Search Results

Search found 55482 results on 2220 pages for 'html line'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 271/2220 | < Previous Page | 267 268 269 270 271 272 273 274 275 276 277 278  | Next Page >

  • WPF Coordinates of intersection from two Line objects

    - by Becky Franklin
    I have two Line objects in C# WPF, and I'm trying to construct a method to work out the coordinates at which the lines intersect (if at all). After giving myself a headache reminding myself of high school maths to do this, I can't work out how to map it into programming format - anyone know how to do this? Thanks very much, Becky

    Read the article

  • Post HTML data via XMLRPC in Python ?

    - by mrblue
    Hi all, I am writing a small script by Python to connect and post content to my WordPress blog. It's pretty straightforward with https://github.com/maxcutler/python-wordpress-xmlrpc However, when i tried to input a HTML data, for example: <b>Hello</b> It appears exactly in the WordPress post (I watch it from the visual editor, and I need to re-format it by copying the data to HTML mode to have the expected result. What should I do with my python script ? Thank you very much

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • java.util.logging: how to suppress date line

    - by andrews
    I'm trying to suppress output of the date line durinng logging when using the default logger in java.util.logging. For example, here is a typical output: Jun 1, 2010 10:18:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:18:12.0, local-time=20100601t101812, duration=180000 Jun 1, 2010 10:21:12 AM gamma.utility.application info INFO: ping: db-time=2010-06-01 10:21:12.0, local-time=20100601t102112, duration=180000 I would like to get rid of the Jun 1, 2010... lines, they just clutter my log output. How can I do this?

    Read the article

  • How to transform multiple line into one line in bash stdout ?

    - by Samantha
    Hello, I sometimes do this in my shell : sam@sam-laptop:~/shell$ ps aux | grep firefox | awk '{print $2}' 2681 2685 2689 4645 $ kill -9 2681 2685 2689 4645 Is there a way I can transform the multiple lines containing the PIDs into one line separated by spaces ? (It's a little bit annoying to type the PIDs every time and I really would like to learn :) ) Thanks a lot.

    Read the article

  • problems with passing html to the server with jquery

    - by CoffeeCode
    i have an ajax call $.ajax({ url: '<%=Url.Action("SaveDetails","Survey") %>', dataType: 'JSON', cache: false, data: { Id: selectedRow.Id, Value: surveyValue, FileName: filename, FileGuid: fileguid }, success: function(data) { ... } }); where the surveyValue is a html string. this call doesn't work. but is i change the surveyValue to an ordinary text i works fine. how can i pass the html to the server?

    Read the article

  • flex textarea text attribute but still renders as html

    - by David
    actually i got to the cause of the issue. if you feed the textarea text attribute with an tag that has a valid src url, then for some reason flex will try to render everything as html. Eg, try this: <mx:TextArea id="textArea" width="100%" height="90%" text="<img src='http://url-to-a-valid-img"/> and instead of it rendering it as raw text it will render it as an html. any idea?

    Read the article

  • Formatted HTML as output from method invocation from JMX HTTP page

    - by Dutch
    Hi, Is there a way to return HTML from a method which gets called from the JMX HTTP page. I have a huge set of data and want to display the data with some formatting. The following code does not work: @ManagedOperation(description = "return html") @ManagedOperationParameters({@ManagedOperationParameter(name = "someVal", description = "text")}) public List returnAsHtml(String someVal) { return ""+someValblah"; } Looks like JMX escapes the returned script before throwing it to the browser.

    Read the article

  • Current Line For Visual Studio Macros

    - by Vadim
    How can I read text of a current line (where cursor is situated) from Macros? I'm going to use such a fucntion: Public Sub AddTextToChangeLogFile() Dim textOnACurrentLine As ??? textOnACurrentLine = ??? If textOnACurrentLine.Text <> String.Empty Then Dim sw As New StreamWriter("C:\###\Changes.txt", True) sw.WriteLine(textOnACurrentLine + ". file: " + DTE.ActiveDocument.Name) sw.Close() End If End Sub

    Read the article

  • Animating gradient displays line artifacts in ActionScript

    - by TheDarkIn1978
    i've programatically created a simple gradient (blue to red) sprite rect using my own basic class called GradientRect, but moving or animation the sprite exhibits line artifacts. when the sprite is rotating, it kind of resembles bad reception of an old television set. i'm almost certain the cause is because each line slice of the gradient is vector so there are gaps between the lines - this is visible when the sprite is zoomed in. var colorPickerRect:GradientRect = new GradientRect(200, 200, 0x0000FF, 0xFF0000); addChild(colorPickerRect); colorPickerRect.cacheAsBitmap = true; colorPickerRect.x = colorPickerRect.y = 100; colorPickerRect.addEventListener(Event.ENTER_FRAME, rotate); function rotate(evt:Event):void { evt.target.rotation += 1; } ________________________ //CLASS PACKAGE package { import flash.display.CapsStyle; import flash.display.GradientType; import flash.display.LineScaleMode; import flash.display.Sprite; import flash.geom.Matrix; public class GradientRect extends Sprite { public function GradientRect(gradientRectWidth:Number, gradientRectHeight:Number, ...leftToRightColors) { init(gradientRectWidth, gradientRectHeight, leftToRightColors); } private function init(gradientRectWidth:Number, gradientRectHeight:Number, leftToRightColors:Array):void { var leftToRightAlphas:Array = new Array(); var leftToRightRatios:Array = new Array(); var leftToRightPartition:Number = 255 / (leftToRightColors.length - 1); var pixelColor:Number; var i:int; //Push arrays for (i = 0; i < leftToRightColors.length; i++) { leftToRightAlphas.push(1); leftToRightRatios.push(i * leftToRightPartition); } //Graphics matrix and lineStyle var leftToRightColorsMatrix:Matrix = new Matrix(); leftToRightColorsMatrix.createGradientBox(gradientRectWidth, 1); graphics.lineStyle(1, 0, 1, false, LineScaleMode.NONE, CapsStyle.NONE); for (i = 0; i < gradientRectWidth; i++) { graphics.lineGradientStyle(GradientType.LINEAR, leftToRightColors, leftToRightAlphas, leftToRightRatios, leftToRightColorsMatrix); graphics.moveTo(i, 0); graphics.lineTo(i, gradientRectHeight); } } } } how can i solve this problem?

    Read the article

  • NetBeans Java code formatter: logical operators on new line

    - by mizipzor
    My code looks like this: if (firstCondition() && secondCondition()) { // ... code } The default settings for the code formatter in NetBeans wants to put the && on a new line, like this: if (firstCondition() && secondCondition()) { // ... code } The formatter works well so I would just like to find the setting so it doesnt change the code to the latter. Whats the setting called?

    Read the article

  • How to read the selected items in an Html.ListBox at postback time

    - by EasyTimer
    I have a search page on my MVC site that contains a list of strings that I think the user might wish to search for in my database. This list of strings is available in my model class, so I can populate an Html.ListBox with those strings thus: <%=Html.ListBox("SearchStrings", new SelectList(Model.SearchStrings)) % My problem is, how can I tell which strings the user selected in that list in my postback action? Any help would be most appreciated.

    Read the article

  • Batch file command line arguments

    - by Hema Joshi
    I want to pass a command as a command line argument from one batch file to another e.g. first.bat call test.bat "echo hello world" "echo welcome " test.bat set initialcommand=%1 set maincommand=%2 %maincommand% %initialcommand%

    Read the article

  • How to resume CUPS printer from command line

    - by stach81
    Hello I have printer in CUPS that due driver problems (hp 1010) form time to time goes into pause. I would like to write a shell script that will be once per hour resuming printer in cups. But I have no idea after googling for couple of minutes how to resume printer from shell command line. Regards Stan

    Read the article

  • Getting following exception javax.sound.sampled.LineUnavailableException: line with format ULAW 800

    - by angelina
    Dear All, I tried to play and get duration of a wave file using code below but got following exception.please resolve.I m using a wave file format. URL url = new URL("foo.wav"); Clip clip = AudioSystem.getClip(); AudioInputStream ais = AudioSystem.getAudioInputStream(url); clip.open(ais); System.out.println(clip.getMicrosecondLength()); **javax.sound.sampled.LineUnavailableException: line with format ULAW 8000.0 Hz, 8 bit, mono, 1 bytes/frame, not supported.**

    Read the article

  • Python: try statement single line

    - by Brant
    Is there a way in python to turn a try/except into a single line? something like... b = 'some variable' a = c | b #try statement goes here Where b is a declared variable and c is not... so c would throw an error and a would become b...

    Read the article

  • PHP HTML sanitizer

    - by Mark Blades
    Hi, I'm wondering if anybody has used this class and found it to be reliable? http://www.phpclasses.org/package/3746-PHP-Remove-unsafe-tags-and-attributes-from-HTML-code.html Many thanks!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 267 268 269 270 271 272 273 274 275 276 277 278  | Next Page >