Search Results

Search found 3953 results on 159 pages for 'overlapped io'.

Page 27/159 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Homemade fstat to get file size, always return 0 length.

    - by Fred
    Hello, I am trying to use my own function to get the file size from a file. I'll use this to allocate memory for a data structure to hold the information on the file. The file size function looks like this: long fileSize(FILE *fp){ long start; fflush(fp); rewind(fp); start = ftell(fp); return (fseek(fp, 0L, SEEK_END) - start); } Any ideas what I'm doing wrong here?

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • Check whether a folder is a local or a network resource in .NET

    - by rwmnau
    Is there a quick way to check whether a path I have is on a local disk or somewhere on the network? I can't just check to see if it's a drive letter vs. UNC, because that would incorrectly identify mapped drives as local. I assumed it would be a boolean in the DirectoryInfo object, but it appears that it's not. I've found classic VB code to do this check (through an API), but nothing for .NET so far.

    Read the article

  • unix shell, redirect output but keep on stdin

    - by Mike
    I'd like to have a shell script redirect stdout of a child process in the following manner Redirect stdout to a file Display the output of the process in real time I know I could do something like #!/bin/sh ./child > file cat file But that would not display stdout in real time. For instance, if the child was #!/bin/sh echo 1 sleep 1 echo 2 The user would see "1" and "2" printed at the same time

    Read the article

  • best way to output a full precision double into a text file

    - by flevine100
    Hi, I need to use an existing text file to store some very precise values. When read back in, the numbers essentially need to be exactly equivalent to the ones that were originally written. Now, a normal person would use a binary file... for a number of reasons, that's not possible in this case. So... do any of you have a good way of encoding a double as a string of characters (aside from increasing the precision). My first thought was to cast the double to a char[] and write out the chars. I don't think that's going to work because some of the characters are not visible, produce sounds, and even terminate strings ('\0'... I'm talkin to you!) Thoughts?

    Read the article

  • close file with fclose() but file still in use

    - by Marco
    Hi all, I've got a problem with deleting/overwriting a file using my program which is also being used(read) by my program. The problem seems to be that because of the fact my program is reading data from the file (output.txt) it puts the file in a 'in use' state which makes it impossible to delete or overwrite the file. I don't understand why the file stays 'in use' because I close the file after use with fclose(); this is my code: bool bBool = true while(bBool){ //Run myprogram.exe tot generate (a new) output.txt //Create file pointer and open file FILE* pInputFile = NULL; pInputFile = fopen("output.txt", "r"); // //then I do some reading using fscanf() // //And when I'm done reading I close the file using fclose() fclose(pInputFile); //The next step is deleting the output.txt if( remove( "output.txt" ) == -1 ){ //ERROR }else{ //Succesfull } } I use fclose() to close the file but the file remains in use by my program until my program is totally shut down. What is the solution to free the file so it can be deleted/overwrited? In reality my code isn't a loop without an end ; ) Thanks in advance! Marco Update Like ask a part of my code which also generates the file 'in use'. This is not a loop and this function is being called from the main(); Here is a piece of code: int iShapeNr = 0; void firstRun() { //Run program that generates output.txt runProgram(); //Open Shape data file FILE* pInputFile = NULL; int iNumber = 0; pInputFile = fopen("output.txt", "r"); //Put all orientations of al detected shapes in an array int iShapeNr = 0; int iRotationBuffer[1024];//1024 is maximum detectable shapes, can be changed in RoboRealm int iXMinBuffer[1024]; int iXMaxBuffer[1024]; int iYMinBuffer[1024]; int iYMaxBuffer[1024]; while(feof(pInputFile) == 0){ for(int i=0;i<9;i++){ fscanf(pInputFile, "%d", &iNumber); fscanf(pInputFile, ","); if(i == 1) { iRotationBuffer[iShapeNr] = iNumber; } if(i == 3){//xmin iXMinBuffer[iShapeNr] = iNumber; } if(i == 4){//xmax iXMaxBuffer[iShapeNr] = iNumber; } if(i == 5){//ymin iYMinBuffer[iShapeNr] = iNumber; } if(i == 6){//ymax iYMaxBuffer[iShapeNr] = iNumber; } } iShapeNr++; } fflush(pInputFile); fclose(pInputFile); } The while loop parses the file. The output.txt contains sets of 9 variables, the number of sets is unknown but always in sets of 9. output.txt could contain for example: 0,1,2,3,4,5,6,7,8,8,7,6,5,4,1,2,3,0

    Read the article

  • Can't access my files in ASP.NET web site

    - by jumbojs
    I'm having a very difficult time. I am running windows 2008 server, I have an Able Commerce site using ASP.NET with C#. I'm writing an automated task that will ftp some xml files down into a local directory on our web server and then the program parses the xml file and saves information to our database. The problem, once I save the files to our local directory, my program has no access to the files. The NETWORK SERVICE user permissions isn't being inherited by the xml files so my program can't do anything with them. I can manually change the permissions, but this wouldn't be automated and won't work. How can I get this to work? help please, it's very frustrating.

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Java file searching problem

    - by Infinity
    Hello guys! I need to search a file for a word and return the whole line and the line number with this word, then edit the line and write back to the file. Maybe the line number isn't necesary to edit a line in a file. I `was reading after seraching with regexp and opening the filechannel of the file, but I can't get the line number. Maybe there are other better ways to do this. Can you help me how to start this?

    Read the article

  • Make Directory.GetFiles() ignore protected folders

    - by Kryptic
    Hello Everyone, I'm using the Directory.GetFiles() method to get a list of files to operate on. This method throws an UnauthorizedAccessException for example when trying to access a protected folder. I would like it to simply skip over such folders and continue. How can I accomplish this with either Directory.GetFiles (preferably) or another method? Update: Here is the code that throws the exception. I am asking the user to select a directory and then retrieving the list of files. I commented out the code (so this is now whole method) that iterates through the files and the problem still occurs. The exception is thrown on the Directory.GetFiles() line. FolderBrowserDialog fbd = new FolderBrowserDialog(); DialogResult dr = fbd.ShowDialog(); if (dr == System.Windows.Forms.DialogResult.Cancel) return; string directory = fbd.SelectedPath; string[] files = Directory.GetFiles(directory, "*.html", SearchOption.AllDirectories);

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • What file format can I use to output a formatted text file straight from a program without having the markup be too complicated?

    - by Matt
    Premise: I am parsing a file that is quite nearly XML, but not quite. From this file I would like to extract data and output in a file that a user could open up in some program and read. To make the data reasonable, I would almost certainly need to format the text. In case it matters, I will probably be using Java to write the program. Problem: I cannot find a file format that supports formatting without having terribly complex rules and encoding problems. Attempts: I looked into a basic .txt extension first, but it does not have enough formatting advantage. I then tried a .rtf extension, but the rules for outputting text seem to be terribly complicated. It was then suggested that I used XML, but I do not understand how this file would be viewed. This appears to be probably the best solution, but I don't understand much about it. Perhaps somebody could shed some light here. In Other Words: Could somebody suggest and easy to use file format and/or shed some light on how to use XML for text formatting and viewing?

    Read the article

  • Store data in file system rather than SQL or Oracle database.

    - by nunu
    Hi All, As I am working on Employee Management system, I have two table (for example) in database as given below. EmployeeMaster (DB table structure) EmployeeID (PK) | EmployeeName | City MonthMaster (DB table structure) Month | Year | EmployeeID (FK) | PrenentDays | BasicSalary Now my question is, I want to store data in file system rather than storing data in SQL or ORACLE. I want my data in file system storage for Insert, Edit and Delete opration with keeping relation with objects too. I am a C# developer, Could anybody have thoughts or idea on it. (To store data in file system with keeping relations between them) Thanks in advance. Any ideas on it?

    Read the article

  • Why Doesn't This Java Code Skip Lines with #?

    - by Nathan
    I'm trying to allow an external .txt file that is read by a Java script be able to have some comments in the beginning of the file so others can easily edit it and add more to it. But if the file contains # (the sign designated for a line that is a comment) it just returns the error that there is a "Format Error in file" (the IOException - so it is getting past that first "IF"...) Can someone help? Here's the portion of the code that deals with commenting lines out of the .txt file being called earlier in the script: while ((line = br.readLine()) != null) { line = line.trim(); if (line.length() < 1 || line.charAt(0) == '#') { // ignore comments continue; } final String[] parts = line.split("="); if (parts.length != 2) { throw new IOException("Format error in file " + JLanguageTool.getDataBroker().getFromRulesDirAsUrl(getFileName()) + ", line: " + line); }

    Read the article

  • writing to an ioport resulting in segfaults...

    - by Sniperchild
    I'm writing for an atmel at91sam9260 arm 9 cored single board computer [glomation gesbc9260] Using request_mem_region(0xFFFFFC00,0x100,"name"); //port range runs from fc00 to fcff that works fine and shows up in /proc/iomem then i try to write to the last bit of the port at fc20 with writel(0x1, 0xFFFFFC20); and i segfault...specifically "unable to handle kernel paging request at virtual address fffffc20. I'm of the mind that i'm not allocating the right memory space... any helpful insight would be great...

    Read the article

  • Fastest way to read data from a lot of ASCII files

    - by Alsenes
    Hi guys, for a college exercise that I've already submitted I needed to read a .txt file wich contained a lot of names of images(1 in each line). Then I needed to open each image as an ascii file, and read their data(images where in ppm format), and do a series of things with them. The things is, I noticed my program was taking 70% of the time in the reading the data from the file part, instead of in the other calculations that I was doing (finding number of repetitions of each pixel with a hash table, finding diferents pixels beetween 2 images etc..), which I found quite odd to say the least. This is how the ppm format looks like: P3 //This value can be ignored when reading the file, because all image will be correctly formatted 4 4 255 //This value can be also ignored, will be always 255. 0 0 0 0 0 0 0 0 0 15 0 15 0 0 0 0 15 7 0 0 0 0 0 0 0 0 0 0 0 0 0 15 7 0 0 0 15 0 15 0 0 0 0 0 0 0 0 0 This is how I was reading the data from the files: ifstream fdatos; fdatos.open(argv[1]); //Open file with the name of all the images const int size = 128; char file[size]; //Where I'll get the image name Image *img; while (fdatos >> file) { //While there's still images anmes left, continue ifstream fimagen; fimagen.open(file); //Open image file img = new Image(fimagen); //Create new image object with it's data file ……… //Rest of the calculations whith that image ……… delete img; //Delete image object after done fimagen.close(); //Close image file after done } fdatos.close(); And inside the image object read the data like this: const int tallafirma = 100; char firma[tallafirma]; fich_in >> std::setw(100) >> firma; // Read the P3 part, can be ignored int maxvalue, numpixels; fich_in >> height >> width >> maxvalue; // Read the next three values numpixels = height*width; datos = new Pixel[numpixels]; int r,g,b; //Don't need to be ints, max value is 256, so an unsigned char would be ok. for (int i=0; i<numpixels; i++) { fich_in >> r >> g >> b; datos[i] = Pixel( r, g ,b); } //This last part is the slow one, //I thing I should be able to read all this data in one single read //to buffer or something which would be stored in an array of unsigned chars, //and then I'd only need to to do: //buffer[0] -> //Pixel 1 - Red data //buffer[1] -> //Pixel 1 - Green data //buffer[2] -> //Pixel 1 - Blue data So, any Ideas? I think I can improve it quite a bit reading all to an array in one single call, I just don't know how that is done. Also, is it posible to know how many images will be in the "index file"? Is it posiible to know the number of lines a file has?(because there's one file name per line..) Thanks!!

    Read the article

  • Android: How do you delete a folder starts with period

    - by jclova
    I am trying to delete a folder in sdcard. I can delete normal directories, but a directory that starts with period cannot be deleted. (ex. ".helloDir") if (dir.isDirectory()) { String[] children = dir.list(); for (int i = 0; i < children.length; i++) { new File(dir, children[i]).delete(); } } children is null if dir starts with period (ex. ".helloDir").

    Read the article

  • Simple binary File I/O problem with cstdio(c++)

    - by Atilla Filiz
    The c++ program below fails to read the file. I know using cstdio is not good practice but that what I am used to and it should work anyway. $ ls -l l.uyvy -rw-r--r-- 1 atilla atilla 614400 2010-04-24 18:11 l.uyvy $ ./a.out l.uyvy Read 0 bytes out of 614400, possibly wrong file code: #include<cstdio> int main(int argc, char* argv[]) { FILE *fp; if(argc<2) { printf("usage: %s <input>\n",argv[0]); return 1; } fp=fopen(argv[1],"rb"); if(!fp) { printf("erör, cannot open %s for reading\n",argv[1]); return -1; } int bytes_read=fread(imgdata,1,2*IMAGE_SIZE,fp); //2bytes per pixel fclose(fp); if(bytes_read < 2*IMAGE_SIZE) { printf("Read %d bytes out of %d, possibly wrong file\n", bytes_read, 2*IMAGE_SIZE); return -1; } return 0; }

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • [FIXED] Scan file contents into an array of a structure.

    - by ZaZu
    Hello, I have a structure in my program that contains a particular array. I want to scan a random file with numbers and put the contents into that array. This is my code : ( NOTE : This is a sample from a bigger program, so I need the structure and arrays as declared ) The contents of the file are basically : 5 4 3 2 5 3 4 2 #include<stdio.h> #define first 500 #define sec 500 struct trial{ int f; int r; float what[first][sec]; }; int trialtest(trial *test); main(){ trial test; trialtest(&test); } int trialtest(trial *test){ int z,x,i; FILE *fin; fin=fopen("randomfile.txt","r"); for(i=0;i<5;i++){ fscanf(fin,"%5.2f\t",(*test).what[z][x]); } fclose(fin); return 0; } But the problem is, whenever this I run this code, I get this error : (25) : warning 508 - Data of type 'double' supplied where a pointer is required I tried adding do{ for(i=0;i<5;i++){ q=fscanf(fin,"%5.2f\t",(*test).what[z][x]); } }while(q!=EOF); But that didnt work either, it gives the same error. Does anyone have a solution to this problem ?

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >