Search Results

Search found 27592 results on 1104 pages for 'location specific'.

Page 28/1104 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Script to move specific user folders in Windows 7

    - by Evan M.
    Hi there. When I install Windows Vista/7, I move some of my user folders onto a new partition (i.e. Documents, Musics, Pictures, etc.). This does not include moving the whole User directory, just some of the data folders. %AppData% remains in it's default location (%SystemDrive%\Users). I'm getting tired of manually moving each of these folder's by changing their location under the properties dialog. Does anyone know of a way that I can script this to apply to the folders that I wish?

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • windows: force user to use specific network adapter

    - by Chad
    I'm looking for a configuration/hack to force a particular application or all traffic from a particular user to use a specific NIC. I have an legacy client/server app that has a "security feature" that limits connections based on IP address. I'm trying to find a way to migrate this app to a terminal server environment. The simple solution is for the development team to update the code in the application, however in this case that's not an option. I was thinking I might be able to install VMware NIC's installed for each user on the terminal server and do some type of scripting to force that user account to use a specific NIC. Anybody have any ideas on this? EDIT 1: I think I have a hack to work around my specific problem, however I'd love to hear of a more elegant solution. I got lucky in that the software reads the server IP address out of a config file. So I'm going to have to make a config file for each user and make a customer programs files for each user. Then add a VMware NIC for each user and make each server IP address reside on a different subnet. That will force the traffic for a particular user to a particular IP address, however its really messy and all the VM NIC's will slow down the terminal server. I'll setup a proof of concept Monday and let the group know how it affects performance.

    Read the article

  • Determining physical location of data on a disc

    - by Synetech
    Does anybody know of a way to find out where, physically on a CD or DVD a given piece of data would be located? I am trying to watch a DVD at the moment, and am about half-way through, but it keeps dying at a specific spot in the film, presumably because of a scratch. I have a repair kit, but I don’t know where to focus my repair because there are several scuffs and scratches on the disc and I have no way of knowing which one is causing the issue. Obviously, cleaning all of them is inadvisable because not only does it waste the consumable materials in the kit, but not all of them are a problem, and by working them, some may become unreadable. Moreover, just because I am half-way through the movie does not mean that it would be half-way from the hub to the edge for several reasons: Discs have more data towards the outer edge than the inner edge (circles are more mathematically complicated than rectangles) The disc is not completely filled up (and even if it were, the movie itself would be be using it all, there are extras and such) Because in this particular case it is a commercial DVD, it is also dual-layer which further complicates manual determination As such, I am trying to find a program that can let me identify a file (or part thereof), cluster, etc. and show me a picture of where on the CD/DVD it would be located. That way, I can look at the disc and fix any scratches that correspond to that distance from the hub. For example, the image below might indicate where on a disc a couple of files or range of clusters would be located, so by looking for anomalies in those areas (rotating as necessary), the correct one can be identified. I’m sure it can be done since at least one form of copy protection (DPM) uses it and DVD-lab Pro includes a “DVD Topology” feature to do this.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • How to get location of sprite placed on rotating circle in cocos2d android?

    - by Real_steel4819
    I am developing a game using cocos2d and i got stuck here when finding location of sprite placed on rotating circle on background, so that when i hit at certain position on circle its not getting hit at wanted position,but its going away from it and placing target there.I tried printing the position of hit on spriteMoveFinished() and ccTouchesEnded(). Its giving initial position and not rotated position. CGPoint location = CCDirector.sharedDirector().convertToGL(CGPoint.ccp(event.getX(), event.getY())); This is what i am using to get location.

    Read the article

  • How to create Large resumable download from a secured location .NET

    - by Kelvin H
    I need to preface I'm not a .NET coder at all, but to get partial functionality, I modified a technet chunkedfilefetch.aspx script that uses chunked Data Reading and writing Streamed method of doing file transfer, to get me half-way. iStream = New System.IO.FileStream(path, System.IO.FileMode.Open, _ IO.FileAccess.Read, IO.FileShare.Read) dataToRead = iStream.Length Response.ContentType = "application/octet-stream" Response.AddHeader("Content-Length", file.Length.ToString()) Response.AddHeader("Content-Disposition", "attachment; filename=" & filedownload) ' Read and send the file 16,000 bytes at a time. ' While dataToRead 0 If Response.IsClientConnected Then length = iStream.Read(buffer, 0, 16000) Response.OutputStream.Write(buffer, 0, length) Response.Flush() ReDim buffer(16000) ' Clear the buffer ' dataToRead = dataToRead - length Else ' Prevent infinite loop if user disconnects ' dataToRead = -1 End If End While This works great on files up to 2GB and is fully functioning now.. But only one problem it doesn't allow for resume. I took the original code called it fetch.aspx and pass an orderNUM through the URL. fetch.aspx&ordernum=xxxxxxx It then reads the filename/location from the database occording to the ordernumber, and chunks it out from a secured location NOT under the webroot. I need a way to make this resumable, by the nature of the internet and large files people always get disconnected and would like to resume where they left off. But any resumable articles i've read, assume the file is within the webroot.. ie. http://www.devx.com/dotnet/Article/22533/1954 Great article and works well, but I need to stream from a secured location. I'm not a .NET coder at all, at best i can do a bit of coldfusion, if anyone could help me modify a handler to do this, i would really appreciate it. Requirements: I Have a working fetch.aspx script that functions well and uses the above code snippet as a base for the streamed downloading. Download files are large 600MB and are stored in a secured location outside of the webroot. Users click on the fetch.aspx to start the download, and would therefore be clicking it again if it was to fail. If the ext is a .ASPX and the file being sent is a AVI, clicking on it would completely bypass an IHTTP handler mapped to .AVI ext, so this confuses me From what I understand the browser will read and match etag value and file modified date to determine they are talking about the same file, then a subsequent accept-range is exchanged between the browser and IIS. Since this dialog happens with IIS, we need to use a handler to intercept and respond accordingly, but clicking on the link would send it to an ASPX file which the handeler needs to be on an AVI fiel.. Also confusing me. If there is a way to request the initial HTTP request header containing etag, accept-range into the normal .ASPX file, i could read those values and if the accept-range and etag exist, start chunking at that byte value somehow? but I couldn't find a way to transfer the http request headers since they seem to get lost at the IIS level. OrderNum which is passed in the URL string is unique and could be used as the ETag Response.AddHeader("ETag", request("ordernum")) Files need to be resumable and chunked out due to size. File extensions are .AVI so a handler could be written around it. IIS 6.0 Web Server Any help would really be appreciated, i've been reading and reading and downloading code, but none of the examples given meet my situation with the original file being streamed from outside of the webroot. Please help me get a handle on these httphandlers :)

    Read the article

  • how to remove location block from $uri in nginx configuration?

    - by Jason
    I have a rewrite in my ngix conf file that works properly except it seems to include the location block as part of the $uri variable. I only want the path after the location block. My current config code is: location /cargo { try_files $uri $uri/ /cargo/index.php?_REWRITE_COMMAND=$uri&args; } Using an example url of http://localhost/cargo/testpage the redirect works, however the value of the "_REWRITE_COMMAND" parameter received by my php file is "/cargo/testpage". I need to strip off the location block and just have "testpage" as the $uri I am pretty sure there is a regex syntax to split the $uri and assign it to a new variable using $1 $2 etc, but I can't find any example to do just a variable assignment using a regex that is not part of a rewrite statement. I've been looking and trying for hours and I just can't seem to get past this last step. I also know I could just strip this out on the application code, but the reason I want to try to fix it in the nginx conf is for compatibility reasons as it also runs on Apache. I also should say that I have figured out a really hacky way to do it, but it involves an "if" statement to check for file existance and the documentation specifically says not to do it that way. -- UPDATE: ANSWERED BY theuni: The regex goes in the location block definition. one note of caution is that php handler location needs to be ABOVE this location, otherwise you will get a server error because it goes into an infinite redirect loop location ~ ^/cargo/(.*) { try_files $1 /cargo/$1/ /cargo/index.php?_REWRITE_COMMAND=$1&args; }

    Read the article

  • Launch an arbitrary application with a specific icon

    - by Camilo Martin
    I'm thinking about customizing my Windows 7's application icons, so that they all follow a specific theme (Token-like icons). This would involve using Resource Hacker (or similar) to patch each .exe. Not only this would be tiresome, but also it would require doing it again at each update of each application (nevermind that some could break just because it was tampered with). Instead, is there any way to launch an application with a specific icon? Ideally it would be something from the command-line (so I can make a shortcut), like this: launchwithicon.exe --app C:\myapp.exe --icon C:\myicon.ico Note that while it is possible to do something similar by setting the taskbar to "always combine, hide labels", I do not like this approach and instead am looking for something that works without combining the taskbar icons.

    Read the article

  • Open Google Chrome Specific Profile From Command Line Mac

    - by gradedcatfood
    I have been trying to open Google Chrome from command line but with no luck! I have tried How do I start Chrome using a specified "user profile"? My goal is to open Google Chrome with a specific profile such as "profile 1", "profile 2", or "Default" from the command line, using bash to be specific, on my Mac. UPDATE: 6/3/14 Got this to work BUT only works when opening chrome for the first time open -a Google\ Chrome --args --"profile-directory"="Profile 1" So How do you get --args to be accepted AFTER google chrome as already been launched??

    Read the article

  • How to bind Apache to specific IP and port on Windows Server 2008

    - by webworm
    I have a Windows Server 2008 R2 that I use to host various ASP.NET applications under IIS7. I would also like to run various PHP based web apps using Apache (or Apache 2). The server has three static IP addresses assigned to it and I would like to bind one of the IP addresses to Apache while using the other two IP addresses for IIS. I can use the IIS Manager to bind the specific IP addresses to IIS, but I am unaware of how to do this with Apache. Can anyone tell me how to go about binding Apache to a specific IP address and port (port 80 is what I want to use). Please note .. I am aware that PHP can run under IIS. In fact that is how I have been running my PHP web applications. However, there are so many inconsistencies and pitfalls with PHP running under IIS that I just prefer to use Apache.

    Read the article

  • Mac Screenshot of a Specific Window without Using the Mouse/Click

    - by huyqt
    Hello, I've been researching for a day or two but can't find a method to take a screenshot of a specific window (possibly the only window) open at a specific time using an Apple script. Currently I have the script execute screencapture -T1 ~/Desktop/screenshot.png But what I want is really screencapture -wx -T1 ~/Desktop/screenshot.png But when I use -wx, it waits for a mouse click on the window. Are there any utilities, built in or not, that will allow me to do this? Thank you so much! (I'm sorry if this belongs on Stack Overflow, can someone move it if it does. It kind of overlaps both super user and stack overflow.) Edit: The windows alternative that I'm looking for on a Mac is the keyboard shortcut: Alt + PrntScrn

    Read the article

  • Webstorm/PhpStorm: Select specific font from a Font Family

    - by Himanshu Pokhariya
    WebStorm/PhpStorm: How do I choose a specific font from a font family? (for the editor). Specifically, I have downloaded the Source Code Pro font. It comes with these typefaces: Extra Light, Light, Regular, Semibold, Bold. Now, I want to choose Extra Light/Light. But, when trying to select a font, Webstorm only shows me one font for the entire family. How do I make it use a specific one? If it makes a difference, I am currently using Mac OS X Mountain Lion (but I'd be interested in finding the answer to this for Windows as well)

    Read the article

  • Move flag for follow of a specific color to a folder in Outlook 2003

    - by Campo
    I have a user request to be able to create a rule that would move an email in outlook 2003 that the user flagged for follow up to a specific folder. That seemed simple enough till he requested that depending on the flag color they were to be moved to a specific folder. Issue is that in outlook 2003 that's not an option when creating a rule. I know that this is very straight forward in outlook 2007 and 2010 and using the categories feature is very convenient as it displays as a list when you right click.... Though in 2003 categories are not so convenient. as an example the user will flag for follow up as so... Red Flag for sales Blue Flag for requests Green Flag for personal They want a rule that will move all items with a red flag to the sales folder, Green flag to the requests folder and so on.... Thank you for your suggestions.

    Read the article

  • Firewall to block traffic to specific websites

    - by Ctroy
    I have recently switched from MAC to Windows Vista. I used to have LittleSnitch on Mac where I can create filters and disable browsing to other websites. I mean, I can create filters so that LittleSnitch will not send traffic to specific websites like Google Analytics etc. However, I cannot find a similar software on Windows. I tried Zone Alarm firewall, but it doesn't let you add filters to stop traffic to specific websites. Are there any software available on windows which are similar to LittleSnitch?

    Read the article

  • rsync bash script to backup specific directories nightly to remote server

    - by Janice Young
    Hello, I am looking for a rsync script that will backup specific directories from my home machine to a remote server nightly. So say: /home/me/Pictures to ssh -p 6587 [email protected]/Pictures. It would be nice if it can look for changes but im not worried so much about the changes aspect is having a script that runs at a certain time of night with cron or however. I have googled and found scripts but those scripts were specific to the operations of those creators. Any help would be happily accepted as the scripted part really throws me off. Thank you, Janice

    Read the article

  • FTP restrict user access to a specific folder

    - by Mahdi Ghiasi
    I have created a FTP Site inside IIS 7.5 panel. Now I have access to whole site using administrator username and password. Now, I want to let my friend access a specific folder of that FTP site. (for example, this path: \some\folder\accessible\) I can't create a whole new FTP Site for this purpose, since it says the port is being used by another website. How to create an account for my friend to have access to just an specific folder? P.S: I have read about User Isolation feature of IIS 7.5, but I couldn't find how to create a user just for FTP and set it to a custom path.

    Read the article

  • Varnish: User specific pages

    - by jchong0707
    I'm new to Varnish and am interested in using it to speed up my web application I wanted to know if Varnish can handle caching and serving user specific content. For example if I have a page say for example /welcome which is dynamically generated in the backend and is user specific So if User John Smith shows up to /welcome it'll show in the page itself 'Welcome John Smith' and if Bob Smith shows up to /welcome it'll show 'Welcome Bob Smith' Ideally both of those /welcome pages will be cached for each unique User, is this something Varnish can do? (is this even a good Use Case of Varnish?) Thanks!

    Read the article

  • Forward emails from specific domain in Exchange

    - by neildeadman
    Our Exchange server handles emails for @ourdomain.com (for example). We have multiple clients that will send emails to our [email protected] email address and we want to configure server-side rules that will forward emails from each client's domain to a different email address within our exchange server. For example: [email protected] sends an email to [email protected] and we forward it to [email protected] [email protected] sends an email to [email protected] and we forward it to [email protected] ...and so on. It would be nice if we can additionally stop the email arriving in the [email protected] mailbox, but that is not a specific requirement. We have a rule setup in Outlook that sort of works, but it doesn't do all from a domain only specific email addresses. It does work when Outlook is not running which is a start. I realise it would be easier to give each client a partiuclar email address and have them email straight to that rather than all use the same, but this is what I have been asked to setup.... :S

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >