Search Results

Search found 1499 results on 60 pages for 'wildcard certificates'.

Page 27/60 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Do You Use Oracle Exchange? Read This Important Information!

    - by LindaJ-Oracle
    Any change required on the Oracle Exchange instance (e.g.: SSL certificates, patches, datafix, etc.)  is required to be executed first in the Test Exchange.  This can also be applicable to issues where clients are using Oracle iProcurement and Oracle Fusion Self Service Procurement for Punchout to and via Oracle Exchange. See the details today in Doc ID 1681121.1 -  Oracle Exchange Requirements

    Read the article

  • What is a Valid Trust Anchor in Windows 7 relating to Wifi?

    - by Aaron
    The error below just started happening at work with a personal laptop running Windows 7 Ultimate. I'm unable to use installed, non-expired certificates to connect to a private wireless network. No recent changes were made by IT that would explain the issue. It worked fine several weeks ago and happens on two laptops I own. The details and some screen shots are here: http://www.wiredprairie.us/blog/index.php/archives/906 The error we don't understand is this: The credentials provided by the server could not be validated. We recommend that you terminate the connection and contact your administrator with the information provided in the details. You may still connect but doing so exposes you to the security risk by a possible rogue server. The server XYZ presented a valid certificate issued by Company Name Certificate Authority but Company Name Certificate Authority is not configured as a valid trust anchor for this profile. We don't know to to resolve the issue without ignoring the error (nor what's changed that could explain this new error). Update: The new information is that we have our own Root CA, and that the certificates were not updated recently, nor have any expired.

    Read the article

  • untrusted (self-sign) certificate on android browser

    - by Basiclife
    Hi all, Apologies for the brevity of this question but due to an unfortunate series of events, I've managed to brick my PC so am posting from my phone... We've just set up Windows Small Business Server 2008 at work which has an external web portal accessible via HTTPS. We haven't yet bought?installed any certificates. The portal provides access to email, sharepoint, remote desktop, etc.... (I'm aware some of these are never going to work on the phone) From firefox / other desktop browsers, this displays an "untrusted cert' warning which I can choose to ignore. When browsing from my mobile I get a popup notification which says. "A secure connection could not be established" when I OK this (my only option) I see the standard android-generated "unable to load page - has it moved?" Page. Does anyone know of a way to either accept the certificate temporarily or allow untrusted certificates generally? I'm aware that the latter option is non-ideal in the mid to long term but at the moment, I need to access the portal and am willing to either toggle settings as/when required or forego using the mobile for banking, etc... to mitigate my risk. Thanks in advance for any help you can provide and apologies again for brevity In case it helps I'm on the G1 running android 1.6 using the default browser

    Read the article

  • Virtual SMTP not sending mails

    - by DoStuffZ
    Hi I have been googling for the better part of the last two hours without finding any conclusion. My mails are not being sent from the production webserver. If I stop/start the Virtual SMTP I get this in the event log: No usable TLS server certificate for SMTP virtual server instance '1' could be found. TLS will be disabled for this virtual-server. We recently updated the webapplication running and I assume something went amiss during that. Googling the message straight up gave me a list that just as well could have been in greek. I found a security certificate on the server, installing that gave no change. I basicly played russian roulette with the certificate file (.cer), though I was somewhat certain it would not have a negative effect. (Russian roulette with a 6 chamber gun and 2 bullets.) I found a .pfx in our local documentation folder, though I'm far from certain that to have a positive effect. (6 chambers and 5 bullets). I found a site describing how the Virtual SMTP - Properties - Access - should have a button saying Certificates. I have a text saying "Did not find any TLS certificates" and a grayed out tick box saying "Require TLS certificate". I found the TLS being SSL ver3.1+ (3.1-3.3). So question goes - How do I enable the SMTP to once again send emails, like before.

    Read the article

  • apache renew ssl not working [on hold]

    - by Varun S
    Downloaded a new ssl cert from go daddy and installed the cert on apache2 server put the cert in /etc/ssl/certs/ folder put the gd_bundle.crt in the /etc/ssl/ folder private key is in /etc/ssl/private/private.key I just replaced the original files with the new files, did not replace the private key. I restarted the server but the website is still showing old certificated date. What am I doing wrong and how do i resolve it ? my httpd.conf file is empty, the certificated config is in the sites-enabled/default-ssl file the server is apache2 running ubuntu 14.04 os SSLEngine on # A self-signed (snakeoil) certificate can be created by installing # the ssl-cert package. See # /usr/share/doc/apache2.2-common/README.Debian.gz for more info. # If both key and certificate are stored in the same file, only the # SSLCertificateFile directive is needed. SSLCertificateFile /etc/ssl/certs/2b1f6d308c2f9b.crt SSLCertificateKeyFile /etc/ssl/private/private.key # Server Certificate Chain: # Point SSLCertificateChainFile at a file containing the # concatenation of PEM encoded CA certificates which form the # certificate chain for the server certificate. Alternatively # the referenced file can be the same as SSLCertificateFile # when the CA certificates are directly appended to the server # certificate for convinience. SSLCertificateChainFile /etc/ssl/gd_bundle.crt -rwxr-xr-x 1 root root 1944 Aug 16 06:34 /etc/ssl/certs/2b1f6d308c2f9b.crt -rwxr-xr-x 1 root root 3197 Aug 16 06:10 /etc/ssl/gd_bundle.crt -rw-r--r-- 1 root root 1679 Oct 3 2013 /etc/ssl/private/private.key /etc/apache2/sites-available/default-ssl: # SSLCertificateFile directive is needed. /etc/apache2/sites-available/default-ssl: SSLCertificateFile /etc/ssl/certs/2b1f6d308c2f9b.crt /etc/apache2/sites-available/default-ssl: SSLCertificateKeyFile /etc/ssl/private/private.key /etc/apache2/sites-available/default-ssl: # Point SSLCertificateChainFile at a file containing the /etc/apache2/sites-available/default-ssl: # the referenced file can be the same as SSLCertificateFile /etc/apache2/sites-available/default-ssl: SSLCertificateChainFile /etc/ssl/gd_bundle.crt /etc/apache2/sites-enabled/default-ssl: # SSLCertificateFile directive is needed. /etc/apache2/sites-enabled/default-ssl: SSLCertificateFile /etc/ssl/certs/2b1f6d308c2f9b.crt /etc/apache2/sites-enabled/default-ssl: SSLCertificateKeyFile /etc/ssl/private/private.key /etc/apache2/sites-enabled/default-ssl: # Point SSLCertificateChainFile at a file containing the /etc/apache2/sites-enabled/default-ssl: # the referenced file can be the same as SSLCertificateFile /etc/apache2/sites-enabled/default-ssl: SSLCertificateChainFile /etc/ssl/gd_bundle.crt

    Read the article

  • Always failed in connecting to the Outlook Anywhere through TMG 2010 with certificate ?

    - by Albert Widjaja
    Hi, I have successfully published Exchange Activesync using TMG 2010 and OWA internally only but somehow when I tried to publish the Outlook Anywhere it failed ( as can be seen from the https://www.testexchangeconnectivity.com ) Settings: IIS 7 settings, I have unchecked the require SSL and "Ignore" the client certificate Exchange CAS settings: ServerName : ExCAS02-VM SSLOffloading : True ExternalHostname : activesync.domain.com ClientAuthenticationMethod : Basic IISAuthenticationMethods : {Basic} MetabasePath : IIS://ExCAS02-VM.domainad.com/W3SVC/1/ROOT/Rpc Path : C:\Windows\System32\RpcProxy Server : ExCAS02-VM AdminDisplayName : ExchangeVersion : 0.1 (8.0.535.0) Name : Rpc (Default Web Site) DistinguishedName : CN=Rpc (Default Web Site),CN=HTTP,CN=Protocols,CN=ExCAS02-VM,CN=Servers,CN=Exchange Administrative....... Identity : ExCAS02-VM\Rpc (Default Web Site) Guid : 59873fe5-3e09-456e-9540-f67abc893f5e ObjectCategory : domainad.com/Configuration/Schema/ms-Exch-Rpc-Http-Virtual-Directory ObjectClass : {top, msExchVirtualDirectory, msExchRpcHttpVirtualDirectory} WhenChanged : 18/02/2011 4:31:54 PM WhenCreated : 18/02/2011 4:30:27 PM OriginatingServer : ADDC01.domainad.com IsValid : True Test-OutlookWebServices settings: 1013 Error When contacting https://activesync.domain.com/Rpc received the error The remote server returned an error: (500) Internal Server Error. 1017 Error [EXPR]-Error when contacting the RPC/HTTP service at https://activesync.domain.com/Rpc. The elapsed time was 0 milliseconds. https://www.testexchangeconnectivity.com testing result: Checking the IIS configuration for client certificate authentication. Client certificate authentication was detected. Additional Details Accept/Require client certificates were found. Set the IIS configuration to Ignore Client Certificates if you aren't using this type of authentication. environment: Windows Server 2008 (HT-CAS) Exchange Server 2007 SP1 TMG 2010 Standard Outlook 2007 client SP2. Any kind of help would be greatly appreciated. Thanks.

    Read the article

  • Makecert.exe hangs

    - by Robert
    I was following the steps in Scott Hanselman's blog post describing how to create a certificate authority and code signing certificate for PowerShell scripts. Initially, I created the certificate authority and a personal certifcate and used it to sign a powershell script successfully. All went as described in the blog post. The problem starts (as most do) when I did something that was (probably) stupid, although it seemed reasonable at the time. I wanted to start over and repeat the process again with a clean slate, so from the mmc certificates snap-in console, I deleted the personal certificate and the certificate authority I created previously. After that any time I try to use makecert, (just as I did the first time around), makecert either hangs or faults (which prompts to end or debug). Did I hose something up by deleting via the certificates snap-in? It didn't complain or warn me that it could be potentially hazardous. Is this just coincidence and something else entirely could be hosed? I have Event Log entries from the times when makecert crashed, which all look very similar; here is one: Log Name: Application Source: Application Error Date: 8/5/2009 3:55:04 PM Event ID: 1000 Task Category: (100) Level: Error Description: Faulting application makecert.exe, version 6.0.6000.16384, time stamp 0x4545910b, faulting module ntdll.dll, version 6.0.6002.18005, time stamp 0x49e03821, exception code 0xc0000005, fault offset 0x00067409, process id 0xe58, application start time 0x01ca160efdf30625. Anyone have any ideas as to what exactly caused this and/or what I can do to fix it. I'm on 32-bit Vista Enterprise w/SP2.

    Read the article

  • Setting up HTTPS across multiple servers

    - by JohnyD
    I'm looking to offer our online services over https and I'm having a couple of problems understanding how to accomplish this. To access our services you must pass through our ISA firewall to a Win2000 server running IIS6. About half our services are located here and the other half take you to a Win2003 server also running IIS6. So, in order to achieve this must each server have the proper certificate installed? ISA, IIS6_1 and IIS6_2? Is there a separate configuration that must be made to our ISA firewall? The other problem is with the CA and knowing how many certificates I need. It's important to note that the domain name for our services on IIS6_1 is www.domainname.com but the domain name on IIS6_2 is services.domainname.com. I believe that this will require me to purchase more than one certificate. It looks as though we will be going with Thawte's SSL123 as it's a good name and it's fast to get. Will I need to purchase 2 certificates (one for www that will be installed on our ISA firewall as well as IIS6_1, and one for services.domainname.com on IIS6_2)? Or will I need to purchase 3, the extra one being used on our firewall server? Another side question is about SAN's (subject alternative names). Is this basically adding sub-domains to your cert? So I could purchase one cert with 1 SAN for my www and services.? Thanks a lot for your help! Please let me know if I can provide any further information.

    Read the article

  • Using secure proxies with Google Chrome

    - by cYrus
    Whenever I use a secure proxy with Google Chrome I get ERR_PROXY_CERTIFICATE_INVALID, I tried a lot of different scenarios and versions. The certificate I'm using a self-signed certificate: openssl genrsa -out key.pem 1024 openssl req -new -key key.pem -out request.pem openssl x509 -req -days 30 -in request.pem -signkey key.pem -out certificate.pem Note: this certificate works (with a warning since it's self-signed) when I try to setup a simple HTTPS server. The proxy Then I start a secure proxy on localhost:8080. There are a several ways to accomplish this, I tried: a custom Node.js script; stunnel; node-spdyproxy (OK, this involves SPDY too, but later... the problem is the same); [...] The browser Then I run Google Chrome with: google-chrome --proxy-server=https://localhost:8080 http://superuser.com to load, say, http://superuser.com. The issue All I get is: Error 136 (net::ERR_PROXY_CERTIFICATE_INVALID): Unknown error. in the window, and something like: [13633:13639:1017/182333:ERROR:cert_verify_proc_nss.cc(790)] CERT_PKIXVerifyCert for localhost failed err=-8179 in the console. Note: this is not the big red warning that complains about insecure certificates. Now, I have to admit that I'm quite n00b for what concerns certificates and such, if I'm missing some fundamental points, please let me know.

    Read the article

  • Subversion Edge LDAP (require CAC Certificate not Username and Password)

    - by Frank Hale
    What I've Done: I've successfully installed and configured Subversion Edge 3.1.2 with LDAP support on a Windows 2008 server. I have configured LDAP users and am able to use LDAP credentials to work on repositories just fine. No issues whatsoever. Works great! What I Want To Do: I've been searching for several hours now in hopes to find some information on how to configure Subversion Edge server to require client certificates for user authentication against an LDAP environment. I have not found anything yet that gives me an indication of how to do it. I know there are SVN clients that are capable of prompting for CAC certificates but I cannot figure out how to set my server up to require it. NOTE: CAC authentication is already setup and working in the windows environment. Desired Outcome: When running svn commands that require authentication against my Subversion Edge Server I want it to prompt me for my CAC certificate instead of my Active Directory username and password. If anyone has any information on this I'd greatly appreciate it. EDIT: I'm still digging so if I find out anything I'll update this question with what I found.

    Read the article

  • Nginx with http/https - Http seemed redirected to https all the time

    - by dwarfy
    I've this really weird behaviour with my ubuntu 10.04 / nginx 1.2.3 server. Basically I changed the SSL certificates this morning. And ever since it has been behaving weirdly on all apps. Godaddy is reporting that HTTPS/SSL setup is correct. When I try a page it still works correctly when I'm using HTTPS. But when I try using HTTP nginx reports error : 400 Bad Request The plain HTTP request was sent to HTTPS port After looking around on google for hours, I've tried different setup (while originaly my setup was working correctly for longtime, I just renewed certificates) I kindof found a half solution by adding this to my config : error_page 497 $request_uri; The realllly weird thing is that when I use this setup : server { listen 80; server_name john.johnrocks.eu; access_log /home/john/envs/john_prod/nginx_access.log; error_log /home/john/envs/john_prod/nginx_error.log; location / { uwsgi_pass unix:///home/john/envs/john_prod/john.sock; include uwsgi_params; } location /media { alias /home/john/envs/john_prod/johntab/www; } location /adminmedia { alias /home/john/envs/john_prod/johntab/www/adminmedia; } } I still have the same error when using HTTP (while nothing is setup for HTTPS here)?? I'm getting crazy on this !

    Read the article

  • IIS 6 getting "Page Not Found" after applying SSL

    - by Dominic Zukiewicz
    I am setting up SSL certificates on a development environment using IIS 6 on W2k3. I have a directory called login with a single page login.asp which I would like only viewable over SSL. So before installing or applying SSL permissions, the page is viewable through a browser. I can browse the page and it redirects etc. and all is good. However Basic Authentication is Base64 encoded so I want to secure the traffic from this page only. I have created a dummy certificate in makecert, installed it and added it to IIS. IIS is happy that it is trusted. I have selected the directory of login and child files to "Require SSL channel". When I refresh my browser on login/login.asp I get a "404: Page Not Found" in IE 8. So 2 issues here The page is now unviewable when using HTTPS. They must manually type the HTTPS (minor inconvenience for now) If I turn off "Require SSL Channel" from IIS, it works again. What part of the process am I missing as I have followed several tutorials on installed SSL certificates, but still come across this barrier.

    Read the article

  • WEP/WPA/WPA2 and wifi sniffing

    - by jcea
    Hi, I know that WEP traffic can be "sniffed" by any user of the WIFI. I know that WPA/WPA2 traffic is encrypted using a different link key for each user, so they can't sniff traffic... unless they capture the initial handshake. If you are using a PSK (preshared key) schema, then you recover the link key trivially from this initial handshake. If you don't know the PSK, you can capture the handshake and try to crack the PSK by bruteforce offline. Is my understanding correct so far?. I know that WPA2 has AES mode and can use "secure" tokens like X.509 certificates and such, and it is said to be secure against sniffing because capturing the handshake doesn't help you. So, is WPA2+AES secure (so far) against sniffing, and how it actually works?. That is, how is the (random) link key negociated?. When using X.509 certificates or a (private and personal) passphrase. Do WPA/WPA2 have other sniffer-secure modes beside WPA2+AES? How is broadcast traffic managed to be received by all the WIFI users, if each has a different link key?. Thanks in advance! :).

    Read the article

  • SSL timeout on some sites, across all browsers, on Mac OS X Snow Leopard

    - by dansays
    For the past several weeks, I've been receiving "Error 7 (net::ERR_TIMED_OUT): The operation timed out" when I attempt to connect to either Twitter or Paypal via SSL. I get this specific error in Google Chrome, but the same problem occurs in both Safari and Firefox. Other sites work fine, and other computers on my network can access these two sites. I have no firewall settings that would prevent me from accessing these sites over port 443. I notice that both Twitter and Paypal both have "Verisign Class 3 Extended Validation SSL CA" certificates. It is unclear whether this is related to the problem. In an effort to troubleshoot, I attempted to open the test sites referenced on Verisign's root certificate support page, which worked fine. Just to be sure, I downloaded and installed the root package file and installed all included Verisign certificates. No joy. I feel like I've hit a dead end. Any ideas? Update the first: I also cannot connect to FedEx.com, who also has a Verisign Class 3 Extended Validation cert. Update the second: Aaaaaaand it fixed itself. I did nothing. Or, I did something that worked, but in a delayed fashion. Frustrating, but a win is a win. I'll take it.

    Read the article

  • SSL connection error for only one site (of many) on server

    - by Matt Lacey
    I have a server running many websites, each with SSL. One of the sites is now refusing connections over SSL. This was previously working and I'm looking for assistance in determining what has been changed. Here's the situation: http://site1.com/ - works https://site1.com/ - works http://site2.com/ - works https://site2.com/ - Doesn't work (but did previously) Both sites are on the same server (Win Server 2003 SP2 - IIS6) Both sites use certificates from the same authority and are both valid (according to IIS). As far as I can tell, both sites have certificates configured identically in IIS. (Checked by a manual/visual check of properties, side by side) Through use of OpenSSL I can see that there's a "ssl handshake failure" when trying to connect to site2 using https. What could be the cause of this? How can I investigate further? Without SSL connections being available to this site, users are unable to log in or register. :( disclaimer: I'm not a server admin and not responsible for the box. Yes, there are wider issues here but I need to get this working again first.

    Read the article

  • Keytool and SSL Apache config

    - by Safari
    I have a question about SSL certificate... I have generate a certificate using this keytool command.. keytool -genkey -alias myalias -keyalg RSA -keysize 2048 and I used this command to export the certificate keytool -export -alias myalias -file certificate.crt So, I have a file .crt Now I would to configure my Apache ssl module. I need to use keytool...At the moment I can't to use Openssl How can I configure the module if I have only this certificate.crt file? I see these sections in my ssl.conf # Server Certificate: # Point SSLCertificateFile at a PEM encoded certificate. If # the certificate is encrypted, then you will be prompted for a # pass phrase. Note that a kill -HUP will prompt again. A new # certificate can be generated using the genkey(1) command. #SSLCertificateFile /etc/pki/tls/certs/localhost.crt # Server Private Key: # If the key is not combined with the certificate, use this # directive to point at the key file. Keep in mind that if # you've both a RSA and a DSA private key you can configure # both in parallel (to also allow the use of DSA ciphers, etc.) #SSLCertificateKeyFile /etc/pki/tls/private/localhost.key # Server Certificate Chain: # Point SSLCertificateChainFile at a file containing the # concatenation of PEM encoded CA certificates which form the # certificate chain for the server certificate. Alternatively # the referenced file can be the same as SSLCertificateFile # when the CA certificates are directly appended to the server # certificate for convinience. #SSLCertificateChainFile /etc/pki/tls/certs/server-chain.crt How can I configure the correct section?

    Read the article

  • How to make an x.509 certificate from a PEM one?

    - by Ken
    I'm trying to test a script, locally, which involves uploading a file using a Java-based program to a FileZilla FTPES server. For the real thing, there is a real certificate on the FZ server, and the upload step (tested alone) seems to work fine. I've installed FileZilla Server on my dev box (so it'll test uploading from localhost to localhost). I don't have a real certificate for it, of course, so I used the "Generate new certificate..." button in FZ. It works fine from an interactive FTPES program (as long as I OK the unknown cert), but from my Java program it throws a javax.net.ssl.SSLHandshakeException ("unable to find valid certification path to requested target"). So how do I tell Java that this certificate is OK with me? (I know there's a way to change the Java program to accept any certificate, but I don't want to go down that route. I want to test it just as it will happen in production, and I don't want to ignore unknown certificates in production.) I found that Java has a program called "keytool" that seems to be for managing this sort of thing, but it complains that the certificate file that FZ generated is not an "x.509" file. A posting from the FZ side said it was "PEM encoded". I have "openssl" here, which looks like it's perfect for converting between certificate formats, but I think my understanding of certificate formats is wrong because I'm not seeing anything obvious. My knowledge of security certificates is a bit shaky, so if my title is stupidly wrong, please help by fixing that. :-)

    Read the article

  • Getting the EFS Private Key out of system image

    - by thaimin
    I had to recently re-install Windows 7 and I lost my exported private key for EFS. I however have the entirety of my user directory and my figuring that the key must be in there SOMEWHERE. The only question is how to get it out. I did find the PUBLIC keys in AppData\Roaming\Microsoft\SystemCertificates\My\Certificates If I import them using certmg.msc it says I do have the private key in the information, but if I try export them it says I do not have the private key. Also, decryption of files doesn't work. There is also a "keys" folder at AppData\Roaming\Microsoft\SystemCertificates\My\Keys. After importing the certificates I copy those over into my new installation but it has no effect. I am starting to believe they are either in AppData\Roaming\Microsoft\Protect\S-1-5-21-...\ or AppData\Roaming\Microsoft\Crypto\RSA\S-1-5-21-...\ but I am unsure how to use the files in those folders. Also, since my SID has changed, will I be able to use them? The other parts of the account have remained the same (name and password). I also have complete access to the user registry hive and most of the old system files (including the old system registry hives). I do keep seeing references to "Key Recovery Agent" but have not found anything about using, just that it can be used. Thanks!

    Read the article

  • Security Token for Mac/Linux/Windows, self-managed, pref. open source?

    - by DevelopersDevelopersDevelopers
    I'm looking to buy an evaluation security token (combined smart card/usb reader) for my business that works on: Windows 7 x64 OS X 10.6.x x64 Ubuntu Linux (64 or 32 bit, 10.04 or 10.10, I can bend based on possible tokens) Functionality I need is: Login authentication Authentication for whole-disk encryption (in Linux/Windows, Mac is flexible here) Signing/encryption using PGP and x.509 certificates RSA-2048 key-capable (1024 not good enough.) I can manage the certificates myself Open source middleware/drivers (not necessarily FOSS, just source available. Can flex on this, I just want to be able to audit the code. OpenSC-compatible on Linux would be great.) Is there any token that can do all of this? Or would I need multiple ones to accomplish this? Or do I need to look at smart cards and readers to get this? I have been researching this for a while and have had a heck of a time even getting accurate information about products. Also, I am in the USA, and it appears that EU export laws prevent me from buying from there, so those vendors are out. I was looking at Feitian tokens from Gooze, but since they are in France I can't buy.

    Read the article

  • Removing expired self-signed certificate in IE9 (created with IIS7.5)

    - by Itison
    Over 1 year ago, I created a self-signed certificate in IIS 7.5 and exported it. I then installed it for IE9 (it may have been IE8 at the time), which worked fine until a year later when the certificate expired. I have put this off, but today I created a new self-signed certificate in IIS, exported it, and attempted to install it in IE9. The problem is that for whatever reason, IE cannot seem to forget about the old, expired certificate. Here's what I tried initially: Accessed my ASP.NET application and see the Certificate error. Clicked "View certificates". Clicked "Install Certificate" and then Next/Next/Finish. At this point, it says the import is successful, but it still only shows the expired certificate. I've tried simply double-clicking on the exported certificate on my desktop. Initially I chose to automatically select the certificate store, but then I tried it again and manually selected "Trusted Root Certification Authorities". I've also tried dragging/dropping the certificate over an IE window and clicking "Open". The process is then exactly the same as it is if I had double-clicked on the certificate, but I had hoped that this would somehow specifically tell IE to use this certificate. I tried opening MMC and with the Certificate snap-in, confirmed that the new certificate was added under "Trusted Root Certification Authorities". It was also under my "Personal" certificates (I guess this is where it goes by default). Nothing worked, so I went through every folder in MMC and deleted the expired certificate. I also deleted the expired certificate in IIS. Nothing has worked. Any ideas? I see no clear resolution and I can't seem to find any posts related to this issue.

    Read the article

  • How to securely connect to multiple different LDAPS servers (Debian)

    - by Pickle
    I'm trying to connect to multiple different LDAPS servers. A lot of the documentation I've seen recommends setting TLS_REQCERT never, but that strikes me as horribly unsecure to not verify the certificate. So I've set that to demand. All the documentation I've seen says I need to update ldap.conf with a TLS_CACERT directive pointing to a .pem file. I've got that .pem file set up with the certificate from LDAP Server #1, and ldaps connections are happening fine. I've now got to communicate securely with another LDAP server in another branch of my organization, that uses a different certificate. I've seen no documentation on how to do this, except 1 page that says I can simply put multiple (not chained) certificates in the same .pem file. I've done this and everything is working hunky dorey. However, when I told a colleague what I did, he sounded like the sky was falling - putting 2 non-chained certificates into one .pem file is apparently the worst thing since ... ever. Is there a more acceptable way to do this? Or is this the only accepted way?

    Read the article

  • Strategy to isolate multiple nginx ssl apps with single domain via suburi's?

    - by icpu
    Warning: so far I have only learnt how to use nginx to serve apps with their own domain and server block. But I think its time to dive a little deeper. To mitigate the need for multiple SSL certificates or expensive wildcard certificates I would like to serve multiple apps (e.g. rails apps, php apps, node.js apps) from one nginx server_name. e.g. rooturl/railsapp rooturl/nodejsapp rooturl/phpshop rooturl/phpblog I am unsure on ideal strategy. Some examples I have seen and or thought about: Multiple location rules, this seems to cause conflicts between the individual app config requirements, e.g. differing rewrite and access requirements Isolated apps by backend internal port, is this possible? Each port routing to its own config? So config is isolated and can be bespoke to app requirements. Reverse proxy, I am little ignorant of how this works, is this what I need to research? is this actually 2 above? Help online seems to always proxy to another server e.g apache What is an effective way to isolate config requirements for apps served from a single domain via sub uris?

    Read the article

  • Routes for IIS Classic and Integrated Mode

    - by imran_ku07
         Introduction:             ASP.NET MVC Routing feature makes it very easy to provide clean URLs. You just need to configure routes in global.asax file to create an application with clean URLs. In most cases you define routes works in IIS 6, IIS 7 (or IIS 7.5) Classic and Integrated mode. But in some cases your routes may only works in IIS 7 Integrated mode, like in the case of using extension less URLs in IIS 6 without a wildcard extension map. So in this article I will show you how to create different routes which works in IIS 6 and IIS 7 Classic and Integrated mode.       Description:             Let's say that you need to create an application which must work both in Classic and Integrated mode. Also you have no control to setup a wildcard extension map in IIS. So you need to create two routes. One with extension less URL for Integrated mode and one with a URL with an extension for Classic Mode.   routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults );               Now you have set up two routes, one for Integrated mode and one for Classic mode. Now you only need to ensure that Integrated mode route should only match if the application is running in Integrated mode and Classic mode route should only match if the application is running in Classic mode. For making this work you need to create two custom constraint for Integrated and Classic mode. So replace the above routes with these routes,     routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new ClassicModeConstraint() }// Constraints ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new IntegratedModeConstraint() }// Constraints );            The first route which is for Classic mode adds a ClassicModeConstraint and second route which is for Integrated mode adds a IntegratedModeConstraint. Next you need to add the implementation of these constraint classes.     public class ClassicModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return !HttpRuntime.UsingIntegratedPipeline; } } public class IntegratedModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return HttpRuntime.UsingIntegratedPipeline; } }             HttpRuntime.UsingIntegratedPipeline returns true if the application is running on Integrated mode; otherwise, it returns false. So routes for Integrated mode only matched when the application is running on Integrated mode and routes for Classic mode only matched when the application is not running on Integrated mode.       Summary:             During developing applications, sometimes developers are not sure that whether this application will be host on IIS 6 or IIS 7 (or IIS 7.5) Integrated mode or Classic mode. So it's a good idea to create separate routes for both Classic and Integrated mode so that your application will use extension less URLs where possible and use URLs with an extension where it is not possible to use extension less URLs. In this article I showed you how to create separate routes for IIS Integrated and Classic mode. Hope you will enjoy this article too.   SyntaxHighlighter.all()

    Read the article

  • SQL SERVER – Query Hint – Contest Win Joes 2 Pros Combo (USD 198) – Day 1 of 5

    - by pinaldave
    August 2011 we ran a contest where every day we give away one book for an entire month. The contest had extreme success. Lots of people participated and lots of give away. I have received lots of questions if we are doing something similar this month. Absolutely, instead of running a contest a month long we are doing something more interesting. We are giving away USD 198 worth gift every day for this week. We are giving away Joes 2 Pros 5 Volumes (BOOK) SQL 2008 Development Certification Training Kit every day. One copy in India and One in USA. Total 2 of the giveaway (worth USD 198). All the gifts are sponsored from the Koenig Training Solution and Joes 2 Pros. The books are available here Amazon | Flipkart | Indiaplaza How to Win: Read the Question Read the Hints Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India residents only) 2 Winners will be randomly selected announced on August 20th. Question of the Day: Which of the following queries will return dirty data? a) SELECT * FROM Table1 (READUNCOMMITED) b) SELECT * FROM Table1 (NOLOCK) c) SELECT * FROM Table1 (DIRTYREAD) d) SELECT * FROM Table1 (MYLOCK) Query Hints: BIG HINT POST Most SQL people know what a “Dirty Record” is. You might also call that an “Intermediate record”. In case this is new to you here is a very quick explanation. The simplest way to describe the steps of a transaction is to use an example of updating an existing record into a table. When the insert runs, SQL Server gets the data from storage, such as a hard drive, and loads it into memory and your CPU. The data in memory is changed and then saved to the storage device. Finally, a message is sent confirming the rows that were affected. For a very short period of time the update takes the data and puts it into memory (an intermediate state), not a permanent state. For every data change to a table there is a brief moment where the change is made in the intermediate state, but is not committed. During this time, any other DML statement needing that data waits until the lock is released. This is a safety feature so that SQL Server evaluates only official data. For every data change to a table there is a brief moment where the change is made in this intermediate state, but is not committed. During this time, any other DML statement (SELECT, INSERT, DELETE, UPDATE) needing that data must wait until the lock is released. This is a safety feature put in place so that SQL Server evaluates only official data. Additional Hints: I have previously discussed various concepts from SQL Server Joes 2 Pros Volume 1. SQL Joes 2 Pros Development Series – Dirty Records and Table Hints SQL Joes 2 Pros Development Series – Row Constructors SQL Joes 2 Pros Development Series – Finding un-matching Records SQL Joes 2 Pros Development Series – Efficient Query Writing Strategy SQL Joes 2 Pros Development Series – Finding Apostrophes in String and Text SQL Joes 2 Pros Development Series – Wildcard – Querying Special Characters SQL Joes 2 Pros Development Series – Wildcard Basics Recap Next Step: Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India) Bonus Winner Leave a comment with your favorite article from the “additional hints” section and you may be eligible for surprise gift. There is no country restriction for this Bonus Contest. Do mention why you liked it any particular blog post and I will announce the winner of the same along with the main contest. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Joes 2 Pros, PostADay, SQL, SQL Authority, SQL Puzzle, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >