and you can't translate them using a simple ($number == 0) or ($number > 1) switch? I didn't, but Zend_Translate can handle it. Just to illustrate the level of thorougness the library seems to have been built with.) I am now literally at the point of no return, starting to replace key components of the system by the Zend-made ones. I'm not really having second thoughts - and I am surely not looking to incite a flame war - but before going onward, I would like to step back for a moment and look whether there is anything speaking against tying a big system closely to Zend Framework. What I like about Zend: As far as I can see, very high quality code Extremely well documented, at least regarding introductions to how things work (Haven't had to use detailed API documentation yet) Backed by a company that has an interest in seeing the framework prosper Well received in the community, has a considerable user base Employs coding standards I like Comes with a full set of unit tests Feels to me like the right choice to make - or at least, one of the right choices - in terms of modern, professional PHP development. I have been thinking about encapsulating and abstracting ZF's functionality into own classes to be able to switch frameworks more easily, but have come to the conclusion that this would not be a good idea because: it would be an unnecessary level of abstraction it could cost performance the big advantage of using a framework - the existence of a developer base that is familiar with its components - would partly be cancelled out therefore, the commitment to ZF would be a deep one. Thus my question: Is there anything substantial speaking against committing to the Zend Framework? Do you have insider knowledge of plans of Zend Inc.'s to go evil in 2011, and make it a closed source library? Is Zend Inc. run by vampires? Are there conceptual flaws in the code base you start to notice when you've transitioned all your projects to it? Is the appearance of quality code an illusion? Does the code look good, but run terribly slow on anything below my quad-core workstation?

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

  • Which is the "best" data access framework/approach for C# and .NET?

    - by Frans
    (EDIT: I made it a community wiki as it is more suited to a collaborative format.) There are a plethora of ways to access SQL Server and other databases from .NET. All have their pros and cons and it will never be a simple question of which is "best" - the answer will always be "it depends". However, I am looking for a comparison at a high level of the different approaches and frameworks in the context of different levels of systems. For example, I would imagine that for a quick-and-dirty Web 2.0 application the answer would be very different from an in-house Enterprise-level CRUD application. I am aware that there are numerous questions on Stack Overflow dealing with subsets of this question, but I think it would be useful to try to build a summary comparison. I will endeavour to update the question with corrections and clarifications as we go. So far, this is my understanding at a high level - but I am sure it is wrong... I am primarily focusing on the Microsoft approaches to keep this focused. ADO.NET Entity Framework Database agnostic Good because it allows swapping backends in and out Bad because it can hit performance and database vendors are not too happy about it Seems to be MS's preferred route for the future Complicated to learn (though, see 267357) It is accessed through LINQ to Entities so provides ORM, thus allowing abstraction in your code LINQ to SQL Uncertain future (see Is LINQ to SQL truly dead?) Easy to learn (?) Only works with MS SQL Server See also Pros and cons of LINQ "Standard" ADO.NET No ORM No abstraction so you are back to "roll your own" and play with dynamically generated SQL Direct access, allows potentially better performance This ties in to the age-old debate of whether to focus on objects or relational data, to which the answer of course is "it depends on where the bulk of the work is" and since that is an unanswerable question hopefully we don't have to go in to that too much. IMHO, if your application is primarily manipulating large amounts of data, it does not make sense to abstract it too much into objects in the front-end code, you are better off using stored procedures and dynamic SQL to do as much of the work as possible on the back-end. Whereas, if you primarily have user interaction which causes database interaction at the level of tens or hundreds of rows then ORM makes complete sense. So, I guess my argument for good old-fashioned ADO.NET would be in the case where you manipulate and modify large datasets, in which case you will benefit from the direct access to the backend. Another case, of course, is where you have to access a legacy database that is already guarded by stored procedures. ASP.NET Data Source Controls Are these something altogether different or just a layer over standard ADO.NET? - Would you really use these if you had a DAL or if you implemented LINQ or Entities? NHibernate Seems to be a very powerful and powerful ORM? Open source Some other relevant links; NHibernate or LINQ to SQL Entity Framework vs LINQ to SQL

    Read the article

  • Java - Layering issues with Lists and Graphics2D

    - by Mirrorcrazy
    So I have a DisplayPanel class that extends JPanel and that also paints my numerous images for my program using Graphics2D. In order to be able to easily customly use this I set it up so that every time the panel is repainted it uses a List, that I can add to or remove from as the program processes. My problem is with layering. I've run into an issue where the List must have reached its resizing point (or something whacky like that) and so the images i want to display end up beneath all of the other images already on the screen. I've come to the community for an answer because I have faith you will provide a good one. DisplayPanel: package earthworm; import java.awt.Graphics; import java.awt.Graphics2D; import java.util.ArrayList; import java.util.List; import javax.swing.JPanel; public class DisplayPanel extends JPanel { private List<ImageMap> images = new ArrayList(); public DisplayPanel() { setSize(800, 640); refresh(); } public void refresh() { revalidate(); repaint(); } @Override public void paintComponent(Graphics g) { super.paintComponent(g); Graphics2D g2d = (Graphics2D) g; g2d.clearRect(0, 0, 800, 640); for(int i = 0; i < images.size(); i++) g2d.drawImage( images.get(i).getImage(), images.get(i).getX(), images.get(i).getY(), null); } public void paintImage(ImageMap[] images, ImageMap[] clearImages, boolean clear) { if(clear) this.images.clear(); else if(clearImages!=null) for(int i = 0; i < clearImages.length; i++) this.images.remove(clearImages[i]); if(images!=null) for(int i = 0; i<images.length; i++) this.images.add(images[i]); refresh(); } }

    Read the article

  • Java template classes using generator or similar?

    - by Hugh Perkins
    Is there some library or generator that I can use to generate multiple templated java classes from a single template? Obviously Java does have a generics implementation itself, but since it uses type-erasure, there are lots of situations where it is less than adequate. For example, if I want to make a self-growing array like this: class EasyArray { T[] backingarray; } (where T is a primitive type), then this isn't possible. This is true for anything which needs an array, for example high-performance templated matrix and vector classes. It should probably be possible to write a code generator which takes a templated class and generates multiple instantiations, for different types, eg for 'double' and 'float' and 'int' and 'String'. Is there something that already exists that does this? Edit: note that using an array of Object is not what I'm looking for, since it's no longer an array of primitives. An array of primitives is very fast, and uses only as much space a sizeof(primitive) * length-of-array. An array of object is an array of pointers/references, that points to Double objects, or similar, which could be scattered all over the place in memory, require garbage collection, allocation, and imply a double-indirection for access. Edit2: good god, voted down for asking for something that probably doesn't currently exist, but is technically possible and feasible? Does that mean that people looking for ways to improve things have already left the java community? Edit3: Here is code to show the difference in performance between primitive and boxed arrays: int N = 10*1000*1000; double[]primArray = new double[N]; for( int i = 0; i < N; i++ ) { primArray[i] = 123.0; } Object[] objArray = new Double[N]; for( int i = 0; i < N; i++ ) { objArray[i] = 123.0; } tic(); primArray = new double[N]; for( int i = 0; i < N; i++ ) { primArray[i] = 123.0; } toc(); tic(); objArray = new Double[N]; for( int i = 0; i < N; i++ ) { objArray[i] = 123.0; } toc(); Results: double[] array: 148 ms Double[] array: 4614 ms Not even close!

    Read the article

  • Fill 4 input with one textarea

    - by Patrice Poliquin
    I have a question for the community. My problem is that I have 4 input files with a maxlength of 60 caracters for a total of 240 caracters. Because the "backend" of the customer's system, it need to be 4 differents inputs max to be inserted and they say it is not user-friendly to fill 4 fields. My solution I want to make a textarea and when you fill it, il complete the 4 fields. [input text #1] max60 [input text #2] max60 [input text #3] max60 [input text #4] max60 [textarea max 240] What I am trying to do is to make by javascript/jQuery to fill up the four field while typing in. At the moment, here is my code. $(document).ready(function() { // My text area $("#inf_notes").bind('keydown', function () { var maxLength = 240; if ($(this).val().length <= 60) { // The first 60 caracters $('#inf_notes_1').val($(this).val()); } if ($(this).val().length > 60 && $(this).val().length <= 120) { // If more then 60, fill the second field $('#inf_notes_2').val($(this).val()); } // If 121 - 180 ... // If 181 - 240 ... if($(this).val().length == 240) { $(this).val($(this).val().substring(0, maxLength)); $('.alert_textarea').show(); // Simple alert else { $('.alert_textarea').hide(); } }); }); It actually works for the first one, but I would like to have some feedbacks to help me complete the script to fill the 3 nexts. Any guess to complete it? -- EDIT #1 I found a way that could maybe work! When the first input is completly filled, it will jump to the next field with a .focus() $(".inf_notes").bind('keydown', function () { var notes1 = $('#inf_notes_1').val(); var notes2 = $('#inf_notes_2').val(); var notes3 = $('#inf_notes_3').val(); if (notes1.length == 60) { $('#inf_notes_2').focus(); } if (notes2.length == 60) { $('#inf_notes_3').focus(); } if (notes3.length == 60) { $('#inf_notes_4').focus(); } });

    Read the article

  • Correct use of a "for...in" loop in javascript?

    - by jnkrois
    Hello everybody, before I ask my question I wanted to let everybody know that I appreciate the fact that there's always somebody out there willing to help, and on my end I'll try to give back to the community as much as I can. Thanks Now, I would like to get some pointers as to how to properly take advantage of the "for...in" loop in JavaScript, I already did some research and tried a couple things but it is still not clear to me how to properly use it. Let's say I have a random number of "select" tags in an HTML form, and I don't require the user to select an option for all of them, they can leave some untouched if they want. However I need to know if they selected none or at least one. The way I'm trying to find out if the user selected any of them is by using the "for...in" loop. For example: var allSelected = $("select option:selected"); var totalSelected = $("select option:selected").length; The first variable produces an array of all the selected options. The second variable tells me how many selected options I have in the form (select tags could be more than one and it changes every time). Now, in order to see if any has been selected I loop through each element (selected option), and retrieve the "value" attribute. The default "option" tag has a value="0", so if any selected option returns a value greater than 0, I know at least one option has been selected, however it does not have to be in order, this is my loop so far: for(var i = 0; i < totalSelected; i++){ var eachOption = $(allSelected[i]).val(); var defaultValue = 0; if(eachOption == defaultValue){ ...redirect to another page }else if(eachOption > defaultValue){ ... I display an alert } } My problem here is that as soon as the "if" matches a 0 value, it sends the user to the next page without testing the rest of the elements in the array, and the user could have selected the second or third options. What I really want to do is check all the elements in the array and then take the next action, in my mind this is how I could do it, but I'm not getting it right: var randomValue = 25; for(randomValue in allSelected){ var found = true; var notFound = false if(found){ display an alert }else{ redirect to next page } } This loop or the logic I'm using are flawed (I'm pretty sure), what I want to do is test all the elements in the array against a single variable and take the next action accordingly. I hope this makes some sense to you guys, any help would be appreciated. Thanks, JC

    Read the article

  • SQL version control methodology

    - by Tom H.
    There are several questions on SO about version control for SQL and lots of resources on the web, but I can't find something that quite covers what I'm trying to do. First off, I'm talking about a methodology here. I'm familiar with the various source control applications out there and I'm familiar with tools like Red Gate's SQL Compare, etc. and I know how to write an application to check things in and out of my source control system automatically. If there is a tool which would be particularly helpful in providing a whole new methodology or which have a useful and uncommon functionality then great, but for the tasks mentioned above I'm already set. The requirements that I'm trying to meet are: The database schema and look-up table data are versioned DML scripts for data fixes to larger tables are versioned A server can be promoted from version N to version N + X where X may not always be 1 Code isn't duplicated within the version control system - for example, if I add a column to a table I don't want to have to make sure that the change is in both a create script and an alter script The system needs to support multiple clients who are at various versions for the application (trying to get them all up to within 1 or 2 releases, but not there yet) Some organizations keep incremental change scripts in their version control and to get from version N to N + 3 you would have to run scripts for N-N+1 then N+1-N+2 then N+2-N+3. Some of these scripts can be repetitive (for example, a column is added but then later it is altered to change the data type). We're trying to avoid that repetitiveness since some of the client DBs can be very large, so these changes might take longer than necessary. Some organizations will simply keep a full database build script at each version level then use a tool like SQL Compare to bring a database up to one of those versions. The problem here is that intermixing DML scripts can be a problem. Imagine a scenario where I add a column, use a DML script to fill said column, then in a later version that column name is changed. Perhaps there is some hybrid solution? Maybe I'm just asking for too much? Any ideas or suggestions would be greatly appreciated though. If the moderators think that this would be more appropriate as a community wiki, please let me know. Thanks!

    Read the article

  • Is it possible to make this Flex/Flash application safe?

    - by Frank
    I'm back with another Flex/Flash security question. I've already received some help from the community on this topic, but I'm still not quite sure this is the best way to do. Here's the thing. A flex web app, a lot of users (1000+), custom configuration of the application depending of the user group. Can I make this thing safe... or safer. For the moment, when a user comes to the application, there is only one configuration possible, but for the next version we've implented a multi-configuration protocol, this way : 1. The user connect to Default.aspx, server code process the windows credentials (whe are on intranet) and give the correct xml configuration file. 2. The flex app loads with the xml conf file as a flashvar and then the app 'builds' itself with the content of the xml file. As we know, since this is a flex application the swf is downloaded on the client computer and the xml file too. If more than one user connects to the app, from the same computer, the can possibly see the other xml file in the windows temp folder. The current directory of the application looks that way : Web site |-> default.aspx |-> index.swf |-> configAdmin.xml |-> configUserType1.xml |-> configUserType2.xml |-> com |-> a lot of swf and xml files I was first thinking making another directory (without read access for the client) containing all the configurations xml files, picking the right one, copying it to the client and deleting it afterwards. But it seems like I must let know the user know when downloading/deleting content on it's computer... I'm running out of ideas, so I hope you have some great ones. It's there are some design flaws (in the way the app is build, not in Flash :p) please share. I'm always looking forward to improve. Thanks Update : In browser Flash/Flex (without AIR that is) doesn't allow deleting file localy silently (on the client computer, where the application is). It's also not yet possible to get session data.

    Read the article

  • Ajax Control Toolkit Now Supports jQuery

    - by Stephen.Walther
    I’m excited to announce the September 2013 release of the Ajax Control Toolkit, which now supports building new Ajax Control Toolkit controls with jQuery. You can download the latest release of the Ajax Control Toolkit from http://AjaxControlToolkit.CodePlex.com or you can install the Ajax Control Toolkit directly within Visual Studio by executing the following NuGet command: The New jQuery Extender Base Class This release of the Ajax Control Toolkit introduces a new jQueryExtender base class. This new base class enables you to create Ajax Control Toolkit controls with jQuery instead of the Microsoft Ajax Library. Currently, only one control in the Ajax Control Toolkit has been rewritten to use the new jQueryExtender base class (only one control has been jQueryized). The ToggleButton control is the first of the Ajax Control Toolkit controls to undergo this dramatic transformation. All of the other controls in the Ajax Control Toolkit are written using the Microsoft Ajax Library. We hope to gradually rewrite these controls as jQuery controls over time. You can view the new jQuery ToggleButton live at the Ajax Control Toolkit sample site: http://www.asp.net/ajaxLibrary/AjaxControlToolkitSampleSite/ToggleButton/ToggleButton.aspx Why are we rewriting Ajax Control Toolkits with jQuery? There are very few developers actively working with the Microsoft Ajax Library while there are thousands of developers actively working with jQuery. Because we want talented developers in the community to continue to contribute to the Ajax Control Toolkit, and because almost all JavaScript developers are familiar with jQuery, it makes sense to support jQuery with the Ajax Control Toolkit. Also, we believe that the Ajax Control Toolkit is a great framework for Web Forms developers who want to build new ASP.NET controls that use JavaScript. The Ajax Control Toolkit has great features such as automatic bundling, minification, caching, and compression. We want to make it easy for ASP.NET developers to build new controls that take advantage of these features. Instantiating Controls with data-* Attributes We took advantage of the new JQueryExtender base class to change the way that Ajax Control Toolkit controls are instantiated. In the past, adding an Ajax Control Toolkit to a page resulted in inline JavaScript being injected into the page. For example, adding the ToggleButton control to a page injected the following HTML and script: <input id="ctl00_SampleContent_CheckBox1" name="ctl00$SampleContent$CheckBox1" type="checkbox" checked="checked" /> <script type="text/javascript"> //<![CDATA[ Sys.Application.add_init(function() { $create(Sys.Extended.UI.ToggleButtonBehavior, {"CheckedImageAlternateText":"Check", "CheckedImageUrl":"ToggleButton_Checked.gif", "ImageHeight":19, "ImageWidth":19, "UncheckedImageAlternateText":"UnCheck", "UncheckedImageUrl":"ToggleButton_Unchecked.gif", "id":"ctl00_SampleContent_ToggleButtonExtender1"}, null, null, $get("ctl00_SampleContent_CheckBox1")); }); //]]> </script> Notice the call to the JavaScript $create() method at the bottom of the page. When using the Microsoft Ajax Library, this call to the $create() method is necessary to create the Ajax Control Toolkit control. This inline script looks pretty ugly to a modern JavaScript developer. Inline script! Horrible! The jQuery version of the ToggleButton injects the following HTML and script into the page: <input id="ctl00_SampleContent_CheckBox1" name="ctl00$SampleContent$CheckBox1" type="checkbox" checked="checked" data-act-togglebuttonextender="imageWidth:19, imageHeight:19, uncheckedImageUrl:'ToggleButton_Unchecked.gif', checkedImageUrl:'ToggleButton_Checked.gif', uncheckedImageAlternateText:'I don&#39;t understand why you don&#39;t like ASP.NET', checkedImageAlternateText:'It&#39;s really nice to hear from you that you like ASP.NET'" /> Notice that there is no script! There is no call to the $create() method. In fact, there is no inline JavaScript at all. The jQuery version of the ToggleButton uses an HTML5 data-* attribute instead of an inline script. The ToggleButton control is instantiated with a data-act-togglebuttonextender attribute. Using data-* attributes results in much cleaner markup (You don’t need to feel embarrassed when selecting View Source in your browser). Ajax Control Toolkit versus jQuery So in a jQuery world why is the Ajax Control Toolkit needed at all? Why not just use jQuery plugins instead of the Ajax Control Toolkit? For example, there are lots of jQuery ToggleButton plugins floating around the Internet. Why not just use one of these jQuery plugins instead of using the Ajax Control Toolkit ToggleButton control? There are three main reasons why the Ajax Control Toolkit continues to be valuable in a jQuery world: Ajax Control Toolkit controls run on both the server and client jQuery plugins are client only. A jQuery plugin does not include any server-side code. If you need to perform any work on the server – think of the AjaxFileUpload control – then you can’t use a pure jQuery solution. Ajax Control Toolkit controls provide a better Visual Studio experience You don’t get any design time experience when you use jQuery plugins within Visual Studio. Ajax Control Toolkit controls, on the other hand, are designed to work with Visual Studio. For example, you can use the Visual Studio Properties window to set Ajax Control Toolkit control properties. Ajax Control Toolkit controls shield you from working with JavaScript I like writing code in JavaScript. However, not all developers like JavaScript and some developers want to completely avoid writing any JavaScript code at all. The Ajax Control Toolkit enables you to take advantage of JavaScript (and the latest features of HTML5) in your ASP.NET Web Forms websites without writing a single line of JavaScript. Better ToolkitScriptManager Documentation With this release, we have added more detailed documentation for using the ToolkitScriptManager. In particular, we added documentation that describes how to take advantage of the new bundling, minification, compression, and caching features of the Ajax Control Toolkit. The ToolkitScriptManager documentation is part of the Ajax Control Toolkit sample site and it can be read here: http://www.asp.net/ajaxLibrary/AjaxControlToolkitSampleSite/ToolkitScriptManager/ToolkitScriptManager.aspx Other Fixes This release of the Ajax Control Toolkit includes several important bug fixes. For example, the Ajax Control Toolkit Twitter control was completely rewritten with this release. Twitter is in the process of retiring the first version of their API. You can read about their plans here: https://dev.twitter.com/blog/planning-for-api-v1-retirement We completely rewrote the Ajax Control Toolkit Twitter control to use the new Twitter API. To take advantage of the new Twitter API, you must get a key and access token from Twitter and add the key and token to your web.config file. Detailed instructions for using the new version of the Ajax Control Toolkit Twitter control can be found here: http://www.asp.net/ajaxLibrary/AjaxControlToolkitSampleSite/Twitter/Twitter.aspx   Summary We’ve made some really great changes to the Ajax Control Toolkit over the last two releases to modernize the toolkit. In the previous release, we updated the Ajax Control Toolkit to use a better bundling, minification, compression, and caching system. With this release, we updated the Ajax Control Toolkit to support jQuery. We also continue to update the Ajax Control Toolkit with important bug fixes. I hope you like these changes and I look forward to hearing your feedback.

    Read the article

  • sudo apt-get update errors

    - by Adrian Begi
    Here is what I get on my terminal when running sudo apt-get update errors. I dont know if the issue is from my sources.list or my proxy setup(have not made any changes to proxies). Thank you for any help in advanced. Ign http://security.ubuntu.com oneiric-security Release.gpg Ign http://security.ubuntu.com oneiric-security Release Ign http://security.ubuntu.com oneiric-security/main Sources/DiffIndex Ign http://security.ubuntu.com oneiric-security/restricted Sources/DiffIndex Ign http://security.ubuntu.com oneiric-security/universe Sources/DiffIndex Ign http://security.ubuntu.com oneiric-security/multiverse Sources/DiffIndex Ign http://security.ubuntu.com oneiric-security/main amd64 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/restricted amd64 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/universe amd64 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/multiverse amd64 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/main i386 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/restricted i386 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/universe i386 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/multiverse i386 Packages/DiffIndex Ign http://security.ubuntu.com oneiric-security/main TranslationIndex Ign http://security.ubuntu.com oneiric-security/multiverse TranslationIndex Ign http://security.ubuntu.com oneiric-security/restricted TranslationIndex Ign http://security.ubuntu.com oneiric-security/universe TranslationIndex Err http://security.ubuntu.com oneiric-security/main Sources 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/restricted Sources 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/universe Sources 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/multiverse Sources 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/main amd64 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/restricted amd64 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/universe amd64 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/multiverse amd64 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/main i386 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/restricted i386 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/universe i386 Packages 404 Not Found [IP: 91.189.91.15 80] Err http://security.ubuntu.com oneiric-security/multiverse i386 Packages 404 Not Found [IP: 91.189.91.15 80] Ign http://security.ubuntu.com oneiric-security/main Translation-en_US Ign http://security.ubuntu.com oneiric-security/main Translation-en Ign http://security.ubuntu.com oneiric-security/multiverse Translation-en_US Ign http://security.ubuntu.com oneiric-security/multiverse Translation-en Ign http://security.ubuntu.com oneiric-security/restricted Translation-en_US Ign http://security.ubuntu.com oneiric-security/restricted Translation-en Ign http://security.ubuntu.com oneiric-security/universe Translation-en_US Ign http://security.ubuntu.com oneiric-security/universe Translation-en W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/main/source/Sources 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/restricted/source/Sources 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/universe/source/Sources 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/multiverse/source/Sources 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/main/binary-amd64/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/restricted/binary-amd64/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/universe/binary-amd64/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/multiverse/binary-amd64/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/main/binary-i386/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/restricted/binary-i386/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/universe/binary-i386/Packages 404 Not Found [IP: 91.189.91.15 80] W: Failed to fetch http://security.ubuntu.com/ubuntu/dists/oneiric-security/multiverse/binary-i386/Packages 404 Not Found [IP: 91.189.91.15 80] E: Some index files failed to download. They have been ignored, or old ones used instead. HERE IS MY SOURCES.LIST # # deb cdrom:[Ubuntu-Server 11.10 _Oneiric Ocelot_ - Release amd64 (20111011)]/ dists/oneiric/main/binary-i386/ # deb cdrom:[Ubuntu-Server 11.10 _Oneiric Ocelot_ - Release amd64 (20111011)]/ dists/oneiric/restricted/binary-i386/ # deb cdrom:[Ubuntu-Server 11.10 _Oneiric Ocelot_ - Release amd64 (20111011)]/ oneiric main restricted #deb cdrom:[Ubuntu-Server 11.10 _Oneiric Ocelot_ - Release amd64 (20111011)]/ dists/oneiric/main/binary-i386/ #deb cdrom:[Ubuntu-Server 11.10 _Oneiric Ocelot_ - Release amd64 (20111011)]/ dists/oneiric/restricted/binary-i386/ #deb cdrom:[Ubuntu-Server 11.10 _Oneiric Ocelot_ - Release amd64 (20111011)]/ oneiric main restricted # See http://help.ubuntu.com/community/UpgradeNotes for how to upgrade to # newer versions of the distribution. deb http://us.archive.ubuntu.com/ubuntu/ oneiric main restricted deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric main restricted ## Major bug fix updates produced after the final release of the ## distribution. deb http://us.archive.ubuntu.com/ubuntu/ oneiric-updates main restricted deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric-updates main restricted ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team. Also, please note that software in universe WILL NOT receive any ## review or updates from the Ubuntu security team. deb http://us.archive.ubuntu.com/ubuntu/ oneiric universe deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric universe deb http://us.archive.ubuntu.com/ubuntu/ oneiric-updates universe deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric-updates universe ## N.B. software from this repository is ENTIRELY UNSUPPORTED by the Ubuntu ## team, and may not be under a free licence. Please satisfy yourself as to ## your rights to use the software. Also, please note that software in ## multiverse WILL NOT receive any review or updates from the Ubuntu ## security team. deb http://us.archive.ubuntu.com/ubuntu/ oneiric multiverse deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric multiverse deb http://us.archive.ubuntu.com/ubuntu/ oneiric-updates multiverse deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric-updates multiverse ## N.B. software from this repository may not have been tested as ## extensively as that contained in the main release, although it includes ## newer versions of some applications which may provide useful features. ## Also, please note that software in backports WILL NOT receive any review ## or updates from the Ubuntu security team. deb http://us.archive.ubuntu.com/ubuntu/ oneiric-backports main restricted universe multiverse deb-src http://us.archive.ubuntu.com/ubuntu/ oneiric-backports main restricted universe multiverse deb http://security.ubuntu.com/ubuntu oneiric-security main restricted deb-src http://security.ubuntu.com/ubuntu oneiric-security main restricted deb http://security.ubuntu.com/ubuntu oneiric-security universe deb-src http://security.ubuntu.com/ubuntu oneiric-security universe deb http://security.ubuntu.com/ubuntu oneiric-security multiverse deb-src http://security.ubuntu.com/ubuntu oneiric-security multiverse ## Uncomment the following two lines to add software from Canonical's ## 'partner' repository. ## This software is not part of Ubuntu, but is offered by Canonical and the ## respective vendors as a service to Ubuntu users. # deb http://archive.canonical.com/ubuntu oneiric partner # deb-src http://archive.canonical.com/ubuntu oneiric partner ## Uncomment the following two lines to add software from Ubuntu's ## 'extras' repository. ## This software is not part of Ubuntu, but is offered by third-party ## developers who want to ship their latest software. # deb http://extras.ubuntu.com/ubuntu oneiric main # deb-src http://extras.ubuntu.com/ubuntu oneiric main

    Read the article

  • javafx tableview get selected data from ObservableList

    - by user3717821
    i am working on a javafx project and i need your help . while i am trying to get selected data from table i can get selected data from normal cell but can't get data from ObservableList inside tableview. code for my database: -- phpMyAdmin SQL Dump -- version 4.0.4 -- http://www.phpmyadmin.net -- -- Host: localhost -- Generation Time: Jun 10, 2014 at 06:20 AM -- Server version: 5.1.33-community -- PHP Version: 5.4.12 SET SQL_MODE = "NO_AUTO_VALUE_ON_ZERO"; SET time_zone = "+00:00"; /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; -- -- Database: `test` -- -- -------------------------------------------------------- -- -- Table structure for table `customer` -- CREATE TABLE IF NOT EXISTS `customer` ( `col0` int(11) NOT NULL, `col1` varchar(255) DEFAULT NULL, `col2` int(11) DEFAULT NULL, PRIMARY KEY (`col0`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1; -- -- Dumping data for table `customer` -- INSERT INTO `customer` (`col0`, `col1`, `col2`) VALUES (12, 'adasdasd', 231), (22, 'adasdasd', 231), (212, 'adasdasd', 231); /*!40101 SET CHARACTER_SET_CLIENT=@OLD_CHARACTER_SET_CLIENT */; /*!40101 SET CHARACTER_SET_RESULTS=@OLD_CHARACTER_SET_RESULTS */; /*!40101 SET COLLATION_CONNECTION=@OLD_COLLATION_CONNECTION */; my javafx codes: import java.sql.Connection; import java.sql.DriverManager; import java.sql.ResultSet; import java.sql.SQLException; import java.util.Map; import javafx.application.Application; import javafx.beans.property.SimpleStringProperty; import javafx.beans.value.ChangeListener; import javafx.beans.value.ObservableValue; import javafx.collections.FXCollections; import javafx.collections.ObservableList; import javafx.event.ActionEvent; import javafx.event.EventHandler; import javafx.scene.Scene; import javafx.scene.control.Button; import javafx.scene.control.TableCell; import javafx.scene.control.TableColumn; import javafx.scene.control.TableColumn.CellDataFeatures; import javafx.scene.control.TablePosition; import javafx.scene.control.TableView; import javafx.scene.control.TableView.TableViewSelectionModel; import javafx.scene.control.cell.ChoiceBoxTableCell; import javafx.scene.control.cell.TextFieldTableCell; import javafx.scene.layout.BorderPane; import javafx.stage.Stage; import javafx.util.Callback; import javafx.util.StringConverter; class DBConnector { private static Connection conn; private static String url = "jdbc:mysql://localhost/test"; private static String user = "root"; private static String pass = "root"; public static Connection connect() throws SQLException{ try{ Class.forName("com.mysql.jdbc.Driver").newInstance(); }catch(ClassNotFoundException cnfe){ System.err.println("Error: "+cnfe.getMessage()); }catch(InstantiationException ie){ System.err.println("Error: "+ie.getMessage()); }catch(IllegalAccessException iae){ System.err.println("Error: "+iae.getMessage()); } conn = DriverManager.getConnection(url,user,pass); return conn; } public static Connection getConnection() throws SQLException, ClassNotFoundException{ if(conn !=null && !conn.isClosed()) return conn; connect(); return conn; } } public class DynamicTable extends Application{ Object newValue; //TABLE VIEW AND DATA private ObservableList<ObservableList> data; private TableView<ObservableList> tableview; //MAIN EXECUTOR public static void main(String[] args) { launch(args); } //CONNECTION DATABASE public void buildData(){ tableview.setEditable(true); Callback<TableColumn<Map, String>, TableCell<Map, String>> cellFactoryForMap = new Callback<TableColumn<Map, String>, TableCell<Map, String>>() { @Override public TableCell call(TableColumn p) { return new TextFieldTableCell(new StringConverter() { @Override public String toString(Object t) { return t.toString(); } @Override public Object fromString(String string) { return string; } }); } }; Connection c ; data = FXCollections.observableArrayList(); try{ c = DBConnector.connect(); //SQL FOR SELECTING ALL OF CUSTOMER String SQL = "SELECT * from CUSTOMer"; //ResultSet ResultSet rs = c.createStatement().executeQuery(SQL); /********************************** * TABLE COLUMN ADDED DYNAMICALLY * **********************************/ for(int i=0 ; i<rs.getMetaData().getColumnCount(); i++){ //We are using non property style for making dynamic table final int j = i; TableColumn col = new TableColumn(rs.getMetaData().getColumnName(i+1)); if(j==1){ final ObservableList<String> logLevelList = FXCollections.observableArrayList("FATAL", "ERROR", "WARN", "INFO", "INOUT", "DEBUG"); col.setCellFactory(ChoiceBoxTableCell.forTableColumn(logLevelList)); tableview.getColumns().addAll(col); } else{ col.setCellValueFactory(new Callback<CellDataFeatures<ObservableList,String>,ObservableValue<String>>(){ public ObservableValue<String> call(CellDataFeatures<ObservableList, String> param) { return new SimpleStringProperty(param.getValue().get(j).toString()); } }); tableview.getColumns().addAll(col); } if(j!=1) col.setCellFactory(cellFactoryForMap); System.out.println("Column ["+i+"] "); } /******************************** * Data added to ObservableList * ********************************/ while(rs.next()){ //Iterate Row ObservableList<String> row = FXCollections.observableArrayList(); for(int i=1 ; i<=rs.getMetaData().getColumnCount(); i++){ //Iterate Column row.add(rs.getString(i)); } System.out.println("Row [1] added "+row ); data.add(row); } //FINALLY ADDED TO TableView tableview.setItems(data); }catch(Exception e){ e.printStackTrace(); System.out.println("Error on Building Data"); } } @Override public void start(Stage stage) throws Exception { //TableView Button showDataButton = new Button("Add"); showDataButton.setOnAction(new EventHandler<ActionEvent>() { public void handle(ActionEvent event) { ObservableList<String> row = FXCollections.observableArrayList(); for(int i=1 ; i<=3; i++){ //Iterate Column row.add("asdasd"); } data.add(row); //FINALLY ADDED TO TableView tableview.setItems(data); } }); tableview = new TableView(); buildData(); //Main Scene BorderPane root = new BorderPane(); root.setCenter(tableview); root.setBottom(showDataButton); Scene scene = new Scene(root,500,500); stage.setScene(scene); stage.show(); tableview.getSelectionModel().selectedItemProperty().addListener(new ChangeListener() { @Override public void changed(ObservableValue observableValue, Object oldValue, Object newValue) { //Check whether item is selected and set value of selected item to Label if (tableview.getSelectionModel().getSelectedItem() != null) { TableViewSelectionModel selectionModel = tableview.getSelectionModel(); ObservableList selectedCells = selectionModel.getSelectedCells(); TablePosition tablePosition = (TablePosition) selectedCells.get(0); Object val = tablePosition.getTableColumn().getCellData(newValue); System.out.println("Selected Value " + val); System.out.println("Selected row " + newValue); } } }); } } please help me..

    Read the article

  • Week in Geek: US Govt E-card Scam Siphons Confidential Data Edition

    - by Asian Angel
    This week we learned how to “back up photos to Flickr, automate repetitive tasks, & normalize MP3 volume”, enable “stereo mix” in Windows 7 to record audio, create custom papercraft toys, read up on three alternatives to Apple’s flaky iOS alarm clock, decorated our desktops & app docks with Google icon packs, and more. Photo by alexschlegel. Random Geek Links It has been a busy week on the security & malware fronts and we have a roundup of the latest news to help keep you updated. Photo by TopTechWriter.US. US govt e-card scam hits confidential data A fake U.S. government Christmas e-card has managed to siphon off gigabytes of sensitive data from a number of law enforcement and military staff who work on cybersecurity matters, many of whom are involved in computer crime investigations. Security tool uncovers multiple bugs in every browser Michal Zalewski reports that he discovered the vulnerability in Internet Explorer a while ago using his cross_fuzz fuzzing tool and reported it to Microsoft in July 2010. Zalewski also used cross_fuzz to discover bugs in other browsers, which he also reported to the relevant organisations. Microsoft to fix Windows holes, but not ones in IE Microsoft said that it will release two security bulletins next week fixing three holes in Windows, but it is still investigating or working on fixing holes in Internet Explorer that have been reportedly exploited in attacks. Microsoft warns of Windows flaw affecting image rendering Microsoft has warned of a Windows vulnerability that could allow an attacker to take control of a computer if the user is logged on with administrative rights. Windows 7 Not Affected by Critical 0-Day in the Windows Graphics Rendering Engine While confirming that details on a Critical zero-day vulnerability have made their way into the wild, Microsoft noted that customers running the latest iteration of Windows client and server platforms are not exposed to any risks. Microsoft warns of Office-related malware Microsoft’s Malware Protection Center issued a warning this week that it has spotted malicious code on the Internet that can take advantage of a flaw in Word and infect computers after a user does nothing more than read an e-mail. *Refers to a flaw that was addressed in the November security patch releases. Make sure you have all of the latest security updates installed. Unpatched hole in ImgBurn disk burning application According to security specialist Secunia, a highly critical vulnerability in ImgBurn, a lightweight disk burning application, can be used to remotely compromise a user’s system. Hole in VLC Media Player Virtual Security Research (VSR) has identified a vulnerability in VLC Media Player. In versions up to and including 1.1.5 of the VLC Media Player. Flash Player sandbox can be bypassed Flash applications run locally can read local files and send them to an online server – something which the sandbox is supposed to prevent. Chinese auction site touts hacked iTunes accounts Tens of thousands of reportedly hacked iTunes accounts have been found on Chinese auction site Taobao, but the company claims it is unable to take action unless there are direct complaints. What happened in the recent Hotmail outage Mike Schackwitz explains the cause of the recent Hotmail outage. DOJ sends order to Twitter for Wikileaks-related account info The U.S. Justice Department has obtained a court order directing Twitter to turn over information about the accounts of activists with ties to Wikileaks, including an Icelandic politician, a legendary Dutch hacker, and a U.S. computer programmer. Google gets court to block Microsoft Interior Department e-mail win The U.S. Federal Claims Court has temporarily blocked Microsoft from proceeding with the $49.3 million, five-year DOI contract that it won this past November. Google Apps customers get email lockdown Companies and organisations using Google Apps are now able to restrict the email access of selected users. LibreOffice Is the Default Office Suite for Ubuntu 11.04 Matthias Klose has announced some details regarding the replacement of the old OpenOffice.org 3.2.1 packages with the new LibreOffice 3.3 ones, starting with the upcoming Ubuntu 11.04 (Natty Narwhal) Alpha 2 release. Sysadmin Geek Tips Photo by Filomena Scalise. How to Setup Software RAID for a Simple File Server on Ubuntu Do you need a file server that is cheap and easy to setup, “rock solid” reliable, and has Email Alerting? This tutorial shows you how to use Ubuntu, software RAID, and SaMBa to accomplish just that. How to Control the Order of Startup Programs in Windows While you can specify the applications you want to launch when Windows starts, the ability to control the order in which they start is not available. However, there are a couple of ways you can easily overcome this limitation and control the startup order of applications. Random TinyHacker Links Using Opera Unite to Send Large Files A tutorial on using Opera Unite to easily send huge files from your computer. WorkFlowy is a Useful To-do List Tool A cool to-do list tool that lets you integrate multiple tasks in one single list easily. Playing Flash Videos on iOS Devices Yes, you can play flash videos on jailbroken iPhones. Here’s a tutorial. Clear Safari History and Cookies On iPhone A tutorial on clearing your browser history on iPhone and other iOS devices. Monitor Your Internet Usage Here’s a cool, cross-platform tool to monitor your internet bandwidth. Super User Questions See what the community had to say on these popular questions from Super User this week. Why is my upload speed much less than my download speed? Where should I find drivers for my laptop if it didn’t come with a driver disk? OEM Office 2010 without media – how to reinstall? Is there a point to using theft tracking software like Prey on my laptop, if you have login security? Moving an “all-in-one” PC when turned on/off How-To Geek Weekly Article Recap Get caught up on your HTG reading with our hottest articles from this past week. How to Combine Rescue Disks to Create the Ultimate Windows Repair Disk How To Boot 10 Different Live CDs From 1 USB Flash Drive What is Camera Raw, and Why Would a Professional Prefer it to JPG? Did You Know Facebook Has Built-In Shortcut Keys? The How-To Geek Guide to Audio Editing: The Basics One Year Ago on How-To Geek Enjoy looking through our latest gathering of retro article goodness. Learning Windows 7: Create a Homegroup & Join a New Computer To It How To Disconnect a Machine from a Homegroup Use Remote Desktop To Access Other Computers On a Small Office or Home Network How To Share Files and Printers Between Windows 7 and Vista Allow Users To Run Only Specified Programs in Windows 7 The Geek Note That is all we have for you this week and we hope your first week back at work or school has gone very well now that the holidays are over. Know a great tip? Send it in to us at [email protected]. Photo by Pamela Machado. Latest Features How-To Geek ETC HTG Projects: How to Create Your Own Custom Papercraft Toy How to Combine Rescue Disks to Create the Ultimate Windows Repair Disk What is Camera Raw, and Why Would a Professional Prefer it to JPG? The How-To Geek Guide to Audio Editing: The Basics How To Boot 10 Different Live CDs From 1 USB Flash Drive The 20 Best How-To Geek Linux Articles of 2010 Arctic Theme for Windows 7 Gives Your Desktop an Icy Touch Install LibreOffice via PPA and Receive Auto-Updates in Ubuntu Creative Portraits Peek Inside the Guts of Modern Electronics Scenic Winter Lane Wallpaper to Create a Relaxing Mood Access Your Web Apps Directly Using the Context Menu in Chrome The Deep – Awesome Use of Metal Objects as Deep Sea Creatures [Video]

    Read the article

< Previous Page | 264 265 266 267 268 269 270 271 272 273 274 275  | Next Page >