Search Results

Search found 9701 results on 389 pages for 'row minds'.

Page 27/389 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Fill lower matrix with vector by row, not column

    - by mhermans
    I am trying to read in a variance-covariance matrix written out by LISREL in the following format in a plain text, whitespace separated file: 0.23675E+01 0.86752E+00 0.28675E+01 -0.36190E+00 -0.36190E+00 0.25381E+01 -0.32571E+00 -0.32571E+00 0.84425E+00 0.25598E+01 -0.37680E+00 -0.37680E+00 0.53136E+00 0.47822E+00 0.21120E+01 -0.37680E+00 -0.37680E+00 0.53136E+00 0.47822E+00 0.91200E+00 0.21120E+01 This is actually a lower diagonal matrix (including diagonal): 0.23675E+01 0.86752E+00 0.28675E+01 -0.36190E+00 -0.36190E+00 0.25381E+01 -0.32571E+00 -0.32571E+00 0.84425E+00 0.25598E+01 -0.37680E+00 -0.37680E+00 0.53136E+00 0.47822E+00 0.21120E+01 -0.37680E+00 -0.37680E+00 0.53136E+00 0.47822E+00 0.91200E+00 0.21120E+01 I can read in the values correctly with scan() or read.table(fill=T). I am however not able to correctly store the read-in vector in a matrix. The following code S <- diag(6) S[lower.tri(S,diag=T)] <- d fills the lower matrix by column, while it should fill it by row. Using matrix() does allow for the option byrow=TRUE, but this will fill in the whole matrix, not just the lower half (with diagonal). Is it possible to have both: only fill the lower matrix (with diagonal) and do it by row? (separate issue I'm having: LISREL uses 'D+01' while R only recognises 'E+01' for scientific notation. Can you change this in R to accept also 'D'?)

    Read the article

  • Return the Column Name for row with last non-null value "Ms Access 2007"

    - by bri1969
    I have a Table, which contains a list of league players. Each season, we record their Points per Dart. Their total PPD for that season is stored in other tables and extracted through other queries, which in turn are imported to the master table "Player History" at the end of the season for use as historical data. The current query retrieves each players PPD for each season they played, when they played last, and how many seasons played. The code for Last season Played has become too long and unstable to use. it was originally created, and split into two separate columns because a single SQL was to long. (LSP1) and LSP2) which work, but as I add seasons, Access does not like the length of code. In short, i need to find a more simple code that will look at each row, and look in that row for the last non null cell and report which column that last non null value is in. So if a player played seasons 30 & 31, but did not play 32..but did play 33, the Column with the code should be titled Last Season Played, and for that Player, it would state "33" in that cell, indicating that this player last played season "33" I will provide both tables and the query.. Please help

    Read the article

  • Alternating table row color, but with 2 rows of data

    - by PixelMuse
    I've got my table setup for Zebra striping, but how do I accomplish making the row color alternate for 2 rows instead of a single row? My data markup looks like this: <tr> <td>@task.TaskNum</td> <td>@task.RepiarTime</td> <td>Priority Club</td> <td>SD</td> <td>Commercial</td> <td>Reg Commercial</td> <td>After Hours</td> </tr> <tr><td colspan="7"> @task.Description.ToString() </td></tr> I am using this to stripe it: $(document).ready(function () { $(".stripeMe tr").mouseover(function () { $(this).addClass("over"); }).mouseout(function () { $(this).removeClass("over"); }); $(".stripeMe tr:even").addClass("alt"); });

    Read the article

  • Hide table row onclick using jquery

    - by John
    I have a bunch of table rows such as: <tr> <td>cell1</td> <td>cell2</td> <td><a href="action.php">cell3</a></td> </tr> <tr class="notes_row"> <td colspan="6"> <ul class="message warning no-margin" id="notes_box"> <li>Notes here</li> </ul> </td> </tr> <tr> <td>cell1</td> <td>cell2</td> <td><a href="action.php">cell3</a></td> </tr> The class="notes_row" is only there if notes are present for the row above it. How can I hide the tr and if its there the tr with the notes_row class below it without affecting the other rows using jquery? So if someone clicked cell3 the tr that link is in is hidden then if there is a notes table row below it, it hides that as well.

    Read the article

  • Adding up row number and displaying total using COUNT (PHP MySQL)

    - by Yvonne
    I'm attempting to run a query that adds up the total number of subjects in a class. A class has many subjects. There is a 'teachersclasses' table between teachers (the user table) and classes. The principles sounds pretty simple but I'm having some trouble in getting my page to display the number of subjects for each class (directly associated with the teacher) This is what I have so far, trying to make use of the COUNT with a nested SELECT: SELECT (SELECT count(*) FROM subjects WHERE subjects.classid = class.classid) AS total_subjects, class.classname, class.classid FROM class Then I am calling up 'num_subjects' to present the total within a while loop: <?php echo $row['total_subjects']?> From the above, I am receiving the total subjects for a class, but within the same table row (for one class) and my other while loop doesnt run anymore, which returns all of the classes associated with a teacher :( ... Bit of a mess now! I know to return the classes for a particular teacher, I can do an additional WHERE clause on the session of 'teacherid' but I think my query is getting too complicated for me that errors are popping up everywhere. Anyone have a quick fix for this! Thanks very much

    Read the article

  • Remove all rows in duplication (different from distinct row selection)

    - by user1671401
    How can I remove EVERY duplicating row in a DataTable, based on the value of two columns that are in duplication. Unfortunately, I am unable to find the equivalent LINQ Query. (I dont want distinct values even). The table below shall explain my problem I want to delete every row in duplication based on Column_A and Column_B COLUMN_A      COLUMN_B      COLUMN_C     COLUMN_D..... A                       B C                       D E                       F G                       H A                       B E                       F EXPECTED OUTPUT: COLUMN_A      COLUMN_B      COLUMN_C     COLUMN_D..... C                       D G                       H Please help

    Read the article

  • JSF : able to do mass update but unable to update a single row in a datatable

    - by nash
    I have a simple data object: Car. I am showing the properties of Car objects in a JSF datatable. If i display the properties using inputText tags, i am able to get the modified values in the managed bean. However i just want a single row editable. So have placed a edit button in a separate column and inputText and outputText for every property of Car. the edit button just toggles the rendering of inputText and outputText. Plus i placed a update button in a separate column which is used to save the updated values. However on clicking the update button, i still get the old values instead of the modified values. Here is the complete code: public class Car { int id; String brand; String color; public Car(int id, String brand, String color) { this.id = id; this.brand = brand; this.color = color; } //getters and setters of id, brand, color } Here is the managed bean: import java.util.ArrayList; import java.util.List; import javax.faces.bean.ManagedBean; import javax.faces.bean.RequestScoped; import javax.faces.component.UIData; @ManagedBean(name = "CarTree") @RequestScoped public class CarTree { int editableRowId; List<Car> carList; private UIData myTable; public CarTree() { carList = new ArrayList<Car>(); carList.add(new Car(1, "jaguar", "grey")); carList.add(new Car(2, "ferari", "red")); carList.add(new Car(3, "camri", "steel")); } public String update() { System.out.println("updating..."); //below statments print old values, was expecting modified values System.out.println("new car brand is:" + ((Car) myTable.getRowData()).brand); System.out.println("new car color is:" + ((Car) myTable.getRowData()).color); //how to get modified row values in this method?? return null; } public int getEditableRowId() { return editableRowId; } public void setEditableRowId(int editableRowId) { this.editableRowId = editableRowId; } public UIData getMyTable() { return myTable; } public void setMyTable(UIData myTable) { this.myTable = myTable; } public List<Car> getCars() { return carList; } public void setCars(List<Car> carList) { this.carList = carList; } } here is the JSF 2 page: <?xml version='1.0' encoding='UTF-8' ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xmlns:h="http://java.sun.com/jsf/html" xmlns:f="http://java.sun.com/jsf/core"> <h:head> <title>Facelet Title</title> </h:head> <h:body> <h:form id="carForm" prependId="false"> <h:dataTable id="dt" binding="#{CarTree.myTable}" value="#{CarTree.cars}" var="car" > <h:column> <h:outputText value="#{car.id}" /> </h:column> <h:column> <h:outputText value="#{car.brand}" rendered="#{CarTree.editableRowId != car.id}"/> <h:inputText value="#{car.brand}" rendered="#{CarTree.editableRowId == car.id}"/> </h:column> <h:column> <h:outputText value="#{car.color}" rendered="#{CarTree.editableRowId != car.id}"/> <h:inputText value="#{car.color}" rendered="#{CarTree.editableRowId == car.id}"/> </h:column> <h:column> <h:commandButton value="edit"> <f:setPropertyActionListener target="#{CarTree.editableRowId}" value="#{car.id}" /> </h:commandButton> </h:column> <h:column> <h:commandButton value="update" action="#{CarTree.update}"/> </h:column> </h:dataTable> </h:form> </h:body> </html> However if i just keep the inputText tags and remove the rendered attributes, i get the modified values in the update method. How can i get the modified values for the single row edit?

    Read the article

  • SpGridView , Get Selected Row Data

    - by sbtahir
    I m using SPGridView , i want to fill textboxes with the SPGridview Selected Row Data on a button click event. Does Anyone know how to do that? my code: txtCode= SPGridView.SelectedRow.Cell[1].Text; but on debugging it shows Cell[1] is empty but it showing data in the Grid. Any Idea? Thanks SAAD

    Read the article

  • Can not delete row from MySQL

    - by Drew
    Howdy all, I've got a table, which won't delete a row. Specifically, when I try to delete any row with a GEO_SHAPE_ID over 150000000 it simply does not disappear from the DB. I have tried: SQLyog to erase it. DELETE FROM TABLE WHERE GEO_SHAPE_ID = 150000042 (0 rows affected). UNLOCK TABLES then 2. As far as I am aware, bigint is a valid candidate for auto_increment. Anyone know what could be up? You gotta help us, Doc. We’ve tried nothin’ and we’re all out of ideas! DJS. PS. Here is the table construct and some sample data just for giggles. CREATE TABLE `GEO_SHAPE` ( `GEO_SHAPE_ID` bigint(11) NOT NULL auto_increment, `RADIUS` float default '0', `LATITUDE` float default '0', `LONGITUDE` float default '0', `SHAPE_TYPE` enum('Custom','Region') default NULL, `PARENT_ID` int(11) default NULL, `SHAPE_POLYGON` polygon default NULL, `SHAPE_TITLE` varchar(45) default NULL, `SHAPE_ABBREVIATION` varchar(45) default NULL, PRIMARY KEY (`GEO_SHAPE_ID`) ) ENGINE=MyISAM AUTO_INCREMENT=150000056 DEFAULT CHARSET=latin1 CHECKSUM=1 DELAY_KEY_WRITE=1 ROW_FORMAT=DYNAMIC; SET FOREIGN_KEY_CHECKS = 0; LOCK TABLES `GEO_SHAPE` WRITE; INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (57, NULL, NULL, NULL, 'Region', 10, NULL, 'Washington', 'WA'); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (58, NULL, NULL, NULL, 'Region', 10, NULL, 'West Virginia', 'WV'); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (59, NULL, NULL, NULL, 'Region', 10, NULL, 'Wisconsin', 'WI'); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000042, 10, -33.8833, 151.217, 'Custom', NULL, NULL, 'Sydney%2C%20New%20South%20Wales%20%2810km%20r', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000043, 10, -33.8833, 151.167, 'Custom', NULL, NULL, 'Annandale%2C%20New%20South%20Wales%20%2810km%', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000048, 10, -27.5, 153.017, 'Custom', NULL, NULL, 'Brisbane%2C%20Queensland%20%2810km%20radius%2', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000045, 10, 43.1002, -75.2956, 'Custom', NULL, NULL, 'New%20York%20Mills%2C%20New%20York%20%2810km%', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000046, 10, 40.1117, -78.9258, 'Custom', NULL, NULL, 'Region1', NULL); UNLOCK TABLES; SET FOREIGN_KEY_CHECKS = 1;

    Read the article

  • hierachical query to return final row

    - by jeff
    I have a hierarchical query that doesn't return an expected row (employee badge = 444). TABLE: hr_data badge fname supervisor_badge 111 Jeff 222 222 Joe 333 333 John 444 444 Tom 444 SQL: SELECT CONNECT_BY_ISCYCLE As IC, badge, fname, supervisor_badge FROM hr_data START WITH badge = '111' CONNECT BY NOCYCLE badge = PRIOR supervisor_badge What is Returned: IC badge fname supervisor_badge 0 111 Jeff 222 0 222 Joe 333 1 333 John 444 What is Expected: IC badge fname supervisor_badge 0 111 Jeff 222 0 222 Joe 333 **0** 333 John 444 **1** 444 Tom 444 How can I get this query to return the employee Tom and then stop?

    Read the article

  • Select First Row as default in UITableView [Urgent]

    - by tushar
    hi , ihave application that is viewbased and i am adding tableview as subview to main view and i have taken UITableViewDelegate to respond the table methods everything is working fine but i want to select first row or UITableView as default selected(Highlighted) plz help me if possible then send me sample code and where i have to place that code means in which method or event Thanks In Advance

    Read the article

  • QTreeWidget set height of each row depending on content

    - by serge
    Hi everyone, I want to make editable cells with multi-lines content in QTreeWidget and I use for this purpose QPlainTextEdit as a delegate. I need to set proper size to all rows that switching between editing and displaying went smooth, without any visible changes. rect = textEdit.blockBoundingRect(textEdit.firstVisibleBlock()) with this I can find out the height I need to set for the row, but I missing the place where I can do it. How can i set proper height to QTreeWidget's rows on initialization stage? Thank you in advance, Serge

    Read the article

  • Editing a row in a gridview

    - by chaitanya
    I have a two text boxes named region id and region name..and a button control I enter some values into those text boxes and click the button to insert those values into the "gridview"and a "data table" associated with the gridview. The gridview has the "enable editing" set to true..but when i click the "edit" button of a particular row in a gridview i get no response...i.e i do not get editable textboxes as it happens normally... What is the solution for this?

    Read the article

  • WPF DataGrid cannot Add a row when datasource is empty

    - by Trindaz
    CanUserAddRows="True" only 'works' when there's already data in the itemsource of the data grid. If it just so happens that there are no rows in the original list of items, then the datagrid doesn't display a 'placeholder' row for entering new items, even though I've set CanUserAddRows="True". Why?! Thanks in advance, Trindaz

    Read the article

  • IText can't keep rows together, second row spans multiple pages but won't stick with first row.

    - by J2SE31
    I am having trouble keeping my first and second rows of my main PDFPTable together using IText. My first row consists of a PDFPTable with some basic search criteria. My second row consists of a PdfPTable that contains all of the tabulated results. Everytime the tabulated results becomes too big and spans multiple pages, it is kicked to the second page automatically rather than showing up directly below the search criteria and then paging to the next page. How can I avoid this problem? I have tried using setSplitRows(false), but I simply get a blank document (see commented lines 117 and 170). How can I keep my tabulated data (second row) up on the first page? An example of my code is shown below (you should be able to just copy/paste). public class TestHelper{ private TestEventHelper helper; public TestHelper(){ super(); helper = new TestEventHelper(); } public TestEventHelper getHelper() { return helper; } public void setHelper(TestEventHelper helper) { this.helper = helper; } public static void main(String[] args){ TestHelper test = new TestHelper(); TestEventHelper helper = test.getHelper(); FileOutputStream file = null; Document document = null; PdfWriter writer = null; try { file = new FileOutputStream(new File("C://Documents and Settings//All Users//Desktop//pdffile2.pdf")); document = new Document(PageSize.A4.rotate(), 36, 36, 36, 36); writer = PdfWriter.getInstance(document, file); // writer.setPageEvent(templateHelper); writer.setPdfVersion(PdfWriter.PDF_VERSION_1_7); writer.setUserunit(1f); document.open(); List<Element> pages = null; try { pages = helper.createTemplate(); } catch (Exception e) { e.printStackTrace(); } Iterator<Element> iterator = pages.iterator(); while (iterator.hasNext()) { Element element = iterator.next(); if (element instanceof Phrase) { document.newPage(); } else { document.add(element); } } } catch (Exception de) { de.printStackTrace(); // log.debug("Exception " + de + " " + de.getMessage()); } finally { if (document != null) { document.close(); } if (writer != null) { writer.close(); } } System.out.println("Done!"); } private class TestEventHelper extends PdfPageEventHelper{ // The PdfTemplate that contains the total number of pages. protected PdfTemplate total; protected BaseFont helv; private static final float SMALL_MARGIN = 20f; private static final float MARGIN = 36f; private final Font font = new Font(Font.HELVETICA, 12, Font.BOLD); private final Font font2 = new Font(Font.HELVETICA, 10, Font.BOLD); private final Font smallFont = new Font(Font.HELVETICA, 10, Font.NORMAL); private String[] datatableHeaderFields = new String[]{"Header1", "Header2", "Header3", "Header4", "Header5", "Header6", "Header7", "Header8", "Header9"}; public TestEventHelper(){ super(); } public List<Element> createTemplate() throws Exception { List<Element> elementList = new ArrayList<Element>(); float[] tableWidths = new float[]{1.0f, 1.0f, 1.0f, 1.0f, 1.0f, 1.25f, 1.25f, 1.25f, 1.25f}; // logger.debug("entering create reports template..."); PdfPTable splitTable = new PdfPTable(1); splitTable.setSplitRows(false); splitTable.setWidthPercentage(100f); PdfPTable pageTable = new PdfPTable(1); pageTable.setKeepTogether(true); pageTable.setWidthPercentage(100f); PdfPTable searchTable = generateSearchFields(); if(searchTable != null){ searchTable.setSpacingAfter(25f); } PdfPTable outlineTable = new PdfPTable(1); outlineTable.setKeepTogether(true); outlineTable.setWidthPercentage(100f); PdfPTable datatable = new PdfPTable(datatableHeaderFields.length); datatable.setKeepTogether(false); datatable.setWidths(tableWidths); generateDatatableHeader(datatable); for(int i = 0; i < 100; i++){ addCell(datatable, String.valueOf(i), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+1), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+2), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+3), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+4), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+5), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+6), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+7), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+8), 1, Rectangle.NO_BORDER, Element.ALIGN_RIGHT, smallFont, true); } PdfPCell dataCell = new PdfPCell(datatable); dataCell.setBorder(Rectangle.BOX); outlineTable.addCell(dataCell); PdfPCell searchCell = new PdfPCell(searchTable); searchCell.setVerticalAlignment(Element.ALIGN_TOP); PdfPCell outlineCell = new PdfPCell(outlineTable); outlineCell.setVerticalAlignment(Element.ALIGN_TOP); addCell(pageTable, searchCell, 1, Rectangle.NO_BORDER, Element.ALIGN_LEFT, null, null); addCell(pageTable, outlineCell, 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, null, null); PdfPCell pageCell = new PdfPCell(pageTable); pageCell.setVerticalAlignment(Element.ALIGN_TOP); addCell(splitTable, pageCell, 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, null, null); elementList.add(pageTable); // elementList.add(splitTable); return elementList; } public void onOpenDocument(PdfWriter writer, Document document) { total = writer.getDirectContent().createTemplate(100, 100); total.setBoundingBox(new Rectangle(-20, -20, 100, 100)); try { helv = BaseFont.createFont(BaseFont.HELVETICA, BaseFont.WINANSI, BaseFont.NOT_EMBEDDED); } catch (Exception e) { throw new ExceptionConverter(e); } } public void onEndPage(PdfWriter writer, Document document) { //TODO } public void onCloseDocument(PdfWriter writer, Document document) { total.beginText(); total.setFontAndSize(helv, 10); total.setTextMatrix(0, 0); total.showText(String.valueOf(writer.getPageNumber() - 1)); total.endText(); } private PdfPTable generateSearchFields(){ PdfPTable searchTable = new PdfPTable(2); for(int i = 0; i < 6; i++){ addCell(searchTable, "Search Key" +i, 1, Rectangle.NO_BORDER, Element.ALIGN_RIGHT, font2, MARGIN, true); addCell(searchTable, "Search Value +i", 1, Rectangle.NO_BORDER, Element.ALIGN_LEFT, smallFont, null, true); } return searchTable; } private void generateDatatableHeader(PdfPTable datatable) { if (datatableHeaderFields != null && datatableHeaderFields.length != 0) { for (int i = 0; i < datatableHeaderFields.length; i++) { addCell(datatable, datatableHeaderFields[i], 1, Rectangle.BOX, Element.ALIGN_CENTER, font2); } } } private PdfPCell addCell(PdfPTable table, String cellContent, int colspan, int cellBorder, int horizontalAlignment, Font font) { return addCell(table, cellContent, colspan, cellBorder, horizontalAlignment, font, null, null); } private PdfPCell addCell(PdfPTable table, String cellContent, int colspan, int cellBorder, int horizontalAlignment, Font font, Boolean noWrap) { return addCell(table, cellContent, colspan, cellBorder, horizontalAlignment, font, null, noWrap); } private PdfPCell addCell(PdfPTable table, String cellContent, Integer colspan, Integer cellBorder, Integer horizontalAlignment, Font font, Float paddingLeft, Boolean noWrap) { PdfPCell cell = new PdfPCell(new Phrase(cellContent, font)); return addCell(table, cell, colspan, cellBorder, horizontalAlignment, paddingLeft, noWrap); } private PdfPCell addCell(PdfPTable table, PdfPCell cell, int colspan, int cellBorder, int horizontalAlignment, Float paddingLeft, Boolean noWrap) { cell.setColspan(colspan); cell.setBorder(cellBorder); cell.setHorizontalAlignment(horizontalAlignment); if(paddingLeft != null){ cell.setPaddingLeft(paddingLeft); } if(noWrap != null){ cell.setNoWrap(noWrap); } table.addCell(cell); return cell; } } }

    Read the article

  • How to add 1 to the value of a column of an existing row in mysql

    - by mithun1538
    Hello everyone, I have a table called pollData. It will always contain only 1 row. It has columns option1, option2, option3, option4, option5 each of type int. In the beginning, these columns have 0 as their value. How do I add 1 to any column, say option2? I mean do i retrieve the value of that column first, perform addition, and store back, or is there any auto increment function?

    Read the article

  • SQL - fetch the row which has the Max value for a column

    - by Umang
    Table: UserId, Value, Date. I want to get the UserId, Value for the max(Date) for each UserId. That is, the Value for each UserId that has the latest date. Is there a way to do this simply in SQL? (Preferably Oracle) Thank in advance! [Update:] Apologies for any ambiguity: I need to get ALL the UserIds. But for each UserId, only that row where that user has the latest date.

    Read the article

  • Add Dynamic ListView Row

    - by soclose
    Hi, I could intercept ContentObserver changes at any time. In these time, I'd like to add a dynamic listview row with or without opening my application but i don't know how to implement it. Please share me some hints. Thank you.

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >