Search Results

Search found 7443 results on 298 pages for 'elements'.

Page 275/298 | < Previous Page | 271 272 273 274 275 276 277 278 279 280 281 282  | Next Page >

  • Javascript scope problem with object and setTimeout

    - by Shabbyrobe
    I'm trying to make a jQuery plugin that executes a method on a timer. I'd like it to work on multiple elements on a page independently. I've reached a point where the timer executes for each element, but the method called in the setTimeout seems to only know about the last instance of the plugin. I know I'm doing something fundamentally stupid here, but I'm danged if I know what. I know stuff like this has been asked 8 million times on here before, but I've not managed to find an answer that relates to my specific problem. Here's a script that demonstrates the structure of what I'm doing. <html> <head> <script type="text/javascript" src="assets/jquery.min.js"></script> <script type="text/javascript"> var crap = 0; (function($) { jQuery.fn.pants = function(options) { var trousers = { id: null, current: 0, waitTimeMs: 1000, begin: function() { var d = new Date(); this.id = crap++; console.log(this.id); // do a bunch of stuff window.setTimeout(function(self) {return function() {self.next();}}(this), this.waitTimeMs); }, next: function() { this.current ++; console.log(this.id); window.setTimeout(function(self) {return function() {self.next();}}(this), this.waitTimeMs); }, }; options = options || {}; $.extend(trousers, options); this.each(function(index, element) { trousers.begin(); }); return this; }; } )(jQuery); jQuery(document).ready(function() { jQuery("div.wahey").pants(); }); </script> </head> <body> <div class="wahey"></div> <div class="wahey"></div> </body> </html> The output I get is this: 0 1 1 1 1 1 The output I expect to get is this: 0 1 0 1 0 1

    Read the article

  • Get value of element in Multi-Dimensional Array

    - by George
    Here is my foreach loop to get at the values from a multi-dimensional array $_coloredvariables = get_post_meta( $post->ID, '_coloredvariables', true ); foreach ($_coloredvariables as $key => $value) { var_dump($value); } Which outputs this: array 'label' => string 'Color' (length=5) 'size' => string 'small' (length=5) 'displaytype' => string 'square' (length=6) 'values' => array 'dark-night-angel' => array 'type' => string 'Image' (length=5) 'color' => string '#2c4065' (length=7) 'image' => string '' (length=0) 'forest-green' => array 'type' => string 'Color' (length=5) 'color' => string '#285d5f' (length=7) 'image' => string '' (length=0) 'voilet' => array 'type' => string 'Color' (length=5) 'color' => string '#6539c9' (length=7) 'image' => string '' (length=0) 'canary-yellow' => array 'type' => string 'Color' (length=5) 'color' => string 'grey' (length=4) 'image' => string '' (length=0) And then to only get the values array I can do this: foreach ($_coloredvariables as $key => $value) { var_dump($value['values']); } which outputs this: array 'dark-night-angel' => array 'type' => string 'Image' (length=5) 'color' => string '#2c4065' (length=7) 'image' => string '' (length=0) 'forest-green' => array 'type' => string 'Color' (length=5) 'color' => string '#285d5f' (length=7) 'image' => string '' (length=0) 'voilet' => array 'type' => string 'Color' (length=5) 'color' => string '#6539c9' (length=7) 'image' => string '' (length=0) 'canary-yellow' => array 'type' => string 'Color' (length=5) 'color' => string 'grey' (length=4) 'image' => string '' (length=0) What I can't figure out is how to get these elements in the array structure "dark-night-angel", "forest-green", "voilet", "canary-yellow" Without using specific names: var_dump($value['values']['dark-night-angel']) Something that is more dynamic, of course this doesn't work: var_dump($value['values'][0][0]); thanks

    Read the article

  • How to get the top keys from a hash by value

    - by Kirs Kringle
    I have a hash that I sorted by values greatest to least. How would I go about getting the top 5? There was a post on here that talked about getting only one value. What is the easiest way to get a key with the highest value from a hash in Perl? I understand that so would lets say getting those values add them to an array and delete the element in the hash and then do the process again? Seems like there should be an easier way to do this then that though. My hash is called %words. use strict; use warnings; use Tk; #Learn to install here: http://factscruncher.blogspot.com/2012/01/easy-way-to-install-tk- on-strawberry.html #Reading in the text file my $file0 = Tk::MainWindow->new->Tk::getOpenFile; open( my $filehandle0, '<', $file0 ) || die "Could not open $file0\n"; my @words; while ( my $line = <$filehandle0> ) { chomp $line; my @word = split( /\s+/, lc($line)); push( @words, @word ); } for (@words) { s/[\,|\.|\!|\?|\:|\;|\"]//g; } #Counting words that repeat; put in hash my %words_count; $words_count{$_}++ for @words; #Reading in the stopwords file my $file1 = "stoplist.txt"; open( my $filehandle1, '<', $file1 ) or die "Could not open $file1\n"; my @stopwords; while ( my $line = <$filehandle1> ) { chomp $line; my @linearray = split( " ", $line ); push( @stopwords, @linearray ); } for my $w ( my @stopwords ) { s/\b\Q$w\E\B//ig; } #Comparing the array to Hash and deleteing stopwords my %words = %words_count; for my $stopwords ( @stopwords ) { delete $words{ $stopwords }; } #Sorting Hash Table my @keys = sort { $words{$b} <=> $words{$a} or "\L$a" cmp "\L$b" } keys %words; #Starting Statistical Work my $value_count = 0; my $key_count = 0; #Printing Hash Table $key_count = keys %words; foreach my $key (@keys) { $value_count = $words{$key} + $value_count; printf "%-20s %6d\n", $key, $words{$key}; } my $value_average = $value_count / $key_count; #my @topwords; #foreach my $key (@keys){ #if($words{$key} > $value_average){ # @topwords = keys %words; # } #} print "\n", "The number of values: ", $value_count, "\n"; print "The number of elements: ", $key_count, "\n"; print "The Average: ", $value_average, "\n\n";

    Read the article

  • Modify audio pitch of recorded clip (m4v)

    - by devcube
    I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

    Read the article

  • whats wrong with this php mysql_real_escape_string

    - by skyhigh
    Hi Atomic Number Latin English Abbreviation * check the variables for content */ /*** a list of filters ***/ $filters = array( 'searchtext' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string'), 'fieldname' => array( 'filter' => FILTER_CALLBACK, 'options' => 'mysql_real_escape_string') ); /*** escape all POST variables ***/ $input = filter_input_array(INPUT_POST, $filters); /*** check the values are not empty ***/ if(empty($input['fieldname']) || empty($input['searchtext'])) { echo 'Invalid search'; } else { /*** mysql hostname ***/ $hostname = 'localhost'; /*** mysql username ***/ $username = 'username'; /*** mysql password ***/ $password = 'password'; /*** mysql database name ***/ $dbname = 'periodic_table'; /*** connect to the database ***/ $link = @mysql_connect($hostname, $username, $password); /*** check if the link is a valid resource ***/ if(is_resource($link)) { /*** select the database we wish to use ***/ if(mysql_select_db($dbname, $link) === TRUE) { /*** sql to SELECT information***/ $sql = sprintf("SELECT * FROM elements WHERE %s = '%s'", $input['fieldname'], $input['searchtext']); /*** echo the sql query ***/ echo '<h3>'.$sql.'</h3>'; /*** run the query ***/ $result = mysql_query($sql); /*** check if the result is a valid resource ***/ if(is_resource($result)) { /*** check if we have more than zero rows ***/ if(mysql_num_rows($result) !== 0) { echo '<table>'; while($row=mysql_fetch_array($result)) { echo '<tr> <td>'.$row['atomicnumber'].'</td> <td>'.$row['latin'].'</td> <td>'.$row['english'].'</td> <td>'.$row['abbr'].'</td> </tr>'; } echo '</table>'; } else { /*** if zero results are found.. ***/ echo 'Zero results found'; } } else { /*** if the resource is not valid ***/ 'No valid resource found'; } } /*** if we are unable to select the database show an error ****/ else { echo 'Unable to select database '.$dbname; } /*** close the connection ***/ mysql_close($link); } else { /*** if we fail to connect ***/ echo 'Unable to connect'; } } } else { echo 'Please Choose An Element'; } ? I got this code from phppro.org tutorials site and i tried to run it. It gives Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: A link to the server could not be established. .... Warning: mysql_real_escape_string() [function.mysql-real-escape-string]: Access denied for user 'ODBC'@'localhost' (using password: NO).... I went to php.net and look it up "Note: A MySQL connection is required before using mysql_real_escape_string() otherwise an error of level E_WARNING is generated, and FALSE is returned. If link_identifier isn't defined, the last MySQL connection is used." My questions are: 1-why they put single quotation around mysql_real_escape_string ? 2-They should establish a connection first, then use the $filter array statement with mysql_real_escape_string ?

    Read the article

  • Selecting and Populating a unFocused tab.

    - by Deyon
    I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

    Read the article

  • Perl - Calling subclass constructor from superclass (OO)

    - by Emmel
    This may turn out to be an embarrassingly stupid question, but better than potentially creating embarrassingly stupid code. :-) This is an OO design question, really. Let's say I have an object class 'Foos' that represents a set of dynamic configuration elements, which are obtained by querying a command on disk, 'mycrazyfoos -getconfig'. Let's say that there are two categories of behavior that I want 'Foos' objects to have: Existing ones: one is, query ones that exist in the command output I just mentioned (/usr/bin/mycrazyfoos -getconfig`. Make modifications to existing ones via shelling out commands. Create new ones that don't exist; new 'crazyfoos', using a complex set of /usr/bin/mycrazyfoos commands and parameters. Here I'm not really just querying, but actually running a bunch of system() commands. Affecting changes. Here's my class structure: Foos.pm package Foos, which has a new($hashref-{name = 'myfooname',) constructor that takes a 'crazyfoo NAME' and then queries the existence of that NAME to see if it already exists (by shelling out and running the mycrazyfoos command above). If that crazyfoo already exists, return a Foos::Existing object. Any changes to this object requires shelling out, running commands and getting confirmation that everything ran okay. If this is the way to go, then the new() constructor needs to have a test to see which subclass constructor to use (if that even makes sense in this context). Here are the subclasses: Foos/Existing.pm As mentioned above, this is for when a Foos object already exists. Foos/Pending.pm This is an object that will be created if, in the above, the 'crazyfoo NAME' doesn't actually exist. In this case, the new() constructor above will be checked for additional parameters, and it will go ahead and, when called using -create() shell out using system() and create a new object... possibly returning an 'Existing' one... OR As I type this out, I am realizing it is perhaps it's better to have a single: (an alternative arrangement) Foos class, that has a -new() that takes just a name -create() that takes additional creation parameters -delete(), -change() and other params that affect ones that exist; that will have to just be checked dynamically. So here we are, two main directions to go with this. I'm curious which would be the more intelligent way to go.

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Perl: Compare and edit underlying structure in hash

    - by Mahfuzur Rahman Pallab
    I have a hash of complex structure and I want to perform a search and replace. The first hash is like the following: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"], 456 => ["as", "sd", "df"] }, mno => { 987 => ["lk", "dm", "sd"] }, } and I want to iteratively search for all '123'/'456' elements, and if a match is found, I need to do a comparison of the sublayer, i.e. of ['ab','cd','ef'] and ['as','sd','df'] and in this case, keep only the one with ['ab','cd','ef']. So the output will be as follows: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"] }, mno => { 987 => ["lk", "dm", "sd"] }, } So the deletion is based on the substructure, and not index. How can it be done? Thanks for the help!! Lets assume that I will declare the values to be kept, i.e. I will keep 456 = ["ab", "cd", "ef"] based on a predeclared value of ["ab", "cd", "ef"] and delete any other instance of 456 anywhere else. The search has to be for every key. so the code will go through the hash, first taking 123 = ["xx", "yy", "zy"] and compare it against itself throughout the rest of the hash, if no match is found, do nothing. If a match is found, like in the case of 456 = ["ab", "cd", "ef"], it will compare the two, and as I have said that in case of a match the one with ["ab", "cd", "ef"] would be kept, it will keep 456 = ["ab", "cd", "ef"] and discard any other instances of 456 anywhere else in the hash, i.e. it will delete 456 = ["as", "sd", "df"] in this case.

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • What makes great software?

    - by VirtuosiMedia
    From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

    Read the article

  • How to preserve sibling element position when one sibling is absolutely positioned?

    - by Casey
    In the snippet below, the child div is normally positioned until it is :hovered , when it becomes absolutely positioned. The reasoning behind this markup is to simulate a popup style in a limited environment where I can't use a <select> (among other limitations). When child is hovered, the sibling elements jump around, which is expected, as the contents of the block have changed. But how can I preserve their positioning? That is, what CSS can I add to prevent the siblings from jumping around when child is hovered. Javascript is also not allowed, so please no answers using JS. HTML: <div class="container"> <div class="child"> <span class="d4"></span> <label><input type="radio" name="radio" value="1"/>One</label> <label><input type="radio" name="radio" value="2"/>Two</label> </div> <input type="text" name="sibling"/> <button name="sibling2">Button</button> </div> CSS: .container, .child, button { display:inline-block; } .child { vertical-align: middle; width: 35px; height: 35px; } .child:hover { background: gray; position:absolute; width: 100px; height: auto; } .child:hover > .d4 { display: none; } .child label { display:none; } .child:hover label { display: inline-block; } .d4 { background-position: -411px -1px; width: 35px; height: 35px; background-image: url("https://i.imgur.com/zkgyBOi.png"); background-repeat: no-repeat; color: transparent; display: inline-block; } Here's a fiddle: http://jsfiddle.net/cpctZ/1/

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • JButton Image Ignoring GridBagConstraints

    - by daemor
    I am working on an application and have a screen that needs to have elements (namely some custom JButtons) appear and disappear based on a user selection. However for some reason, when I add these buttons to their pane, the buttton image goes to the top corner, and leaves the text in the center, completely ignoring GridBagConstraints. I am completely stumped on this one as I have done this same exact thing dozens of times earlier in the program without any issues. Here is an image of the problem: The problem is in this method here, and occurs down towards the bottom. public void init(){ contentPane.removeAll(); // Setup jlabels JLabel countyLabel = new JLabel("County"); countyLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); JLabel measureByLabel = new JLabel("Measure By: "); measureByLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); String[] countyChoices = {"Washtenaw", "Oakland", "Livingston"}; // setup components JComboBox<String> countyCombo = new JComboBox<String>(countyChoices); // place baseComponents c.weightx = 0.5; c.weighty = 0.5; c.gridx = 0; c.gridy = 0; c.anchor = GridBagConstraints.NORTH; contentPane.add(countyLabel, c); c.gridx = 2; contentPane.add(countyCombo, c); c.gridy = 1; c.gridx = 0; contentPane.add(trenchButton, c); c.gridx = 2; contentPane.add(bedButton, c); c.gridy = 2; c.gridx = 1; contentPane.add(systemSelection, c); c.gridy = 3; c.gridx = 0; contentPane.add(lengthButton, c); c.fill = GridBagConstraints.BOTH; c.gridwidth = 4; c.gridy = 4; c.gridx = 0; contentPane.add(choicePane, c); GridBagConstraints con = new GridBagConstraints(); con.weightx = 0.5; con.weighty = 0.5; con.gridx = 0; con.gridy = 0; choicePane.add(lengthButton, c); // revalidate and repaint choicePane.revalidate(); choicePane.repaint(); contentPane.revalidate(); contentPane.repaint(); } I have tried doing this in separate methods, the button looks fine when added to the contentPane, the pane is for sure set to gridbagconstraints as I used the expression JPanel choicePane = new JPanel(new GridBagLayout()) to initialize it.

    Read the article

  • How to store result of drag and drop as a image

    - by Jimmy
    I want to take the screenshot of the result of drag and drop, but I don't know how to do. Actually, I found 2 javascript and using HTML5 such as html2canvas and canvas2image. I am now combining them together, but it's still meet some problem with the canvas2image. Please help me solve this problem if you have same experience, thank you a lot. Please help me, I've been stock here for days. Drag and drop code. <script> $(function() { $( "#draggable" ).draggable(); $( "#draggable2" ).draggable(); $( "#droppable" ).droppable({ hoverClass: "ui-state-active", drop: function( event, ui ) { $( this ) .addClass( "ui-state-highlight" ) .find( "p" ) .html( "Dropped!" ); } }); }); </script> Image generation code <script> window.onload = function() { function convertCanvas(strType) { if (strType == "JPEG") var oImg = Canvas2Image.saveAsJPEG(oCanvas, true); if (!oImg) { alert("Sorry, this browser is not capable of saving " + strType + " files!"); return false; } oImg.id = "canvasimage"; oImg.style.border = oCanvas.style.border; oCanvas.parentNode.replaceChild(oImg, oCanvas); } function convertHtml(strType) { $('body').html2canvas(); var queue = html2canvas.Parse(); var canvas = html2canvas.Renderer(queue,{elements:{length:1}}); var img = canvas.toDataURL(); convertCanvas(strType); window.open(img); } document.getElementById("html2canvasbtn").onclick = function() { convertHtml("JPEG"); } } </script> HTML code <body> <h3>Picture:</h3> <div id="draggable"> <img src='http://1.gravatar.com/avatar/1ea64135b09e00ab80fa7596fafbd340? s=50&d=identicon&r=R'> </div> <div id="draggable2"> <img src='http://0.gravatar.com/avatar/2647a7d4b4a7052d66d524701432273b?s=50&d=identicon&r=G'> </div> <div id="dCanvas"> <canvas id="droppable" width="500" height="500" style="border: 2px solid gray" class="ui-widget-header" /> </div> <input type="button" id="bGenImage" value="Generate Image" /> <div id="dOutput"></div> </body>

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Find next and previous link in a hierarchy

    - by rebellion
    I have a hierarchy with links nested in list element like this: <ul> <li><a href="#">Page 1</a> <ul> <li><a href="#">Page 1.1</a></li> <li><a href="#">Page 1.2</a> <ul> <li><a href="#">Page 1.2.1</a></li> <li><a href="#">Page 1.2.2</a></li> </ul> </li> <li><a href="#">Page 1.3</a></li> </ul> </li> <li><a href="#">Page 2</a> <ul> <li><a href="#">Page 2.1</a></li> <li><a href="#">Page 2.2</a></li> </ul> </li> <li><a href="#">Page 3</a> <ul> <li><a href="#">Page 3.1</a> <ul> <li><a href="#">Page 3.1.1</a></li> <li><a href="#">Page 3.1.2</a></li> </ul> <li><a href="#">Page 3.2</a></li> <li><a href="#">Page 3.3</a></li> <ul> <li><a href="#">Page 3.1.1</a></li> <li><a href="#">Page 3.1.2</a></li> </ul> </li> </ul> </li> </ul> Basically just a sitemap. But I want to make next and previous links with jQuery, which finds the active page you're on (probably by checking for a class), and finding the previous and next anchor element (taking no regards of the hierarchy). I've tried with next(), previous() and find() but can't seem to get it to work. What is the easiest way to get the anchor elements before and after the current one?

    Read the article

  • howto parse struct to C++ dll from C#

    - by Nerds Rule
    I am trying to call a function in a unmanaged C++ dll. It has this prototype: [DllImport("C:\\Program Files\\MySDK\\VSeries.dll", EntryPoint = "BII_Send_Index_Template_MT" )] internal unsafe static extern Int32 BII_Send_Index_Template_MT(IntPtr pUnitHandle, ref BII_Template template, Int32 option, Boolean async); BII_Template template = new BII_Template(); error_code = BII_Send_Index_Template_MT(pUnitHandle, ref template, option, false); I is how I define the BII_Template struct in C#: public unsafe struct BII_Template { public ulong id; public ulong employee_id; public ulong password; public byte sensor_version; public byte template_version; public fixed char name[16]; public byte finger; public byte admin_level; public byte schedule; public byte security_thresh; public fixed byte noise_level[18]; public byte corramb; public byte reference_x; public byte reference_y; public fixed byte ihcore[3]; public fixed byte ivcore[3]; public byte temp_xoffset; public byte temp_yoffset; public byte index; public fixed byte inphase[5500]; }; It build and when I run it the dll return error_code = "The record checksum is invalid." I assume that I am using the ref keyword in a wrong way or the size of some of the elements in the struct is wrong. ----- EDIT ------------ Here is the struct in C++: typedef struct { unsigned long id; unsigned long employee_id; unsigned long password; unsigned char sensor_version; unsigned char template_version; char name[16]; unsigned char finger; unsigned char admin_level; unsigned char schedule; unsigned char security_thresh; unsigned char noise_level[18]; unsigned char corramb ; unsigned char reference_x ; unsigned char reference_y ; unsigned char ihcore[NUM_CORE]; unsigned char ivcore[NUM_CORE]; unsigned char temp_xoffset; unsigned char temp_yoffset; unsigned char index; unsigned char inphase[PACKED_ARRAY_SIZE]; } BII_Template;

    Read the article

  • manipulate content inserted by ajax, without using the callback

    - by Cody
    I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

    Read the article

  • Why the parent page get refreshed when I click the link to open thickbox-styled form?

    - by user333205
    Hi, all: I'm using Thickbox 3.1 to show signup form. The form content comes from jquery ajax post. The jquery lib is of version 1.4.2. I placed a "signup" link into a div area, which is a part of my other large pages, and the whole content of that div area is ajax+posted from my server. To make thickbox can work in my above arangement, I have modified the thickbox code a little like that: //add thickbox to href & area elements that have a class of .thickbox function tb_init(domChunk){ $(domChunk).live('click', function(){ var t = this.title || this.name || null; var a = this.href || this.alt; var g = this.rel || false; tb_show(t,a,g); this.blur(); return false; });} This modification is the only change against the original version. Beacause the "signup" link is placed in ajaxed content, so I Use live instead of binding the click event directly. When I tested on my pc, the thickbox works well. I can see the signup form quickly, without feeling the content of the parent page(here, is the other large pages) get refreshed. But after transmiting my site files into VHost, when I click the "signup" link, the signup form get presented very slowly. The large pages get refreshed evidently, because the borwser(ie6) are reloading images from server incessantly. These images are set as background images in CSS files. I think that's because the slow connection of network. But why the parent pages get refreshed? and why the browser reloads those images one more time? Havn't those images been placed in local computer's disk? Is there one way to stop that reloadding? Because the signup form can't get displayed sometimes due to slow connection of network. To verified the question, you can access http://www.juliantec.info/track-the-source.html and click the second link in left grey area, that is the "signup" link mentioned above. Thinks!

    Read the article

  • CSS Z-Index with Gradient Background

    - by Jona
    I'm making a small webpage where the I would like the top banner with some text to remain on top, as such: HTML: <div id = "topBanner"> <h1>Some Text</h1> </div> CSS: #topBanner{ position:fixed; background-color: #CCCCCC; width: 100%; height:200px; top:0; left:0; z-index:900; background: -moz-linear-gradient(top, rgba(204,204,204,0.65) 0%, rgba(204,204,204,0.44) 32%, rgba(204,204,204,0.12) 82%, rgba(204,204,204,0) 100%); /* FF3.6+ */ background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgba(204,204,204,0.65)), color-stop(32%,rgba(204,204,204,0.44)), color-stop(82%,rgba(204,204,204,0.12)), color-stop(100%,rgba(204,204,204,0))); /* Chrome,Safari4+ */ background: -webkit-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* Chrome10+,Safari5.1+ */ background: -o-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* Opera 11.10+ */ background: -ms-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* IE10+ */ background: linear-gradient(to bottom, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* W3C */ filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#a6cccccc', endColorstr='#00cccccc',GradientType=0 ); /* IE6-9 */ } /*WebPage Header*/ h1{ font-size:3em; color:blue; text-shadow:#CCCCCC 2px 2px 2px, #000 0 -1px 2px; position: absolute; width: 570px; left:50%; right:50%; line-height:20px; margin-left: -285px; z-index:999; } The z-index works fine, except that because I'm using a gradient any time I scroll down the elements behind the banner are still visible, albeit somewhat transparent. Is there any way to make them total invisible? i.e., what I'm trying to do is make it as though the banner is a solid color, even though it's a gradient. Thanks in advance for any help!

    Read the article

  • Swapping two jQuery draggable list items not working properly (with jsFiddle example)

    - by Tony_Henrich
    The minimalist working example below swaps the two boxes when box 'one' is dragged and dropped on box 'two'. The problem is that when box 'one' is dropped, its style has 'top' & 'left' values causing it to be placed away from where it should drop. Its class includes 'ui-draggable-dragging'. It seems the top & left values are related to the amount the elements were dragged before the drop. And the dragging was 'interrupted' hence the residual 'ui-draggable-dragging' class? What am I missing to make the swap work seamlessly? full jsfiddle example here <html> <head> <script type="text/javascript" src="includes/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="includes/jquery-ui-1.8.2.custom.min.js"></script> <script type="text/javascript"> jQuery.fn.swapWith = function(to) { return this.each(function() { var copy_to = $(to).clone(true); var copy_from = $(this).clone(true); $(to).replaceWith(copy_from); $(this).replaceWith(copy_to); }); }; $(document).ready(function() { options = {revert: true}; $("li").draggable(options) $('#wrapper').droppable({ drop: function(event, ui) { $(ui.draggable).swapWith($('#two')); } }); }); </script> </head> <body> <form> <ul id="wrapper"> <li id='one'> <div style="width: 100px; height: 100px; border: 1px solid green"> one<br /></div> </li> <li id='two'> <div style="width: 110px; height: 110px; border: 1px solid red"> two<br /></div> </li> </ul> <br /> </form> </body> </html>

    Read the article

  • Emacs, C++ code completion for vectors

    - by Caglar Toklu
    Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

    Read the article

  • XML serialization options in .NET

    - by Borek
    I'm building a service that returns an XML (no SOAP, no ATOM, just plain old XML). Say that I have my domain objects already filled with data and just need to transform them to the XML format. What options do I have on .NET? Requirements: The transformation is not 1:1. Say that I have an Address property of type Address with nested properties like Line1, City, Postcode etc. This may need to result in an XML like <xaddr city="...">Line1, Postcode</xaddr>, i.e. quite different. Some XML elements/attributes are conditional, for example, if a Customer is under 18, the XML needs to contain some additional information. I only need to serialize the objects to XML, the other direction (XML to objects) is not important Some technologies, i.e. Data Contracts use .NET attributes. Other means of configuration (external XML config, buddy classes etc.) would be a plus. Here are the options as I see them as the moment. Corrections / additions will be very welcome. String concatenation - forget it, it was a joke :) Linq 2 XML - complete control but quite a lot of hand written code, would need good suite of unit tests View engines in ASP.NET MVC (or even Web Forms theoretically), the logic being in controllers. It's a question how to structure it, I can have simple rules engine in my controller(s) and one view template per each possible output, or have the decision logic directly in the template. Both have upsides and downsides. XML Serialization - I'm not sure about the flexibility here Data Contracts from WCF - not sure about the flexibility either, plus would they work in a simple ASP.NET MVC app (non-WCF service)? Are they a super-set of the standard XML serialization now? If it exists, some XML-to-object mapper. The more I think about it the more I think I'm looking for something like this but I couldn't find anything appropriate. Any comments / other options?

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

< Previous Page | 271 272 273 274 275 276 277 278 279 280 281 282  | Next Page >