Search Results

Search found 4647 results on 186 pages for 'localizable strings'.

Page 27/186 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Using Visual Studio Intellisense for building jQuery selector strings

    - by jslatts
    This is a minor issue, but one I find myself running into: When I am using jQuery in Visual Studio 2010, I find myself frequently typing: $(#S using Intellisense to find the SomeID object ID: $(#SomeID).click( function() { etc.. }) then going back and adding quotes: $('#SomeID').click( function() { etc.. }) I find it annoying that if I add the quote first, Visual Studio goes into string mode and I lose Intellisense for finding the object's ID or class. Am I doing it wrong?

    Read the article

  • Using a function with variable argument strings

    - by wrongusername
    I was playing around a bit with functions with variable arguments, and decided to make a function to create vectors with the arguments. My function for creating an int vector worked... vector<int> makeIntVector(int numArgs, ...) { va_list listPointer; va_start(listPointer, numArgs); vector<int> made; for(int a = 0; a < numArgs; a++) made.push_back(va_arg(listPointer, int)); va_end(listPointer); return made; } but not my function for creating a string vector: vector<string> makeStringVector(int numArgs, string something, ...) { va_list listPointer; va_start(listPointer, something); vector<string> made; for(int a = 0; a < numArgs; a++) made.push_back(va_arg(listPointer, string)); va_end(listPointer); return made; } which crashes the program. What am I doing wrong?

    Read the article

  • Obfuscate strings in Python

    - by Caedis
    I have a password string that must be passed to a method. Everything works fine but I don't feel comfortable storing the password in clear text. Is there a way to obfuscate the string or to truly encrypt it? I'm aware that obfuscation can be reverse engineered, but I think I should at least try to cover up the password a bit. At the very least it wont be visible to a indexing program, or a stray eye giving a quick look at my code. I am aware of pyobfuscate but I don't want the whole program obfuscated, just one string and possibly the whole line itself where the variable is defined. Target platform is GNU Linux Generic (If that makes a difference)

    Read the article

  • Regex matching wrong strings

    - by Joe Smalley
    I have this PHP/SQL query: $sql = sprintf("SELECT * FROM %sCubeCart_filemanager WHERE filepath REGEXP '%s[\\/\\\\][^\\/\\\\]+$' AND type = '%d' AND disabled = '0' ORDER BY filepath ASC %s", $this->_config['dbprefix'], str_replace(array('\\','/'),'.',$folder), $type, $limit); if '$folder' == 'iha9' it is finding results like 'iha91' and 'iha99' too. Something is wrong with the regular expression, but I don't know how they work, can anyone help?!

    Read the article

  • Connection Strings between Web Application and SQL Server

    - by Raven Dreamer
    Greetings. I'm writing a web application that is supposed to connect to a SQL Server database; the connection is formed from the following database string: <add key="DatabaseConnectionString" value="server=DEVPC1\SQLEXPRESS;uid=USERID;pwd=PASSWORD;database=DATABASE"/> However, whenever I try and run the web application, I get a connection error, specifically: An error occurred attempting this login: Login failed for user 'USERID'. Any suggestions on how to go about debugging this? I'm not really familiar with SQL, so any suggestions would be greatly appreciated.

    Read the article

  • Parsing Strings ( .crt files )

    - by user1661521
    Base Knowledge : I have a .crt file ( certification authoritie file ) and he is composed of many fields but in one line that resumes this question i have this : Certificate: ...(alot of stuff before)... Subject: C=US, ST=Maryland, L=Pasadena, O=Brent Baccala, OU=FreeSoft, CN=www.freesoft.org/[email protected] Subject Public Key Info: ...(alot of stuff after) and i need to parse the file to populate a .csv file and i have that done the problem that i need help is, i need to get the field: CN=www.fresoft.org but when i get this kind of CN=...(Value instead of the ...) with alot of slashes i get a error in the parsing like the raw string is: CN=foo/bar/the/hell/emailAddress=blablabla and i need only: foo/bar/the/hell and for a moment i got that in the correct column but when i dont have the emailAddress something just fail in my parsing and i then get in my CN .csv column the information wrong instead of |CN| foo/bar/the/hell i get: |CN| OU=FreeSoft, foo/bar/the/hell. I have this code doing the CN parsing: #!/bin/bash subject_line=$(echo $cert | grep -o "Subject:.*Subject Public Key Info") cn=$(echo $subject_line | grep -o "CN=.*" ) if [ $(echo $cn | grep -c ".*email.*") -gt 0 ]; then end_cn=$(echo $cn | grep -b -o emailAddress) end_cn_idx=$(echo $end_cn | grep -o .*:) final_end_cn=${end_cn_idx:0:-1} common_name=${cn:3:$final_end_cn-4} echo $common_name else end_cn=$(echo $cn | grep -b -o "Subject Public Key Info") end_cn_idx=$(echo $end_cn | grep -o .*:) final_end_cn=${end_cn_idx:0:-1} common_name=${cn:3:$final_end_cn-5} echo $common_name fi

    Read the article

  • Escape apostrophes inside double quoted strings (Javascript)

    - by George Sheppard
    Say i have a string that i need to evaluate in javascript such as : window.some_class.update( 'Runner', 'update_runner', '{"runner":{"id":"1","name":"Nin's Lad" } }'); In order for eval() to evaluate it, i need to escape the apostrophe in runner_name (Nin's Lad). Is this possable with regex? I dont want to escape the single quotes around Runner and update_runner. I'd just like to escape any single quotes inside double quotes. Thanks,

    Read the article

  • SQL Server 2005 Fail: Return Dates As Strings

    - by Abs
    Hello all, I am using the SQL Server PHP Driver, I think this question can be answered without knowing what this is. I have come across this many times, what does it mean by NAMES? Column names?: SET NAMES utf8 Is there a query similar to the above that will get my dates to be returned as a string? For some reason on my SQL Sever 2008 on Vista, this works: $connectionInfo = array('Database' => $dbname, 'ReturnDatesAsStrings' => true) But the above 'ReturnDatesAsStrings' does not work on my SQL Server 2005 on a windows server machine? I can't execute any queries after setting the above! Does SQL Server 2005 support ReturnDatesAsStrings? Is there some other parameter I can pass to do the same? Thanks all for any help EDIT I should of mentioned this but if there is a solution I am hoping for one that is in the form of a setting that can be set before any queries can be executed as I do not have control on what queries will be executed.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Match HTML tags in two strings using regex in Python

    - by jack
    I want to verify that the HTML tags present in a source string are also present in a target string. For example: >> source = '<em>Hello</em><label>What's your name</label>' >> verify_target(’<em>Hi</em><label>My name is Jim</label>') True >> verify_target('<label>My name is Jim</label><em>Hi</em>') True >> verify_target('<em>Hi<label>My name is Jim</label></em>') False

    Read the article

  • Where can I learn about JNDI strings?

    - by ferrari fan
    How do you know how to form a JNDI string? I know there must be a format and that the divisions must mean something but I haven't been able to find a good resource that explains them. For example: java:comp/env/wm/default. This is supposed to connect to a WorkManager in Websphere with the name of default. But what does the "java", "comp", "env" mean? I know what the wm/default mean because that's the JNDI name put in the WorkManager, but what does the rest mean? Thanks

    Read the article

  • How do i change this method to get strings instead of ints

    - by David
    here is the original code: public static int getInt () { Scanner in = new Scanner (System.in) ; if (in.hasNextInt()) { int a = in.nextInt() ; return a ; } else { System.out.println ("try again:") ; return getInt () ; } } This checks and sees if the input it receives is an int. If it is then it returns the int, if not it tells you to try again and re-runs. This is what i tried to do to change it: public static String getIns () { Scanner in = new Scanner (System.in) ; if (in.hasNextString()) { String a = in.nextString() ; return a ; } else { System.out.println ("try again:") ; return getIns () ; } } This doesn't work though. I looked through the documentation for the scanner class and i think the problem is that there is no such method as in.hasNextString or in.nextString What methods from the scanner class can i use to do what i intend these to do?

    Read the article

  • PHP: Condense array of similar strings into one merged array

    - by Matt Andrews
    Hi everyone. Working with an array of dates (opening times for a business). I want to condense them to their briefest possible form. So far, I started out with this structure Array ( [Mon] => 12noon-2:45pm, 5:30pm-10:30pm [Tue] => 12noon-2:45pm, 5:30pm-10:30pm [Wed] => 12noon-2:45pm, 5:30pm-10:30pm [Thu] => 12noon-2:45pm, 5:30pm-10:30pm [Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) What I want to achieve is this: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) I've tried writing a recursive function and have managed to output this so far: Array ( [Mon-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Tue-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Wed-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Thu-Fri] => 12noon-2:45pm, 5:30pm-10:30pm [Sat] => 12noon-11pm [Sun] => 12noon-9:30pm ) Can anybody see a simple way of comparing the values and combining the keys where they're similar? My recursive function is basically two nested foreach() loops - not very elegant. Thanks, Matt EDIT: Here's my code so far, which produces the 3rd array above (from the first one as input): $last_time = array('t' => '', 'd' => ''); // blank array for looping $i = 0; foreach($final_times as $day=>$time) { if($last_time['t'] != $time ) { // it's a new time if($i != 0) { $print_times[] = $day . ' ' . $time; } // only print if it's not the first, otherwise we get two mondays } else { // this day has the same time as last time $end_day = $day; foreach($final_times as $day2=>$time2) { if($time == $time2) { $end_day = $day2; } } $print_times[] = $last_time['d'] . '-' . $end_day . ' ' . $time; } $last_time = array('t' => $time, 'd' => $day); $i++; }

    Read the article

  • List available languages for PyGTK UI strings

    - by detly
    I'm cleaning up some localisation and translation settings in our PyGTK application. The app is only intended to be used under GNU/Linux systems. One of the features we want is for users to select the language used for the applications (some prefer their native language, some prefer English for consistency, some like French because it sounds romantic, etc). For this to work, I need to actually show a combo box with the various languages available. How can I get this list? In fact, I need a list of pairs of the language code ("en", "ru", etc) and the language name in the native language ("English (US)", "???????"). If I had to implement a brute force method, I'd do something like: look in the system locale dir (eg. "/usr/share/locale") for all language code dirs (eg. "en/") containing the relative path "LC_MESSAGES/OurAppName.mo". Is there a more programmatic way?

    Read the article

  • Mixing c++ standard strings and windows API

    - by JB
    Many windows APIs take a pointer to a buffer and a size element but the result needs to go into a c++ string. (I'm using windows unicode here so they are wstrings) Here is an example :- #include <iostream> #include <string> #include <vector> #include <windows.h> using namespace std; // This is the method I'm interested in improving ... wstring getComputerName() { vector<wchar_t> buffer; buffer.resize(MAX_COMPUTERNAME_LENGTH+1); DWORD size = MAX_COMPUTERNAME_LENGTH; GetComputerNameW(&buffer[0], &size); return wstring(&buffer[0], size); } int main() { wcout << getComputerName() << "\n"; } My question really is, is this the best way to write the getComputerName function so that it fits into C++ better, or is there a better way? I don't see any way to use a string directly without going via a vector unless I missed something? It works fine, but somehow seems a little ugly. The question isn't about that particular API, it's just a convenient example.

    Read the article

  • How to replace strings with javascript?

    - by Damiano
    Hello everybody, I have this function: function emoticons(text){ var url = "http://www.domain.it/images/smilies/"; var emt = { ":D" : 'icon_e_biggrin.gif', ":-D" : 'icon_e_biggrin.gif', ":)" : 'icon_e_smile.gif', ":-)" : 'icon_e_smile.gif', ";)" : 'icon_e_wink.gif', "';-)" : 'icon_e_wink.gif', ":(" : 'icon_e_sad.gif', ":-(" : 'icon_e_sad.gif', ":o" : 'icon_e_surprised.gif', ":?" : 'icon_e_confused.gif', "8-)" : 'icon_cool.gif', ":x" : 'icon_mad.gif', ":P" : 'icon_razz.gif' }; for (smile in emt){ text = text.replace(smile, '<img src="' + url + emt[smile] + '" class="emoticons" />'); } return (text); } As you know .replace() convert the first occurence, how to replace more then one emoticon inside the text? How to change this function? Thank you very much!

    Read the article

  • PHP RegEx: How to Stripe Whitespace Between Two Strings

    - by roydukkey
    I have been trying to write a regex that will remove whitespace following a semicolon (';') when it is between both an open and close curly brace ('{','}'). I've gotten somewhere but haven't been able to pull it off. Here what I've got: <?php $output = '@import url("/home/style/nav.css"); body{color:#777; background:#222 url("/home/style/nav.css") top center no-repeat; line-height:23px; font-family:Arial,Times,serif; font-size:13px}' $output = preg_replace("#({.*;) \s* (.*[^;]})#x", "$1$2", $output); ?> The the $output should be as follows. Also, notice that the first semicolon in the string still is followed by whitespace, as it should be. <?php $output = '@import url("/home/style/nav.css"); body{color:#777;background:#222 url("/home/style/nav.css") top center no-repeat;line-height:23px;font-family:Arial,Times,serif;font-size:13px}'; ?> Thanks! In advance to anyone willing to give it a shot.

    Read the article

  • DB4o Linq query - How to check for null strings

    - by Dave
    Hey there - simple query: var q = (from SomeObject o in container where o.SomeInt > 8 && o.SomeString != null //Null Ref here select o; I always get a null reference exception. If I use String.IsNullOrEmpty(o.SomeString) the query takes about 100 times as long, as if I use && o.SomeString != "" (which is way faster, but obviously not correct). I'm guessing because DB4o needs to activate the objects, in order to pass them in to the IsNullOrEmpty call, and can't use the indexes. My question is, what's a better way to check for nulls in this situation? Is there something like: mystring != Db4o.DBNull.Value, or something? Cheers, Dave

    Read the article

  • Scrubyt: Using big5 strings in query_field for fill_textfield

    - by kuribo
    Does anyone know of a way to get fill_textfield to accept a big5-encoded string in the query_field? I keep getting an "unterminated string meets end of file" error with this: require 'rubygems' require 'scrubyt' search_data = Scrubyt::Extractor.define do fetch 'http://www.google.com/ncr' fill_textfield 'q', '????' submit end

    Read the article

  • SQL Server T-SQL statement to replace/delete sub-strings

    - by StefanE
    Hi, I have a table with 6 columns containing HTML content with some markups in it and now when moving to a new designed site most of this HTML code has to be deleted. More or less all tags except <B> and </B>. Is there a nice way of doing this, identify all tags end delete them within the data? I'm sure there are no < symbols in the test so a regular expression would maybe work? My alternative is to fetch every row, process it and update the database but I'm guessing this is possible to do in T-SQL directly. My server is an MSSQL 2008 and is located in a hosted environment but I can fetch a local copy if needed. Thanks, Stefan

    Read the article

  • Perl's use encoding pragma breaking UTF strings

    - by Karel Bílek
    I have a problem with Perl and Encoding pragma. (I use utf-8 everywhere, in input, output, the perl scripts themselves. I don't want to use other encoding, never ever.) However. When I write binmode(STDOUT, ':utf8'); use utf8; $r = "\x{ed}"; print $r; I see the string "í" (which is what I want - and what is 00+ED unicode char). But when I add the "use encoding" pragma like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; print $r; all I see is a box character. Why? Moreover, when I add Data::Dumper and let the Dumper print the new string like this binmode(STDOUT, ':utf8'); use utf8; use encoding 'utf8'; $r = "\x{ed}"; use Data::Dumper; print Dumper($r); I see that perl changed the string to "\x{fffd}". Why?

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >