Search Results

Search found 22903 results on 917 pages for 'full length screenshots'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 27/917 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Problem calling stored procedure with a fixed length binary parameter using Entity Framework

    - by Dave
    I have a problem calling stored procedures with a fixed length binary parameter using Entity Framework. The stored procedure ends up being called with 8000 bytes of data no matter what size byte array I use to call the function import. To give some example, this is the code I am using. byte[] cookie = new byte[32]; byte[] data = new byte[2]; entities.Insert("param1", "param2", cookie, data); The parameters are nvarchar(50), nvarchar(50), binary(32), varbinary(2000) When I run the code through SQL profiler, I get this result. exec [dbo].[Insert] @param1=N'param1',@param2=N'param2',@cookie=0x00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 [SNIP because of 16000 zeros] ,@data=0x0000 All parameters went through ok other than the binary(32) cookie. The varbinary(2000) seemed to work fine and the correct length was maintained. Is there a way to prevent the extra data being sent to SQL server? This seems like a big waste of network resource.

    Read the article

  • How to marshal structs with unknown length string fields in C#

    - by Ofir
    Hi all, I get an array of bytes, I need to unmarshal it to C# struct. I know the type of the struct, it has some strings fields. The strings in the byte array appears as so: two first bytes are the length of the string, then the string itself. I don;t know the length of the strings. I do know that its Unicode! [StructLayout(LayoutKind.Sequential, CharSet = CharSet.Unicode)] public class User { int Id;//should be 1 String UserName;//should be OFIR String FullName;//should be OFIR } the byte array looks like so: 00,00,01,00, 00,00,08,00, 4F,00,46,00,49,00,52,00, 00,00,08,00, 4F,00,46,00,49,00,52,00, I also found this link with same problem unsolved: loading binary data into a structure Thank you all, Ofir

    Read the article

  • Detecting if a browser's cache is full

    - by abitgone
    We've identified that full browser caches are the cause of a problem on our extranet. It only affects a small number of our users, but we'd like to alert them to the problem and give them some guidance on how to fix the problem for themselves. We'd like to use a similar system to the one which GMail uses. When it detects that your browser's cache is full, it shows a warning message telling users that their cache is full and that it may cause problems with GMail, along with a link to a Gmail Help page on clearing your browser's cache. Does anyone know if there any resources out there, or examples of how to use JavaScript to detect that the browser's cache is full? Thanks.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Interview Question: .Any() vs if (.Length > 0) for testing if a collection has elements

    - by Chris
    In a recent interview I was asked what the difference between .Any() and .Length > 0 was and why I would use either when testing to see if a collection had elements. This threw me a little as it seems a little obvious but feel I may be missing something. I suggested that you use .Length when you simply need to know that a collection has elements and .Any() when you wish to filter the results. Presumably .Any() takes a performance hit too as it has to do a loop / query internally.

    Read the article

  • Barcode field length

    - by bestattendance
    I'm writing some attendance software. Each member will have an ID card with a barcode which they will use to sign in to events. How long should the barcode field be in my database? I'd like to accept Code 39 and Code 128 barcodes. I know these are variable length codes, so what should I set the max length to? Thanks! EDIT: My clients will be using a variety of third-party barcode printing tools.

    Read the article

  • SQL select statement - returning records starting with variable length string

    - by alpheus
    I am using an alphabetical sorting feature and need a SQL statement to return records beginning with a variable length string. However, records also need to be returned if there are periods, spaces, or dashes between any of the characters in the string. For example, the string could be "M" (easy). Or "MA" (in which case it needs to return records starting with "MA", "M.A", "M A", and "M-A"). Or "MAA", and so on. This is the statement I have so far: "SELECT * from table where LEFT(name," + value.Length + ")='" + value + "'" But I can't work out how to get it to return results where there are periods, spaces or dashes in name. Any help constructing the statement would be great.

    Read the article

  • Alter multiple tables' columns length

    - by gdoron
    So, we just found out that 254 tables in our Oracle DBMS have one column named "Foo" with the wrong length- Number(10) instead of Number(3). That foo column is a part from the PK of the tables. Those tables have other tables with forigen keys to it. What I did is: backed-up the table with a temp table. Disabled the forigen keys to the table. Disabled the PK with the foo column. Nulled the foo column for all the rows. Restored all the above But now we found out it's not just couple of tables but 254 tables. Is there an easy way, (or at least easier than this) to alter the columns length? P.S. I have DBA permissions.

    Read the article

  • Accessing Variables in Javascript using .length

    - by CoV
    Hey all, I'm pretty new to Javascript, so forgive me if this is a simple question. I'm trying to access the length of a set of checkboxes in a form using Javascript. However, I need to be able to change the "name" field of the checkboxes to check several different sets of them. Right now, my sample code looks like: var set = "set" + x; totalLength = optionBoxes.set.length; The variable x is being incremented by a for loop that wraps the whole thing and the name of the checkbox sets that I'm trying to access are set0, set1, set2, etc. Thanks. Edit: small typo fixes

    Read the article

  • any other way to find char array length?

    - by user2785137
    public static int getLenth(char[] t) { int i=0; int count=0; try { while(t[i]!='\0') { ++count; i++; } return count; } catch(ArrayIndexOutOfBoundsException aiobe) { return count; } } This method returns length of charArray. But my question is, is there is some other "ways" to find the length of charArray without using this try, catch statements & all ?? Thanks in advance :)

    Read the article

  • Give back full control to a user on a disk from another computer

    - by Foghorn
    I have my friend's hard drive mounted externally. After messing with the permissions with TAKEOWN so I could fix some viruses, I have full control over their drive. The problem is, now it's stuck in a "autochk not found" reboot sequence. I think the problem is that the boot sector is invisible to the drive now. So my question is, How can I use icacls to give back the full ownership, when the user I am giving it to is not on my machine? I ran the TAKEOWN command from my windows 7 laptop, their machine is a windows xp Professional with three partitions, I only altered the one that has the boot sector. Here is the permissions that icacls shows: (Where my computer is %System% my username is ME, and the drive is E:\ C:\Users\ME icacls E:\* E:\$RECYCLE.BIN %System%\ME:(OI)(CI)(F) Mandatory Label\Low Mandatory Level:(OI)(CI)(IO)(NW) E:\ALLDATAW %System%\ME:(I)(OI)(CI)(F) E:\alrt_200.data %System%\ME:(OI)(CI)(F) E:\AUTOEXEC.BAT %System%\ME:(OI)(CI)(F) E:\AZ Commercial %System%\ME:(I)(OI)(CI)(F) E:\boot.ini %System%\ME:(OI)(CI)(F) E:\Config.Msi %System%\ME:(I)(OI)(CI)(F) E:\CONFIG.SYS %System%\ME:(OI)(CI)(F) E:\Documents and Settings %System%\ME:(I)(OI)(CI)(F) E:\IO.SYS %System%\ME:(OI)(CI)(F) E:\Mitchell1 %System%\ME:(I)(OI)(CI)(F) E:\MSDOS.SYS %System%\ME:(OI)(CI)(F) E:\MSOCache %System%\ME:(I)(OI)(CI)(F) E:\NTDClient.log %System%\ME:(OI)(CI)(F) E:\NTDETECT.COM %System%\ME:(OI)(CI)(F) E:\ntldr %System%\ME:(OI)(CI)(F) E:\pagefile.sys %System%\ME:(OI)(CI)(F) E:\Program Files %System%\ME:(I)(OI)(CI)(F) E:\RECYCLER %System%\ME:(I)(OI)(CI)(F) E:\RHDSetup.log %System%\ME:(OI)(CI)(F) E:\System Volume Information %System%\ME:(I)(OI)(CI)(F) E:\WINDOWS %System%\ME:(I)(OI)(CI)(F) Successfully processed 22 files; Failed processing 0 files C:\Users\ME

    Read the article

  • Windows Vista claims wireless key is the wrong length

    - by humble coffee
    A family member of mine is house sitting and has been given the details of their wifi. The access point is an Airport Express, it has WEP encryption (I think) and they've been given a passphrase to use. I know it's a passphrase and not the encrypted key as it's an English word. The passphrase is 10 characters long. The problem is that Vista complains that it's not a valid key as it must be a 5 or 13 character non-hex key or a 10 or 26 character hex key. (From what I've read this suggests the encryption is WEP?) I've found a couple of suggested solutions, but I'm not actually at the house at the moment so I wanted to make sure I have a good chance of getting it to work when I'm there but have no internets to ask. Solution 1: Vista needs to be told explicitly what kind of encryption and key is being used. Specify in the connection settings that you are using WEP and that it is a "shared key". Solution2: Try converting the passphrase to hexadecimal using an ASCII-hex converter and entering that.

    Read the article

  • Line-length-tolerant XML diff

    - by Jon Skeet
    I've looked at the answers to this question, and unfortunately none of them has helped me so far. Not to beat about the bush, the second edition of C# in Depth is now in copy edit. I want to be able to see what the copy editor's done really easily, so I can reject or accept his changes. We're using a modified form of docbook, but I'm happy enough looking at the raw XML source. All fine so far - except that when the copy editor makes a change, that can change the line wrapping. So something that used to read: <para>Foo bar baz second line</para> now reads <para>Foo bar grontle baz second line</para> Now the real change here is the insertion of "grontle". I don't care that "baz" has moved from the first line to the second line... but all the diff tools I've seen do. I realise that one option would be to reformat the whole document (or possibly just whole paragraphs) into single lines... but that's then really hard to read, because diff tools don't wrap when they're displaying. I'm sure I can manage with the tools I've got, but if anyone knows of anything better, I'd be really glad to hear about it. I suspect my publishers would too :) (I've included the Windows tag here because I'd really need it to be available on Windows. I'd like to hear about any non-Windows software too, but only in case I could help to build it on Windows :)

    Read the article

  • Setting my NIC to full duplex

    - by David
    I am trying to optimize the network speed of my Solaris X86 server, and have discovered that the Cisco 3548 that it is connected to has issues with the NIC in my server. The NIC appears to have not been configured fully, and is coming up 100 half-duplex. The 3548 ports are all set to 100 full. Ideally I'd like to have the server set for 100 full, and have been attempting to configure it using ndd commands. However I have had no results. The following command: -bash-3.00# dladm show-dev rtls0 link: unknown speed: 100 Mbps duplex: unknown The NIC shows up as: pci bus 0x0001 cardnum 0x06 function 0x00: vendor 0x10ec device 0x8139 Realtek Semiconductor Co., Ltd. RTL-8139/8139C/8139C+ which should be configurable. I have modified the configuration file from auto config (5) to 100 fdx (4) to no avail. If there is no other choice, I could alter the Cisco 3548 to be 100 half-duplex. However, this solution causes huge performance loss. Currently throughput is about 500Kbps, when it should be around 40Mbps.

    Read the article

  • Overcoming maximum file path length restrictions in Windows

    - by Christopher Edwards
    One of our customers habitually use very long path names (several nested folders, with long names) and we routinely encounter "user education issues" in order to shorten the path to less than 260 characters. Is there a technical solution available, can we flick some sort of switch in Windows 7 and Windows 2008 R2 to say "yeah just ignore these historical problems, and make +260 character path name work". P.S. I have read and been totally unedified by Naming Files, Paths, and Namespaces

    Read the article

  • Show full URI/URL in Chrome's developer tools Network tab

    - by Lev
    When using Chrome to debug, I find it incredibly difficult to be efficient due to the fact that I don't see how I can force the "Network" tab of the developer tools to show the full request URI. It will show the full URI if you hover the link and wait a second, but this is incredibly counterproductive. All of my AJAX requests are sent to ajax.php, and handled by using query string arguments, like: ajax.php?do=profile-set ajax.php?do=game-save ... etc. Since I use AJAX extensively, my network tab is filled with "ajax.php", but I have to manually hover each and every entry to find the request I am looking for. Surely there has got to be another way!? I am constantly fed up by something new in Firefox and immediately force myself back into Chrome, but it is always the developer tools in Chrome that keep me from using it for an extended period of time. Hopefully I can find out how to do this so I can continue using Chrome as my numero uno. I've provided a screen shot to show you where I mean:

    Read the article

  • Rewritten URLs with parameter length > 255 don't work

    - by philfreo
    I'm using mod_rewrite to rewrite URLs like this: http://example.com/1,2,3,4/foo/ By doing this in .htaccess: RewriteRule ^([\d,]+)/foo/$ /foo.php?id=$1 [L,QSA] It works fine, except for when "1,2,3,4" turns into a string longer than 255 characters, Apache returns a "403 Forbidden". Is there some apache setting I should tweak?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >