Search Results

Search found 7443 results on 298 pages for 'elements'.

Page 275/298 | < Previous Page | 271 272 273 274 275 276 277 278 279 280 281 282  | Next Page >

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Hide jQuery Accordion while loading

    - by zac
    I am testing a site build with a slow connection and I noticed the jQuery Accordion stays expanded for a long time, until the rest of the site is loaded, and then finally collapses. Not very pretty. I was wondering how I could keep it collapsed through the loading process and only expand when clicked. I am working with the standalone 1.6 version of the accordion plugin. The basic structure : <div class="sidebar"> <ul id="navigation" class="ui-accordion-container"> <li><a class="head" href="#">1</a> <ul class="sub"> <li><a href="#">1a</a></li> <li><a href="#">2a</a></li> </ul> </li> </ul> </div> and the script jQuery().ready(function(){ jQuery('#navigation').accordion({ active: 'false', header: '.head', navigation: true, animated: 'easeslide', collapsible: true }); }); I tried to hide the elements in the CSS to keep them from appearing while loading but all that achieved is in having them always hidden. Maybe the problem is in the CSS I have a background image in each of the sub menus: #navigation{ margin:0px; margin-left: 10px; padding:0px; text-indent:0px; font-size: 1.1em; width:200px; text-transform: uppercase; padding-bottom: 30px; } #navigation ul{ border-width:0px; margin:0px; padding:0px; text-indent:0px; } #navigation li{ list-style:none outside none; } #navigation li ul{ height:185px; overflow:auto; } #navigation li ul.sub{ background:url('../images/sub.jpg') no-repeat; dispaly: block; } #navigation li li a{ color:#000000; display:block; text-indent:20px; text-decoration: none; padding: 6px 0; } #navigation li li a:hover{ background-color:#FFFF99; color:#FF0000; } Thanks in advance for any advice on how to have this thing run a little smoother and having the accordion always collapsed. -edit - I forgot to mention that I am also hoping for a solution that will allow the nav to still be accessible for those without javscript.

    Read the article

  • What makes great software?

    - by VirtuosiMedia
    From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

    Read the article

  • Navigation bar(s) disappear when the window gets too small

    - by Leron
    The title maybe is a little misleading but I'm not 100% sure how this effect is called. I'm pretty sure what I meant is that my navigation bar is disappearing instead of collapsing. However my set up is this - I am working on the Layout view of ASP.NET MVC 4 project. I'm using bootstrap 3x but also have included jQuery libs so my <head> part is like this: @Scripts.Render("~/Scripts/bootstrap.min.js") @Styles.Render("~/Content/bootstrap.css") @Styles.Render("~/Content/themes/base/jquery.ui.smoothness.css") @Scripts.Render("~/Scripts/jquery-2.0.3.min.js") @Scripts.Render("~/Scripts/jquery-ui-1.10.3.min.js") //just skipped the standard stuff In the body I want to have two navbars and one side menu which will be the same for all my pages but I've noticed that when I start to narrow the window at some point instead of getting an effect similar to this example (noticed how the elements get repositioned) I just got both my navbars gone, I can't see them. The markup for my first navbar is this : <div class="navbar navbar-static-top navbar-inverse navbar-collapse collapse" role="navigation"> <ul class="nav navbar-nav "> <li><a href="#">Info</a></li> <li><a href="#">Info</a></li> </ul> </div> and the second one is : <div class="navbar navbar-collapse collapse" role="navigation" id="main-navigation-bar"> <ul class="nav nav-pills nav-justified"> <li style="border: 1px solid grey"><a href="#">Link</a></li> <li><a href="#">Link</a></li> <li><a href="#">Link</a></li> </ul> In fact the only thing left in my _Layout body is this: <div class="container-fluid"> @RenderBody() </div> which is just for compiling purposes and renders this view : <p>1</p> <p>2</p> <p>3</p> <p>4</p> <p>5</p> So when I make the window small enough so that my navbars disappear the only thing left is 1..5 numbers from the rendered view. I tested with only one navbar (commented the other) - no matter which one is commented, when I narrow the window I loose the navbar. How can I keep them using bootstrap 3x?

    Read the article

  • Mootools 1.2.4 delegation not working in IE8...?

    - by michael
    Hey there everybody-- So I have a listbox next to a form. When the user clicks an option in the select box, I make a request for the related data, returned in a JSON object, which gets put into the form elements. When the form is saved, the request goes thru and the listbox is rebuilt with the updated data. Since it's being rebuilt I'm trying to use delegation on the listbox's parent div for the onchange code. The trouble I'm having is with IE8 (big shock) not firing the delegated event. I have the following HTML: <div id="listwrapper" class="span-10 append-1 last"> <select id="list" name="list" size="20"> <option value="86">Adrian Franklin</option> <option value="16">Adrian McCorvey</option> <option value="196">Virginia Thomas</option> </select> </div> and the following script to go with it: window.addEvent('domready', function() { var jsonreq = new Request.JSON(); $('listwrapper').addEvent('change:relay(select)', function(e) { alert('this doesn't fire in IE8'); e.stop(); var status= $('statuswrapper').empty().addClass('ajax-loading'); jsonreq.options.url = 'de_getformdata.php'; jsonreq.options.method = 'post'; jsonreq.options.data = {'getlist':'<?php echo $getlist ?>','pkey':$('list').value}; jsonreq.onSuccess = function(rObj, rTxt) { status.removeClass('ajax-loading'); for (key in rObj) { status.set('html','You are currently editing '+rObj['cname']); if ($chk($(key))) $(key).value = rObj[key]; } $('lalsoaccomp-yes').set('checked',(($('naccompkey').value > 0)?'true':'false')); $('lalsoaccomp-no').set('checked',(($('naccompkey').value > 0)?'false':'true')); } jsonreq.send(); }); }); (I took out a bit of unrelated stuff). So this all works as expected in firefox, but IE8 refuses to fire the delegated change event on the select element. If I attach the change function directly to the select, then it works just fine. Am I missing something? Does IE8 just not like the :relay? Sidenote: I'm very new to mootools and javascripting, etc, so if there's something that can be improved code-wise, please let me know too.. Thanks!

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • JButton Image Ignoring GridBagConstraints

    - by daemor
    I am working on an application and have a screen that needs to have elements (namely some custom JButtons) appear and disappear based on a user selection. However for some reason, when I add these buttons to their pane, the buttton image goes to the top corner, and leaves the text in the center, completely ignoring GridBagConstraints. I am completely stumped on this one as I have done this same exact thing dozens of times earlier in the program without any issues. Here is an image of the problem: The problem is in this method here, and occurs down towards the bottom. public void init(){ contentPane.removeAll(); // Setup jlabels JLabel countyLabel = new JLabel("County"); countyLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); JLabel measureByLabel = new JLabel("Measure By: "); measureByLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); String[] countyChoices = {"Washtenaw", "Oakland", "Livingston"}; // setup components JComboBox<String> countyCombo = new JComboBox<String>(countyChoices); // place baseComponents c.weightx = 0.5; c.weighty = 0.5; c.gridx = 0; c.gridy = 0; c.anchor = GridBagConstraints.NORTH; contentPane.add(countyLabel, c); c.gridx = 2; contentPane.add(countyCombo, c); c.gridy = 1; c.gridx = 0; contentPane.add(trenchButton, c); c.gridx = 2; contentPane.add(bedButton, c); c.gridy = 2; c.gridx = 1; contentPane.add(systemSelection, c); c.gridy = 3; c.gridx = 0; contentPane.add(lengthButton, c); c.fill = GridBagConstraints.BOTH; c.gridwidth = 4; c.gridy = 4; c.gridx = 0; contentPane.add(choicePane, c); GridBagConstraints con = new GridBagConstraints(); con.weightx = 0.5; con.weighty = 0.5; con.gridx = 0; con.gridy = 0; choicePane.add(lengthButton, c); // revalidate and repaint choicePane.revalidate(); choicePane.repaint(); contentPane.revalidate(); contentPane.repaint(); } I have tried doing this in separate methods, the button looks fine when added to the contentPane, the pane is for sure set to gridbagconstraints as I used the expression JPanel choicePane = new JPanel(new GridBagLayout()) to initialize it.

    Read the article

  • Can this be imporved? Scrubing of dangerous html tags.

    - by chobo2
    Hi I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • Can this be improved? Scrubing of dangerous html tags.

    - by chobo2
    I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

    Read the article

  • Find next and previous link in a hierarchy

    - by rebellion
    I have a hierarchy with links nested in list element like this: <ul> <li><a href="#">Page 1</a> <ul> <li><a href="#">Page 1.1</a></li> <li><a href="#">Page 1.2</a> <ul> <li><a href="#">Page 1.2.1</a></li> <li><a href="#">Page 1.2.2</a></li> </ul> </li> <li><a href="#">Page 1.3</a></li> </ul> </li> <li><a href="#">Page 2</a> <ul> <li><a href="#">Page 2.1</a></li> <li><a href="#">Page 2.2</a></li> </ul> </li> <li><a href="#">Page 3</a> <ul> <li><a href="#">Page 3.1</a> <ul> <li><a href="#">Page 3.1.1</a></li> <li><a href="#">Page 3.1.2</a></li> </ul> <li><a href="#">Page 3.2</a></li> <li><a href="#">Page 3.3</a></li> <ul> <li><a href="#">Page 3.1.1</a></li> <li><a href="#">Page 3.1.2</a></li> </ul> </li> </ul> </li> </ul> Basically just a sitemap. But I want to make next and previous links with jQuery, which finds the active page you're on (probably by checking for a class), and finding the previous and next anchor element (taking no regards of the hierarchy). I've tried with next(), previous() and find() but can't seem to get it to work. What is the easiest way to get the anchor elements before and after the current one?

    Read the article

  • Swapping two jQuery draggable list items not working properly (with jsFiddle example)

    - by Tony_Henrich
    The minimalist working example below swaps the two boxes when box 'one' is dragged and dropped on box 'two'. The problem is that when box 'one' is dropped, its style has 'top' & 'left' values causing it to be placed away from where it should drop. Its class includes 'ui-draggable-dragging'. It seems the top & left values are related to the amount the elements were dragged before the drop. And the dragging was 'interrupted' hence the residual 'ui-draggable-dragging' class? What am I missing to make the swap work seamlessly? full jsfiddle example here <html> <head> <script type="text/javascript" src="includes/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="includes/jquery-ui-1.8.2.custom.min.js"></script> <script type="text/javascript"> jQuery.fn.swapWith = function(to) { return this.each(function() { var copy_to = $(to).clone(true); var copy_from = $(this).clone(true); $(to).replaceWith(copy_from); $(this).replaceWith(copy_to); }); }; $(document).ready(function() { options = {revert: true}; $("li").draggable(options) $('#wrapper').droppable({ drop: function(event, ui) { $(ui.draggable).swapWith($('#two')); } }); }); </script> </head> <body> <form> <ul id="wrapper"> <li id='one'> <div style="width: 100px; height: 100px; border: 1px solid green"> one<br /></div> </li> <li id='two'> <div style="width: 110px; height: 110px; border: 1px solid red"> two<br /></div> </li> </ul> <br /> </form> </body> </html>

    Read the article

  • Flex/Air/AS3 Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Sorted sets and comparators

    - by Jack
    Hello, I'm working with a TreeSetthat is meant to store pathfind locations used during the execution of a A* algorithm. Basically until there are "open" elements (still to be exhaustively visited) the neighbours of every open element are taken into consideration and added to a SortedSetthat keeps them ordered by their cost and heuristic cost. This means that I have a class like: public class PathTileInfo implements Comparable<PathTileInfo> { int cost; int hCost; final int x, y; @Override public int compareTo(PathTileInfo t2) { int c = cost + hCost; int c2 = t2.cost + t2.hCost; int costComp = c < c2 ? -1 : (c > c2 ? 1: 0); return costComp != 0 ? costComp : (x < t2.x || y < t2.y ? -1 : (x > t2.x || y > t2.y ? 1 : 0)); } @Override public boolean equals(Object o2) { if (o2 instanceof PathTileInfo) { PathTileInfo i = (PathTileInfo)o2; return i.cost + i.hCost == cost + hCost && x == i.x && y == i.y; } return false; } } In this way first the total cost is considered, then, since a total ordering is needed (consistency with equals) a ordering according to the x,y coordinate is taken into account. This should work but simply it doesn't, if I iterate over the TreeSet during the algorithm execution like in for (PathTileInfo t : openSet) System.out.print("("+t.x+","+t.y+","+(t.cost+t.hCost)+") "); I get results in which the right ordering is not kept, eg: (7,7,6) (7,6,7) (6,8,6) (6,6,7) (5,8,7) (5,7,7) (6,7,6) (6,6,7) (6,5,7) (5,7,7) (5,5,8) (4,7,7) (4,6,8) (4,5,8) is there something subtle I am missing? Thanks!

    Read the article

  • Writing to a xml file in java

    - by user243680
    import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • Calling a function that resides in the main page from a plugin?

    - by Justin Lee
    I want to call a function from within plugin, but the function is on the main page and not the plugin's .js file. EDIT I have jQuery parsing a very large XML file and building, subsequently, a large list (1.1 MB HTML file when dynamic content is copied, pasted, then saved) that has expand/collapse functionality through a plugin. The overall performance on IE is super slow and doggy, assuming since the page/DOM is so big. I am currently trying to save the collapsed content in the event.data when it is collapsed and remove it from the DOM, then bring it back when it is told to expand... the issue that I am having is that when I bring the content back, obviously the "click" and "hover" events are gone. I'm trying to re-assign them, currently doing so inside the plugin after the plugin expands the content. The issue then though is that is says the function that I declare within the .click() is not defined. Also the hover event doesn't seem to be re-assigning either.... if ($(event.data.trigger).attr('class').indexOf('collapsed') != -1 ) { // if expanding // console.log(event.data.targetContent); $(event.data.trigger).after(event.data.targetContent); $(event.data.target).hide(); /* This Line --->*/ $(event.data.target + 'a.addButton').click(addResourceToList); $(event.data.target + 'li.resource') .hover( function() { if (!($(this).attr("disabled"))) { $(this).addClass("over"); $(this).find("a").css({'display':'block'}); } }, function () { if (!($(this).attr("disabled"))) { $(this).removeClass("over"); $(this).children("a").css({'display':'none'}); } } ); $(event.data.target).css({ "height": "0px", "padding-top": "0px", "padding-bottom": "0px", "margin-top": "0px", "margin-bottom": "0px"}); $(event.data.target).show(); $(event.data.target).animate({ height: event.data.heightVal + "px", paddingTop: event.data.topPaddingVal + "px", paddingBottom: event.data.bottomPaddingVal + "px", marginTop: event.data.topMarginVal + "px", marginBottom: event.data.bottomMarginVal + "px"}, "normal");//, function(){$(this).hide();}); $(event.data.trigger).removeClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'expanded', {hoursToLive: 24 * 365}); } else if ($(event.data.trigger).attr('class').indexOf('collapsed') == -1 ) { // if collapsing $(event.data.target).animate({ height: "0px", paddingTop: "0px", paddingBottom: "0px", marginTop: "0px", marginBottom: "0px"}, "normal", function(){$(this).hide();$(this).remove();}); $(event.data.trigger).addClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'collapsed', {hoursToLive: 24 * 365}); } EDIT So, having new eyes truly makes a difference. As I was reviewing the code in this post this morning after being away over the weekend, I found where I had err'd. This: $(event.data.target + 'a.addButton').click(addResourceToList); Should be this (notice the space before a.addbutton): $(event.data.target + ' a.addButton').click(addResourceToList); Same issue with the "li.resource". So it was never pointing to the right elements... Thank you, Rene, for your help!!

    Read the article

  • whats wrong with this php mysql_real_escape_string

    - by skyhigh
    Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

    Read the article

  • Showing div based on filled form field

    - by Fabio
    I have this script where I use a slider to show some elements of a form. So far so good. The way I'm doing it is by having a slider (can't use a multistep form since it uses a plugin not allowing multistep forms, plus some graphic behaviors) and a button that goes to the next slider. So now I need that button (not part of the form) to show only if a certain field is filled. I tried teh following, but it's not working, I assume some error but can't figure what. My code is as follows: $('#clientname').change(function() { var clientVal = $("input").val() == ''; $(".next").hide(); if ($('#clientname').val() != '').show(); else $('.next').hide(); }); and the html as follows: <div class="b40-right"> <h3>The Basics</h3> <div class="label"> Your Name (required)</div> <div class="inputes"> <span class="wpcf7-form-control-wrap your-name"><input id="clientname" type="text" name="your-name" value="" class="wpcf7-form-control wpcf7-text wpcf7-validates-as-required" size="40" /></span> </div> <div class="label">Your Email (required)</div> <div class="inputes"> <span class="wpcf7-form-control-wrap your-email"><input type="text" name="your-email" value="" class="wpcf7-form-control wpcf7-text wpcf7-email wpcf7-validates-as-required wpcf7-validates-as-email" size="40" /></span> </div> <div class="label">Type of Business</div> <div class="inputes"> <span class="wpcf7-form-control-wrap type-of-business"><textarea name="type-of-business" class="wpcf7-form-control wpcf7-textarea" cols="40" rows="10"></textarea></span> </div> </div> <a class="next" href="javascript:stepcarousel.stepBy('mygallery2', 1)"><img id="nextbut1" src="<?php bloginfo('template_directory'); ?>/images/next.png" alt="" /></a> any help on what am I doing wrong? Is there a better approach/solution? (I'm not a programmer as you may figure) Thank you in advance!

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • How to convert Xml files to Text Files 2

    - by John
    Hi all, I have around 8000 xml files that needs to be converted into text files. The text file must contain title, description and keywords of the xml file without the tags and removing other elements and attributes as well. In other words, i need to create 8000 text files containing the title,description and keywords of the xml file. I need codings for this to be done systematically. Any help would be greatly appreciated. Thanks in advance. Hey all thank you all so so much with your replies. Here's a sample of what my xml looks like: <?xml version="1.0"?> <metadata> <identifier>43productionsNightatthegraveyard</identifier> <title>Night at the graveyard</title> <collection>opensource_movies</collection> <mediatype>movies</mediatype> <resource>movies</resource> <upload_application appid="ccPublisher" version="2.2.1"/> <uploader>[email protected]</uploader> <description>una noche en el cementerio (terror)</description> <license>http://creativecommons.org/licenses/by-nc/3.0/</license> <title>Night at the graveyard</title> <format>Video</format> <adder>[email protected]</adder> <licenseurl>http://creativecommons.org/licenses/by-nc/3.0/</licenseurl> <year>2007</year> <keywords>Night,at,the,graveyard,43,productions</keywords> <holder>43 productions</holder> <publicdate>2007-04-11 19:52:28</publicdate> </metadata> And this would be the output: una noche en el cementerio (terror) Night at the graveyard Night,at,the,graveyard,43,productions This need to be saved with the same name but in text format. Thanks all so much if any more suggestions would be much appreciated.

    Read the article

< Previous Page | 271 272 273 274 275 276 277 278 279 280 281 282  | Next Page >