Search Results

Search found 5784 results on 232 pages for 'points'.

Page 28/232 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • How to stop OpenGL from applying blending to certain content? (cocos2d/iPhone/OpenGL)

    - by RexOnRoids
    Supporting Info: I use cocos2d to draw a sprite (graph background) on the screen (z:-1). I then use cocos2d to draw lines/points (z:0) on top of the background -- and make some calls to OpenGL blending functions before the drawing to SMOOTH out the lines. Problem: The problem is that: aside from producing smooth lines/points, calling these OpenGL blending functions seems to degrade the underlying sprite (graph background). So there is a tradeoff: I can either have (Case 1) a nice background and choppy lines/points, or I can have (Case 2) nice smooth lines/points and a degraded background. But obviously I need both. The Code: I have included code of the draw() method of the CCLayer for both cases explained above. As you can see, the code producing the difference between Case 1 and Case 2 seems to be 1 or 2 lines involving OpenGL Blending. Case 1 -- MainScene.h (CCLayer): -(void)draw{ int lastPointX = 0; int lastPointY = 0; GLfloat colorMAX = 255.0f; GLfloat valR; GLfloat valG; GLfloat valB; if([self.myGraphManager ready]){ valR = (255.0f/colorMAX)*1.0f; valG = (255.0f/colorMAX)*1.0f; valB = (255.0f/colorMAX)*1.0f; NSEnumerator *enumerator = [[self.myGraphManager.currentCanvas graphPoints] objectEnumerator]; GraphPoint* object; while ((object = [enumerator nextObject])) { if(object.filled){ /*Commenting out the following two lines induces a problem of making it impossible to have smooth lines/points, but has merit in that it does not degrade the background sprite.*/ //glEnable (GL_BLEND); //glBlendFunc (GL_SRC_ALPHA, GL_ONE_MINUS_SRC_ALPHA); glHint (GL_LINE_SMOOTH_HINT, GL_DONT_CARE); glEnable (GL_LINE_SMOOTH); glLineWidth(1.5f); glColor4f(valR, valG, valB, 1.0); ccDrawLine(ccp(lastPointX, lastPointY), ccp(object.position.x, object.position.y)); lastPointX = object.position.x; lastPointY = object.position.y; glPointSize(3.0f); glEnable(GL_POINT_SMOOTH); glHint(GL_POINT_SMOOTH_HINT, GL_NICEST); ccDrawPoint(ccp(lastPointX, lastPointY)); } } } } Case 2 -- MainScene.h (CCLayer): -(void)draw{ int lastPointX = 0; int lastPointY = 0; GLfloat colorMAX = 255.0f; GLfloat valR; GLfloat valG; GLfloat valB; if([self.myGraphManager ready]){ valR = (255.0f/colorMAX)*1.0f; valG = (255.0f/colorMAX)*1.0f; valB = (255.0f/colorMAX)*1.0f; NSEnumerator *enumerator = [[self.myGraphManager.currentCanvas graphPoints] objectEnumerator]; GraphPoint* object; while ((object = [enumerator nextObject])) { if(object.filled){ /*Enabling the following two lines gives nice smooth lines/points, but has a problem in that it degrades the background sprite.*/ glEnable (GL_BLEND); glBlendFunc (GL_SRC_ALPHA, GL_ONE_MINUS_SRC_ALPHA); glHint (GL_LINE_SMOOTH_HINT, GL_DONT_CARE); glEnable (GL_LINE_SMOOTH); glLineWidth(1.5f); glColor4f(valR, valG, valB, 1.0); ccDrawLine(ccp(lastPointX, lastPointY), ccp(object.position.x, object.position.y)); lastPointX = object.position.x; lastPointY = object.position.y; glPointSize(3.0f); glEnable(GL_POINT_SMOOTH); glHint(GL_POINT_SMOOTH_HINT, GL_NICEST); ccDrawPoint(ccp(lastPointX, lastPointY)); } } } }

    Read the article

  • Fast swapping of production and staging in IIS

    - by Nathan Ridley
    I'm using IIS 7 on my own dedicated server. Let's say I have two web applications. One points to folder A, and one points to folder B. The first is used for production and the second is for staging. If I want to set up a scenario whereby I upload my aplication to staging, make sure everybody's happy, then swap the folders that each web application points at, thereby putting "staging" live and making the production environment the new staging environment, what's a good way to do this? I know Microsoft themselves use this methodology on their Azure platform and I've seen it used elsewhere too. How can I do it on my server with IIS7?

    Read the article

  • How to calibrate a HDTV that is being used as monitor?

    - by Mike
    I have a HDTV I am using as a second monitor. The first monitor, is a real computer monitor, not a TV and has a fantastic image. The second one, the HDTV has a good image, but it is a little bit blurred and has the problem you can see on the picture below, a kind of red halo around the edges. I think it has something to do with red contrast. Other colors show this problem too, specially the green. The problem is that the TV has no contrast adjustment. Instead it has something called IRE 10 points and IRE 2 points. Taking IRE 10 for example, it has 4 controls for each of the 10 points: luminosity, R, G and B. I could not find a page where I can understand what this IRE is and how should I adjust this. Can someone tell me how should I proceed to calibrate this TV for best picture? thanks for any help.

    Read the article

  • Adding a MySQL StoredProcedure causes not responding state

    - by Omie
    Hello I'm on Windows 7 ultimate 32bit + xampp 1.7.2 [MySQL v5.1.37] This is my stored procedure : delimiter // CREATE PROCEDURE updatePoints(IN parentid INT(5),IN userid INT(5)) DECLARE chpoints INT(5); BEGIN SELECT points INTO chpoints FROM quiz_challenges WHERE id = parentid; UPDATE quiz_users SET points = points + chpoints WHERE forumid=userid; END; // delimiter ; At first it was showing error 1064 while creating stored procedure. I added delimiters part and when I tried running the query from phpmyadmin, Firefox went into not responding state. After that I started Internet Explorer and tried opening my pages which use the same database, it worked fine. However, I tried opening phpmyadmin and IE went into not responding state as well. I restarted both servers. Later restarted PC. Tried again but its same behavior. So whats wrong with this tiny little code ? Am I missing something which might be causing infinite loop ? Thanks

    Read the article

  • Can you link an NTFS junction point to a directory on a Network Attached Storage?

    - by Zachary Burt
    I'm using Windows, and I want to use Dropbox to back up a folder outside my Dropbox directory. So I want to create a junction point from my target directory to my Dropbox folder. Accoding to the Wikipedia article on NTFS junction points, which the Dropbox answer links to: "Junction points can only link to directories on a local volume; junction points to remote shares are unsupported." I am looking to link to a directory on networked attached storage, which would not be a local volume, I believe. What should I do?

    Read the article

  • Adding a MySQL StoredProcedure causes not responding state

    - by Omie
    I'm on Windows 7 ultimate 32bit + xampp 1.7.2 [MySQL v5.1.37] This is my stored procedure : delimiter // CREATE PROCEDURE updatePoints(IN parentid INT(5),IN userid INT(5)) DECLARE chpoints INT(5); BEGIN SELECT points INTO chpoints FROM quiz_challenges WHERE id = parentid; UPDATE quiz_users SET points = points + chpoints WHERE forumid=userid; END; // delimiter ; At first it was showing error 1064 while creating stored procedure. I added delimiters part and when I tried running the query from phpmyadmin, Firefox went into not responding state. After that I started Internet Explorer and tried opening my pages which use the same database, it worked fine. However, I tried opening phpmyadmin and IE went into not responding state as well. I restarted both servers. Later restarted PC. Tried again but its same behavior. So whats wrong with this tiny little code ? Am I missing something which might be causing infinite loop ? Thanks

    Read the article

  • Restore Point area getting deleted

    - by PaoloFCantoni
    Hi, I'm running a multi-boot scenario (which I have been successfully on a number of machines for a number of years). I have Windows 7 (32 bit) on one partition and Windows 7 (64 bit) on another and a common data partition (which happens to store the user hives for each OS instance). For some reason, on one particular machine (a HP Pavilion notebook) the restore points get trashed after a reboot. I can create them (both manually and automatically), but after some (but not all) reboots the restore points get trashed. I have all three partitions set (on both OSs) to hold restore information. This setup has worked successfully on other machines for at least 12 months. I'm out of ideas... I DO need the restore points as I do "bleeding edge" stuff and they've saved my bacon on other machines in the past... TIA, Paolo

    Read the article

  • Blacklist a single access point of a wireless network

    - by Zr40
    At my university, one of the wireless access points is failing. When something tries to associate to the network using that access point, it deassociates the client, claiming 802.1X authentication failure. Other access points do work normally using the same credentials. The issue has been reported, but after a month it still has still not been fixed. Now, I'm looking for a way to blacklist the access point's BSSID, so the OS prefers other access points on the same SSID. How can I blacklist specific BSSIDs in either Mac OS X Snow Leopard or Windows 7?

    Read the article

  • Agile Development

    - by James Oloo Onyango
    Alot of literature has and is being written about agile developement and its surrounding philosophies. In my quest to find the best way to express the importance of agile methodologies, i have found Robert C. Martin's "A Satire Of Two Companies" to be both the most concise and thorough! Enjoy the read! Rufus Inc Project Kick Off Your name is Bob. The date is January 3, 2001, and your head still aches from the recent millennial revelry. You are sitting in a conference room with several managers and a group of your peers. You are a project team leader. Your boss is there, and he has brought along all of his team leaders. His boss called the meeting. "We have a new project to develop," says your boss's boss. Call him BB. The points in his hair are so long that they scrape the ceiling. Your boss's points are just starting to grow, but he eagerly awaits the day when he can leave Brylcream stains on the acoustic tiles. BB describes the essence of the new market they have identified and the product they want to develop to exploit this market. "We must have this new project up and working by fourth quarter October 1," BB demands. "Nothing is of higher priority, so we are cancelling your current project." The reaction in the room is stunned silence. Months of work are simply going to be thrown away. Slowly, a murmur of objection begins to circulate around the conference table.   His points give off an evil green glow as BB meets the eyes of everyone in the room. One by one, that insidious stare reduces each attendee to quivering lumps of protoplasm. It is clear that he will brook no discussion on this matter. Once silence has been restored, BB says, "We need to begin immediately. How long will it take you to do the analysis?" You raise your hand. Your boss tries to stop you, but his spitwad misses you and you are unaware of his efforts.   "Sir, we can't tell you how long the analysis will take until we have some requirements." "The requirements document won't be ready for 3 or 4 weeks," BB says, his points vibrating with frustration. "So, pretend that you have the requirements in front of you now. How long will you require for analysis?" No one breathes. Everyone looks around to see whether anyone has some idea. "If analysis goes beyond April 1, we have a problem. Can you finish the analysis by then?" Your boss visibly gathers his courage: "We'll find a way, sir!" His points grow 3 mm, and your headache increases by two Tylenol. "Good." BB smiles. "Now, how long will it take to do the design?" "Sir," you say. Your boss visibly pales. He is clearly worried that his 3 mms are at risk. "Without an analysis, it will not be possible to tell you how long design will take." BB's expression shifts beyond austere.   "PRETEND you have the analysis already!" he says, while fixing you with his vacant, beady little eyes. "How long will it take you to do the design?" Two Tylenol are not going to cut it. Your boss, in a desperate attempt to save his new growth, babbles: "Well, sir, with only six months left to complete the project, design had better take no longer than 3 months."   "I'm glad you agree, Smithers!" BB says, beaming. Your boss relaxes. He knows his points are secure. After a while, he starts lightly humming the Brylcream jingle. BB continues, "So, analysis will be complete by April 1, design will be complete by July 1, and that gives you 3 months to implement the project. This meeting is an example of how well our new consensus and empowerment policies are working. Now, get out there and start working. I'll expect to see TQM plans and QIT assignments on my desk by next week. Oh, and don't forget that your crossfunctional team meetings and reports will be needed for next month's quality audit." "Forget the Tylenol," you think to yourself as you return to your cubicle. "I need bourbon."   Visibly excited, your boss comes over to you and says, "Gosh, what a great meeting. I think we're really going to do some world shaking with this project." You nod in agreement, too disgusted to do anything else. "Oh," your boss continues, "I almost forgot." He hands you a 30-page document. "Remember that the SEI is coming to do an evaluation next week. This is the evaluation guide. You need to read through it, memorize it, and then shred it. It tells you how to answer any questions that the SEI auditors ask you. It also tells you what parts of the building you are allowed to take them to and what parts to avoid. We are determined to be a CMM level 3 organization by June!"   You and your peers start working on the analysis of the new project. This is difficult because you have no requirements. But from the 10-minute introduction given by BB on that fateful morning, you have some idea of what the product is supposed to do.   Corporate process demands that you begin by creating a use case document. You and your team begin enumerating use cases and drawing oval and stick diagrams. Philosophical debates break out among the team members. There is disagreement as to whether certain use cases should be connected with <<extends>> or <<includes>> relationships. Competing models are created, but nobody knows how to evaluate them. The debate continues, effectively paralyzing progress.   After a week, somebody finds the iceberg.com Web site, which recommends disposing entirely of <<extends>> and <<includes>> and replacing them with <<precedes>> and <<uses>>. The documents on this Web site, authored by Don Sengroiux, describes a method known as stalwart-analysis, which claims to be a step-by-step method for translating use cases into design diagrams. More competing use case models are created using this new scheme, but again, people can't agree on how to evaluate them. The thrashing continues. More and more, the use case meetings are driven by emotion rather than by reason. If it weren't for the fact that you don't have requirements, you'd be pretty upset by the lack of progress you are making. The requirements document arrives on February 15. And then again on February 20, 25, and every week thereafter. Each new version contradicts the previous one. Clearly, the marketing folks who are writing the requirements, empowered though they might be, are not finding consensus.   At the same time, several new competing use case templates have been proposed by the various team members. Each template presents its own particularly creative way of delaying progress. The debates rage on. On March 1, Prudence Putrigence, the process proctor, succeeds in integrating all the competing use case forms and templates into a single, all-encompassing form. Just the blank form is 15 pages long. She has managed to include every field that appeared on all the competing templates. She also presents a 159- page document describing how to fill out the use case form. All current use cases must be rewritten according to the new standard.   You marvel to yourself that it now requires 15 pages of fill-in-the-blank and essay questions to answer the question: What should the system do when the user presses Return? The corporate process (authored by L. E. Ott, famed author of "Holistic Analysis: A Progressive Dialectic for Software Engineers") insists that you discover all primary use cases, 87 percent of all secondary use cases, and 36.274 percent of all tertiary use cases before you can complete analysis and enter the design phase. You have no idea what a tertiary use case is. So in an attempt to meet this requirement, you try to get your use case document reviewed by the marketing department, which you hope will know what a tertiary use case is.   Unfortunately, the marketing folks are too busy with sales support to talk to you. Indeed, since the project started, you have not been able to get a single meeting with marketing, which has provided a never-ending stream of changing and contradictory requirements documents.   While one team has been spinning endlessly on the use case document, another team has been working out the domain model. Endless variations of UML documents are pouring out of this team. Every week, the model is reworked.   The team members can't decide whether to use <<interfaces>> or <<types>> in the model. A huge disagreement has been raging on the proper syntax and application of OCL. Others on the team just got back from a 5-day class on catabolism, and have been producing incredibly detailed and arcane diagrams that nobody else can fathom.   On March 27, with one week to go before analysis is to be complete, you have produced a sea of documents and diagrams but are no closer to a cogent analysis of the problem than you were on January 3. **** And then, a miracle happens.   **** On Saturday, April 1, you check your e-mail from home. You see a memo from your boss to BB. It states unequivocally that you are done with the analysis! You phone your boss and complain. "How could you have told BB that we were done with the analysis?" "Have you looked at a calendar lately?" he responds. "It's April 1!" The irony of that date does not escape you. "But we have so much more to think about. So much more to analyze! We haven't even decided whether to use <<extends>> or <<precedes>>!" "Where is your evidence that you are not done?" inquires your boss, impatiently. "Whaaa . . . ." But he cuts you off. "Analysis can go on forever; it has to be stopped at some point. And since this is the date it was scheduled to stop, it has been stopped. Now, on Monday, I want you to gather up all existing analysis materials and put them into a public folder. Release that folder to Prudence so that she can log it in the CM system by Monday afternoon. Then get busy and start designing."   As you hang up the phone, you begin to consider the benefits of keeping a bottle of bourbon in your bottom desk drawer. They threw a party to celebrate the on-time completion of the analysis phase. BB gave a colon-stirring speech on empowerment. And your boss, another 3 mm taller, congratulated his team on the incredible show of unity and teamwork. Finally, the CIO takes the stage to tell everyone that the SEI audit went very well and to thank everyone for studying and shredding the evaluation guides that were passed out. Level 3 now seems assured and will be awarded by June. (Scuttlebutt has it that managers at the level of BB and above are to receive significant bonuses once the SEI awards level 3.)   As the weeks flow by, you and your team work on the design of the system. Of course, you find that the analysis that the design is supposedly based on is flawedno, useless; no, worse than useless. But when you tell your boss that you need to go back and work some more on the analysis to shore up its weaker sections, he simply states, "The analysis phase is over. The only allowable activity is design. Now get back to it."   So, you and your team hack the design as best you can, unsure of whether the requirements have been properly analyzed. Of course, it really doesn't matter much, since the requirements document is still thrashing with weekly revisions, and the marketing department still refuses to meet with you.     The design is a nightmare. Your boss recently misread a book named The Finish Line in which the author, Mark DeThomaso, blithely suggested that design documents should be taken down to code-level detail. "If we are going to be working at that level of detail," you ask, "why don't we simply write the code instead?" "Because then you wouldn't be designing, of course. And the only allowable activity in the design phase is design!" "Besides," he continues, "we have just purchased a companywide license for Dandelion! This tool enables 'Round the Horn Engineering!' You are to transfer all design diagrams into this tool. It will automatically generate our code for us! It will also keep the design diagrams in sync with the code!" Your boss hands you a brightly colored shrinkwrapped box containing the Dandelion distribution. You accept it numbly and shuffle off to your cubicle. Twelve hours, eight crashes, one disk reformatting, and eight shots of 151 later, you finally have the tool installed on your server. You consider the week your team will lose while attending Dandelion training. Then you smile and think, "Any week I'm not here is a good week." Design diagram after design diagram is created by your team. Dandelion makes it very difficult to draw these diagrams. There are dozens and dozens of deeply nested dialog boxes with funny text fields and check boxes that must all be filled in correctly. And then there's the problem of moving classes between packages. At first, these diagram are driven from the use cases. But the requirements are changing so often that the use cases rapidly become meaningless. Debates rage about whether VISITOR or DECORATOR design patterns should be used. One developer refuses to use VISITOR in any form, claiming that it's not a properly object-oriented construct. Someone refuses to use multiple inheritance, since it is the spawn of the devil. Review meetings rapidly degenerate into debates about the meaning of object orientation, the definition of analysis versus design, or when to use aggregation versus association. Midway through the design cycle, the marketing folks announce that they have rethought the focus of the system. Their new requirements document is completely restructured. They have eliminated several major feature areas and replaced them with feature areas that they anticipate customer surveys will show to be more appropriate. You tell your boss that these changes mean that you need to reanalyze and redesign much of the system. But he says, "The analysis phase is system. But he says, "The analysis phase is over. The only allowable activity is design. Now get back to it."   You suggest that it might be better to create a simple prototype to show to the marketing folks and even some potential customers. But your boss says, "The analysis phase is over. The only allowable activity is design. Now get back to it." Hack, hack, hack, hack. You try to create some kind of a design document that might reflect the new requirements documents. However, the revolution of the requirements has not caused them to stop thrashing. Indeed, if anything, the wild oscillations of the requirements document have only increased in frequency and amplitude.   You slog your way through them.   On June 15, the Dandelion database gets corrupted. Apparently, the corruption has been progressive. Small errors in the DB accumulated over the months into bigger and bigger errors. Eventually, the CASE tool just stopped working. Of course, the slowly encroaching corruption is present on all the backups. Calls to the Dandelion technical support line go unanswered for several days. Finally, you receive a brief e-mail from Dandelion, informing you that this is a known problem and that the solution is to purchase the new version, which they promise will be ready some time next quarter, and then reenter all the diagrams by hand.   ****   Then, on July 1 another miracle happens! You are done with the design!   Rather than go to your boss and complain, you stock your middle desk drawer with some vodka.   **** They threw a party to celebrate the on-time completion of the design phase and their graduation to CMM level 3. This time, you find BB's speech so stirring that you have to use the restroom before it begins. New banners and plaques are all over your workplace. They show pictures of eagles and mountain climbers, and they talk about teamwork and empowerment. They read better after a few scotches. That reminds you that you need to clear out your file cabinet to make room for the brandy. You and your team begin to code. But you rapidly discover that the design is lacking in some significant areas. Actually, it's lacking any significance at all. You convene a design session in one of the conference rooms to try to work through some of the nastier problems. But your boss catches you at it and disbands the meeting, saying, "The design phase is over. The only allowable activity is coding. Now get back to it."   ****   The code generated by Dandelion is really hideous. It turns out that you and your team were using association and aggregation the wrong way, after all. All the generated code has to be edited to correct these flaws. Editing this code is extremely difficult because it has been instrumented with ugly comment blocks that have special syntax that Dandelion needs in order to keep the diagrams in sync with the code. If you accidentally alter one of these comments, the diagrams will be regenerated incorrectly. It turns out that "Round the Horn Engineering" requires an awful lot of effort. The more you try to keep the code compatible with Dandelion, the more errors Dandelion generates. In the end, you give up and decide to keep the diagrams up to date manually. A second later, you decide that there's no point in keeping the diagrams up to date at all. Besides, who has time?   Your boss hires a consultant to build tools to count the number of lines of code that are being produced. He puts a big thermometer graph on the wall with the number 1,000,000 on the top. Every day, he extends the red line to show how many lines have been added. Three days after the thermometer appears on the wall, your boss stops you in the hall. "That graph isn't growing quickly enough. We need to have a million lines done by October 1." "We aren't even sh-sh-sure that the proshect will require a m-million linezh," you blather. "We have to have a million lines done by October 1," your boss reiterates. His points have grown again, and the Grecian formula he uses on them creates an aura of authority and competence. "Are you sure your comment blocks are big enough?" Then, in a flash of managerial insight, he says, "I have it! I want you to institute a new policy among the engineers. No line of code is to be longer than 20 characters. Any such line must be split into two or more preferably more. All existing code needs to be reworked to this standard. That'll get our line count up!"   You decide not to tell him that this will require two unscheduled work months. You decide not to tell him anything at all. You decide that intravenous injections of pure ethanol are the only solution. You make the appropriate arrangements. Hack, hack, hack, and hack. You and your team madly code away. By August 1, your boss, frowning at the thermometer on the wall, institutes a mandatory 50-hour workweek.   Hack, hack, hack, and hack. By September 1st, the thermometer is at 1.2 million lines and your boss asks you to write a report describing why you exceeded the coding budget by 20 percent. He institutes mandatory Saturdays and demands that the project be brought back down to a million lines. You start a campaign of remerging lines. Hack, hack, hack, and hack. Tempers are flaring; people are quitting; QA is raining trouble reports down on you. Customers are demanding installation and user manuals; salespeople are demanding advance demonstrations for special customers; the requirements document is still thrashing, the marketing folks are complaining that the product isn't anything like they specified, and the liquor store won't accept your credit card anymore. Something has to give.    On September 15, BB calls a meeting. As he enters the room, his points are emitting clouds of steam. When he speaks, the bass overtones of his carefully manicured voice cause the pit of your stomach to roll over. "The QA manager has told me that this project has less than 50 percent of the required features implemented. He has also informed me that the system crashes all the time, yields wrong results, and is hideously slow. He has also complained that he cannot keep up with the continuous train of daily releases, each more buggy than the last!" He stops for a few seconds, visibly trying to compose himself. "The QA manager estimates that, at this rate of development, we won't be able to ship the product until December!" Actually, you think it's more like March, but you don't say anything. "December!" BB roars with such derision that people duck their heads as though he were pointing an assault rifle at them. "December is absolutely out of the question. Team leaders, I want new estimates on my desk in the morning. I am hereby mandating 65-hour work weeks until this project is complete. And it better be complete by November 1."   As he leaves the conference room, he is heard to mutter: "Empowermentbah!" * * * Your boss is bald; his points are mounted on BB's wall. The fluorescent lights reflecting off his pate momentarily dazzle you. "Do you have anything to drink?" he asks. Having just finished your last bottle of Boone's Farm, you pull a bottle of Thunderbird from your bookshelf and pour it into his coffee mug. "What's it going to take to get this project done? " he asks. "We need to freeze the requirements, analyze them, design them, and then implement them," you say callously. "By November 1?" your boss exclaims incredulously. "No way! Just get back to coding the damned thing." He storms out, scratching his vacant head.   A few days later, you find that your boss has been transferred to the corporate research division. Turnover has skyrocketed. Customers, informed at the last minute that their orders cannot be fulfilled on time, have begun to cancel their orders. Marketing is re-evaluating whether this product aligns with the overall goals of the company. Memos fly, heads roll, policies change, and things are, overall, pretty grim. Finally, by March, after far too many sixty-five hour weeks, a very shaky version of the software is ready. In the field, bug-discovery rates are high, and the technical support staff are at their wits' end, trying to cope with the complaints and demands of the irate customers. Nobody is happy.   In April, BB decides to buy his way out of the problem by licensing a product produced by Rupert Industries and redistributing it. The customers are mollified, the marketing folks are smug, and you are laid off.     Rupert Industries: Project Alpha   Your name is Robert. The date is January 3, 2001. The quiet hours spent with your family this holiday have left you refreshed and ready for work. You are sitting in a conference room with your team of professionals. The manager of the division called the meeting. "We have some ideas for a new project," says the division manager. Call him Russ. He is a high-strung British chap with more energy than a fusion reactor. He is ambitious and driven but understands the value of a team. Russ describes the essence of the new market opportunity the company has identified and introduces you to Jane, the marketing manager, who is responsible for defining the products that will address it. Addressing you, Jane says, "We'd like to start defining our first product offering as soon as possible. When can you and your team meet with me?" You reply, "We'll be done with the current iteration of our project this Friday. We can spare a few hours for you between now and then. After that, we'll take a few people from the team and dedicate them to you. We'll begin hiring their replacements and the new people for your team immediately." "Great," says Russ, "but I want you to understand that it is critical that we have something to exhibit at the trade show coming up this July. If we can't be there with something significant, we'll lose the opportunity."   "I understand," you reply. "I don't yet know what it is that you have in mind, but I'm sure we can have something by July. I just can't tell you what that something will be right now. In any case, you and Jane are going to have complete control over what we developers do, so you can rest assured that by July, you'll have the most important things that can be accomplished in that time ready to exhibit."   Russ nods in satisfaction. He knows how this works. Your team has always kept him advised and allowed him to steer their development. He has the utmost confidence that your team will work on the most important things first and will produce a high-quality product.   * * *   "So, Robert," says Jane at their first meeting, "How does your team feel about being split up?" "We'll miss working with each other," you answer, "but some of us were getting pretty tired of that last project and are looking forward to a change. So, what are you people cooking up?" Jane beams. "You know how much trouble our customers currently have . . ." And she spends a half hour or so describing the problem and possible solution. "OK, wait a second" you respond. "I need to be clear about this." And so you and Jane talk about how this system might work. Some of her ideas aren't fully formed. You suggest possible solutions. She likes some of them. You continue discussing.   During the discussion, as each new topic is addressed, Jane writes user story cards. Each card represents something that the new system has to do. The cards accumulate on the table and are spread out in front of you. Both you and Jane point at them, pick them up, and make notes on them as you discuss the stories. The cards are powerful mnemonic devices that you can use to represent complex ideas that are barely formed.   At the end of the meeting, you say, "OK, I've got a general idea of what you want. I'm going to talk to the team about it. I imagine they'll want to run some experiments with various database structures and presentation formats. Next time we meet, it'll be as a group, and we'll start identifying the most important features of the system."   A week later, your nascent team meets with Jane. They spread the existing user story cards out on the table and begin to get into some of the details of the system. The meeting is very dynamic. Jane presents the stories in the order of their importance. There is much discussion about each one. The developers are concerned about keeping the stories small enough to estimate and test. So they continually ask Jane to split one story into several smaller stories. Jane is concerned that each story have a clear business value and priority, so as she splits them, she makes sure that this stays true.   The stories accumulate on the table. Jane writes them, but the developers make notes on them as needed. Nobody tries to capture everything that is said; the cards are not meant to capture everything but are simply reminders of the conversation.   As the developers become more comfortable with the stories, they begin writing estimates on them. These estimates are crude and budgetary, but they give Jane an idea of what the story will cost.   At the end of the meeting, it is clear that many more stories could be discussed. It is also clear that the most important stories have been addressed and that they represent several months worth of work. Jane closes the meeting by taking the cards with her and promising to have a proposal for the first release in the morning.   * * *   The next morning, you reconvene the meeting. Jane chooses five cards and places them on the table. "According to your estimates, these cards represent about one perfect team-week's worth of work. The last iteration of the previous project managed to get one perfect team-week done in 3 real weeks. If we can get these five stories done in 3 weeks, we'll be able to demonstrate them to Russ. That will make him feel very comfortable about our progress." Jane is pushing it. The sheepish look on her face lets you know that she knows it too. You reply, "Jane, this is a new team, working on a new project. It's a bit presumptuous to expect that our velocity will be the same as the previous team's. However, I met with the team yesterday afternoon, and we all agreed that our initial velocity should, in fact, be set to one perfectweek for every 3 real-weeks. So you've lucked out on this one." "Just remember," you continue, "that the story estimates and the story velocity are very tentative at this point. We'll learn more when we plan the iteration and even more when we implement it."   Jane looks over her glasses at you as if to say "Who's the boss around here, anyway?" and then smiles and says, "Yeah, don't worry. I know the drill by now."Jane then puts 15 more cards on the table. She says, "If we can get all these cards done by the end of March, we can turn the system over to our beta test customers. And we'll get good feedback from them."   You reply, "OK, so we've got our first iteration defined, and we have the stories for the next three iterations after that. These four iterations will make our first release."   "So," says Jane, can you really do these five stories in the next 3 weeks?" "I don't know for sure, Jane," you reply. "Let's break them down into tasks and see what we get."   So Jane, you, and your team spend the next several hours taking each of the five stories that Jane chose for the first iteration and breaking them down into small tasks. The developers quickly realize that some of the tasks can be shared between stories and that other tasks have commonalities that can probably be taken advantage of. It is clear that potential designs are popping into the developers' heads. From time to time, they form little discussion knots and scribble UML diagrams on some cards.   Soon, the whiteboard is filled with the tasks that, once completed, will implement the five stories for this iteration. You start the sign-up process by saying, "OK, let's sign up for these tasks." "I'll take the initial database generation." Says Pete. "That's what I did on the last project, and this doesn't look very different. I estimate it at two of my perfect workdays." "OK, well, then, I'll take the login screen," says Joe. "Aw, darn," says Elaine, the junior member of the team, "I've never done a GUI, and kinda wanted to try that one."   "Ah, the impatience of youth," Joe says sagely, with a wink in your direction. "You can assist me with it, young Jedi." To Jane: "I think it'll take me about three of my perfect workdays."   One by one, the developers sign up for tasks and estimate them in terms of their own perfect workdays. Both you and Jane know that it is best to let the developers volunteer for tasks than to assign the tasks to them. You also know full well that you daren't challenge any of the developers' estimates. You know these people, and you trust them. You know that they are going to do the very best they can.   The developers know that they can't sign up for more perfect workdays than they finished in the last iteration they worked on. Once each developer has filled his or her schedule for the iteration, they stop signing up for tasks.   Eventually, all the developers have stopped signing up for tasks. But, of course, tasks are still left on the board.   "I was worried that that might happen," you say, "OK, there's only one thing to do, Jane. We've got too much to do in this iteration. What stories or tasks can we remove?" Jane sighs. She knows that this is the only option. Working overtime at the beginning of a project is insane, and projects where she's tried it have not fared well.   So Jane starts to remove the least-important functionality. "Well, we really don't need the login screen just yet. We can simply start the system in the logged-in state." "Rats!" cries Elaine. "I really wanted to do that." "Patience, grasshopper." says Joe. "Those who wait for the bees to leave the hive will not have lips too swollen to relish the honey." Elaine looks confused. Everyone looks confused. "So . . .," Jane continues, "I think we can also do away with . . ." And so, bit by bit, the list of tasks shrinks. Developers who lose a task sign up for one of the remaining ones.   The negotiation is not painless. Several times, Jane exhibits obvious frustration and impatience. Once, when tensions are especially high, Elaine volunteers, "I'll work extra hard to make up some of the missing time." You are about to correct her when, fortunately, Joe looks her in the eye and says, "When once you proceed down the dark path, forever will it dominate your destiny."   In the end, an iteration acceptable to Jane is reached. It's not what Jane wanted. Indeed, it is significantly less. But it's something the team feels that can be achieved in the next 3 weeks.   And, after all, it still addresses the most important things that Jane wanted in the iteration. "So, Jane," you say when things had quieted down a bit, "when can we expect acceptance tests from you?" Jane sighs. This is the other side of the coin. For every story the development team implements,   Jane must supply a suite of acceptance tests that prove that it works. And the team needs these long before the end of the iteration, since they will certainly point out differences in the way Jane and the developers imagine the system's behaviour.   "I'll get you some example test scripts today," Jane promises. "I'll add to them every day after that. You'll have the entire suite by the middle of the iteration."   * * *   The iteration begins on Monday morning with a flurry of Class, Responsibilities, Collaborators sessions. By midmorning, all the developers have assembled into pairs and are rapidly coding away. "And now, my young apprentice," Joe says to Elaine, "you shall learn the mysteries of test-first design!"   "Wow, that sounds pretty rad," Elaine replies. "How do you do it?" Joe beams. It's clear that he has been anticipating this moment. "OK, what does the code do right now?" "Huh?" replied Elaine, "It doesn't do anything at all; there is no code."   "So, consider our task; can you think of something the code should do?" "Sure," Elaine said with youthful assurance, "First, it should connect to the database." "And thereupon, what must needs be required to connecteth the database?" "You sure talk weird," laughed Elaine. "I think we'd have to get the database object from some registry and call the Connect() method. "Ah, astute young wizard. Thou perceives correctly that we requireth an object within which we can cacheth the database object." "Is 'cacheth' really a word?" "It is when I say it! So, what test can we write that we know the database registry should pass?" Elaine sighs. She knows she'll just have to play along. "We should be able to create a database object and pass it to the registry in a Store() method. And then we should be able to pull it out of the registry with a Get() method and make sure it's the same object." "Oh, well said, my prepubescent sprite!" "Hay!" "So, now, let's write a test function that proves your case." "But shouldn't we write the database object and registry object first?" "Ah, you've much to learn, my young impatient one. Just write the test first." "But it won't even compile!" "Are you sure? What if it did?" "Uh . . ." "Just write the test, Elaine. Trust me." And so Joe, Elaine, and all the other developers began to code their tasks, one test case at a time. The room in which they worked was abuzz with the conversations between the pairs. The murmur was punctuated by an occasional high five when a pair managed to finish a task or a difficult test case.   As development proceeded, the developers changed partners once or twice a day. Each developer got to see what all the others were doing, and so knowledge of the code spread generally throughout the team.   Whenever a pair finished something significant whether a whole task or simply an important part of a task they integrated what they had with the rest of the system. Thus, the code base grew daily, and integration difficulties were minimized.   The developers communicated with Jane on a daily basis. They'd go to her whenever they had a question about the functionality of the system or the interpretation of an acceptance test case.   Jane, good as her word, supplied the team with a steady stream of acceptance test scripts. The team read these carefully and thereby gained a much better understanding of what Jane expected the system to do. By the beginning of the second week, there was enough functionality to demonstrate to Jane. She watched eagerly as the demonstration passed test case after test case. "This is really cool," Jane said as the demonstration finally ended. "But this doesn't seem like one-third of the tasks. Is your velocity slower than anticipated?"   You grimace. You'd been waiting for a good time to mention this to Jane but now she was forcing the issue. "Yes, unfortunately, we are going more slowly than we had expected. The new application server we are using is turning out to be a pain to configure. Also, it takes forever to reboot, and we have to reboot it whenever we make even the slightest change to its configuration."   Jane eyes you with suspicion. The stress of last Monday's negotiations had still not entirely dissipated. She says, "And what does this mean to our schedule? We can't slip it again, we just can't. Russ will have a fit! He'll haul us all into the woodshed and ream us some new ones."   You look Jane right in the eyes. There's no pleasant way to give someone news like this. So you just blurt out, "Look, if things keep going like they're going, we're not going to be done with everything by next Friday. Now it's possible that we'll figure out a way to go faster. But, frankly, I wouldn't depend on that. You should start thinking about one or two tasks that could be removed from the iteration without ruining the demonstration for Russ. Come hell or high water, we are going to give that demonstration on Friday, and I don't think you want us to choose which tasks to omit."   "Aw forchrisakes!" Jane barely manages to stifle yelling that last word as she stalks away, shaking her head. Not for the first time, you say to yourself, "Nobody ever promised me project management would be easy." You are pretty sure it won't be the last time, either.   Actually, things went a bit better than you had hoped. The team did, in fact, have to drop one task from the iteration, but Jane had chosen wisely, and the demonstration for Russ went without a hitch. Russ was not impressed with the progress, but neither was he dismayed. He simply said, "This is pretty good. But remember, we have to be able to demonstrate this system at the trade show in July, and at this rate, it doesn't look like you'll have all that much to show." Jane, whose attitude had improved dramatically with the completion of the iteration, responded to Russ by saying, "Russ, this team is working hard, and well. When July comes around, I am confident that we'll have something significant to demonstrate. It won't be everything, and some of it may be smoke and mirrors, but we'll have something."   Painful though the last iteration was, it had calibrated your velocity numbers. The next iteration went much better. Not because your team got more done than in the last iteration but simply because the team didn't have to remove any tasks or stories in the middle of the iteration.   By the start of the fourth iteration, a natural rhythm has been established. Jane, you, and the team know exactly what to expect from one another. The team is running hard, but the pace is sustainable. You are confident that the team can keep up this pace for a year or more.   The number of surprises in the schedule diminishes to near zero; however, the number of surprises in the requirements does not. Jane and Russ frequently look over the growing system and make recommendations or changes to the existing functionality. But all parties realize that these changes take time and must be scheduled. So the changes do not cause anyone's expectations to be violated. In March, there is a major demonstration of the system to the board of directors. The system is very limited and is not yet in a form good enough to take to the trade show, but progress is steady, and the board is reasonably impressed.   The second release goes even more smoothly than the first. By now, the team has figured out a way to automate Jane's acceptance test scripts. The team has also refactored the design of the system to the point that it is really easy to add new features and change old ones. The second release was done by the end of June and was taken to the trade show. It had less in it than Jane and Russ would have liked, but it did demonstrate the most important features of the system. Although customers at the trade show noticed that certain features were missing, they were very impressed overall. You, Russ, and Jane all returned from the trade show with smiles on your faces. You all felt as though this project was a winner.   Indeed, many months later, you are contacted by Rufus Inc. That company had been working on a system like this for its internal operations. Rufus has canceled the development of that system after a death-march project and is negotiating to license your technology for its environment.   Indeed, things are looking up!

    Read the article

  • 2D Procedural Terrain with box2d Assets

    - by Alex
    I'm making a game that invloves a tire moving through terrain that is generated randomly over 1000 points. The terrain is always a downwards incline like so: The actual box2d terrain extends one screen width behind and infront of the circular character. I'm now at a stage where I need to add gameplay elements to the terrain such as chasms or physical objects (like the demo polygon in the picture) and am not sure of the best way to structure the procedural generation of the terrain and objects. I currently have a very simple for loop like so: for(int i = 0; i < kMaxHillPoints; i++) { hillKeyPoints[i] = CGPointMake(terrainX, terrainY); if(i%50 == 0) { i += [self generateCasmAtIndex:i]; } terrainX += winsize.width/20; terrainY -= random() % ((int) winsize.height/20); } With the generateCasmAtIndex function add points to the hillKeyPoints array and incrementing the for loop by the required amount. If I want to generate box2d objects as well for specific terrain elements, I'll also have to keep track of the current position of the player and have some sort of array of box2d objects that need to be created at certain locations. I am not sure of an efficient way to accomplish this procedural generation of terrain elements with accompanying box2d objects. My thoughts are: 1) Have many functions for each terrain element (chasm, jump etc.) which add elements to be drawn to an array that is check on each game step - similar to what I've shown above. 2) Create an array of terrain element objects that string together and are looped over to create the terrain and generate the box2d objects. Each object would hold an array of points to be drawn and and array of accompanying box2d objects. Any help on this is much appreciated as I cannot see a 'clean' solution.

    Read the article

  • How to determine where on a path my object will be at a given point in time?

    - by Dave
    I have map and an obj that is meant to move from start to end in X amount of time. The movements are all straight lines, as curves are beyond my ability at the moment. So I am trying to get the object to move from these points, but along the way there are way points which keep it on a given path. The speed of the object is determined by how long it will take to get from start to end (based on X). This is what i have so far: //get_now() returns seconds since epoch var timepassed = get_now() - myObj[id].start; //seconds since epoch for departure var timeleft = myObj[id].end - get_now(); //seconds since epoch for arrival var journey_time = 60; //this means 60 minutes total journey time var array = [[650,250]]; //way points along the straight paths if(step == 0 || step =< array.length){ var destinationx = array[step][0]; var destinationy = array[step][1]; }else if( step == array.length){ var destinationx = 250; var destinationy = 100; } else { var destinationx = myObj[id].startx; var destinationy = myObj[id].starty; } step++; When the user logs in at any given time, the object needs to be drawn in the correct place of the path, almost as if its been travelling along the path whilst the user has not been at the PC with the available information i have above. How do I do this? Note: The camera angle in the game is a birds eye view so its a straight forward X:Y rather than isometric angles.

    Read the article

  • Distinguishing the Transport Layer from the Session Layer

    In the OSI communications model, the Session layer manages the creation and removal of the association between two communicating network end points. This can also be called a connection. A connection is maintained while the network end points are communicated between each other in a conversation or session of some unknown length of time. Some connections and sessions only need to last long enough to send a message or a piece of data in one direction. In addition, some sessions may last longer, this typically occurs when one or both of the network end points are  able to terminate it the connection. The transport layer ensures that messages/data are delivered without errors, in sequence, and with no data content losses or data content duplications. It relieves the Session Layer from any concern with the transfer of data between them and their peers. Examples: Session Layer This layer acts like a manager and asks one of its employees (Transport Layer) to move a piece of data/message from one network end-point to another. Transportation Layer This layer takes the request of the Session Layer and moves the data as insturcted, it also double checks the data for any missing or corrupted information after it has been moved. If for some reason the new data does not match the old data then the Transport player will attempt to move the data gain until the data at both locations is in sync.

    Read the article

  • What is the best way to render a 2d game map?

    - by Deukalion
    I know efficiency is key in game programming and I've had some experiences with rendering a "map" earlier but probably not in the best of ways. For a 2D TopDown game: (simply render the textures/tiles of the world, nothing else) Say, you have a map of 1000x1000 (tiles or whatever). If the tile isn't in the view of the camera, it shouldn't be rendered - it's that simple. No need to render a tile that won't be seen. But since you have 1000x1000 objects in your map, or perhaps less you probably don't want to loop through all 1000*1000 tiles just to see if they're suppose to be rendered or not. Question: What is the best way to implement this efficiency? So that it "quickly/quicker" can determine what tiles are suppose to be rendered? Also, I'm not building my game around tiles rendered with a SpriteBatch so there's no rectangles, the shapes can be different sizes and have multiple points, say a curved object of 10 points and a texture inside that shape; Question: How do you determine if this kind of objects is "inside" the View of the camera? It's easy with a 48x48 rectangle, just see if it X+Width or Y+Height is in the view of the camera. Different with multiple points. Simply put, how to manage the code and the data efficiently to not having to run through/loop through a million of objects at the same time.

    Read the article

  • Moving objects colliding when using unalligned collision avoidance (steering)

    - by James Bedford
    I'm having trouble with unaligned collision avoidance for what I think is a rare case. I have set two objects to move towards each other but with a slight offset, so one of the objects is moving slightly upwards, and one of the objects is moving slightly downwards. In my unaligned collision avoidance steering algorithm I'm finding the points on the object's forward line and the other object's forward line where these two lines are the closest. If these closest points are within a collision avoidance distance, and if the distance between them is smaller than the two radii of the two object's bounding spheres, then the objects should steer away in the appropriate direction. The problem is that for my case, the closest points on the lines are calculated to be really far away from the actual collision point. This is because the two forward lines for each object are moving away from each other as the objects pass. The problem is that because of this, no steering takes place, and the two objects partially collide. Does anyone have any suggestions as to how I can correctly calculate the point of collision? Perhaps by somehow taking into account the size of the two objects?

    Read the article

  • Adding tolerance to a point in polygon test

    - by David Gouveia
    I've been using this method which was taken from Game Coding Complete to detect whether a point is inside of a polygon. It works in almost every case, but is failing on a few edge cases, and I can't figure out the reason. For example, given a polygon with vertices at (0,0) (0,100) and (100,100), the algorithm is returning: True for any point strictly inside the polygon False for any of the vertices False for (0, 50) which lies on one of the edges of the polygon True (?) for (50,50) which is also on one of the edges of the polygon I'd actually like to relax the algorithm so that it returns true in all of these cases. In other words, it should return true for points that are strictly inside, for the vertices themselves, and for points on the edges of the polygon. If possible I'd also like to give it enough tolerance so that it always tend towards "true" in face of floating point fluctuations. For example, I have another method, that given a line segment and a point, returns the closest location on the line segment to the given point. Currently, given any point outside the polygon and one of its edges, there are cases where the result is categorized as being inside by the method above, while other points are considered outside. I'd like to give it enough tolerance so that it always returns true in this situation. The way I've currently solved the problem is an hack, which consists of using an external library to inflate the polygon by a few pixels, and performing the tests on the inflated polygon, but I'd really like to replace this with a proper solution.

    Read the article

  • Which of these URL scenarios is best for big link menus? [seo /user friendly urls]

    - by Sam
    Hi folks, a question about urls... me and a good friend of mine are exploring the possibilities of either of the three scenarios for a website where each webpage has a menusystem with about 130 links.: SCENARIO 1 the pages menu system has SHORT non-descriptive hyperlinks as well as a SHORT canonical: <a href:"design">dutch design</a> the pages canonical url points to e.g.: "design" OR SCENARIO 2 the pages menu system has SHORT non-descriptive hyperlinks wwith LONG canonical urls: <a href="design">dutch design</a> the pages canonical url points to: dutch-design-crazy-yes-but-always-honest OR SCENARIO 3 the pages menu system has LONG descriptive hyperlinks with LONG canonical urls: <a href="dutch-design-crazy-yes-but-always-honest">dutch design</a> the pages canonical url points to: dutch-design-crazy-yes-but-always-honest Currently we have scenario 2... should we progress to scenario 3? All three work fine and point via RewriteMod to the same page which is fetched underwater. Now, my question is which of these is better in terms of: userfriendlyness (page loading times, full url visible in url bar or not) seo friendlyness (proper indexing due to the urls containing descriptive relevant tags) other concerns we forgot like possible penalties for so many words in link hrefs?? Thanks very much for your suggestions: much appreciated!

    Read the article

  • Moving 2d camera in the y direction

    - by Alex
    I'm developing a simple game for the iphone and am struggling to work out the best way for the camera to follow the main character. The following picture hightlights the three main components: There are 3 components to this: Circle - the main character Green line - terrain Black background The terrain is simply made from an array of points (approx 20 points per screen width). The terrain is moved in the x direction relative to the black background in order to keep the circle in its position shown. The distance to move the terrain is simply: movex = circle.position.x - terrain.position.x with a constant to fix the circle at some distance from the left of the screen. I am struggling to determine the best way to position the terrain in the y plane keep the focus in the character. I want to move the terrain in the y direction smoothly and not fix it to the position of the circle, so the circle can move in the y plane. If I take the same approach as the x positioning, the character is fixed at a point on the screen and the terrain moves. I could sample some terrain points either side of the character and produce an average, but in my implementation this was not smooth. I thought another approach might be to create a camera 'line' that is a smooth version of the terrain line and make the camerea follow this, but I'm not sure if this is the optimum solution. Any advice is much appreciated!

    Read the article

  • Characteristics, what's the inverse of (x*(x+1))/2? [closed]

    - by Valmond
    In my game you can spend points to upgrade characteristics. Each characteristic has a formula like: A) out = in : for one point spent, one pont gained (you spend 1 point on Force so your force goes from 5 to 6) B) out = last level (starting at 1) : so the first point spent earns you 1 point, the next point spent earns you an additional 2 and so on (+3,+4,+5...) C) The inverse of B) : You need to spend 1 point to earn one, then you need to spend 2 to earn another one and so on. I have already found the formula for calculating the actual level of B when points spent = x : charac = (x*(x+1))/2 But I'd like to know what the "reverse" version of B) (usable for C) is, ie. if I have spent x points, how many have I earned if 1 spent gives 1, 1+2=3 gives 2, 1+2+3=6 gives 3 and so on. I know I can just calculate the numbers but I'd like to have the formula because its neater and so that I can stick it in an excel sheet for example... Thanks! ps. I think I have nailed it down to something like charac = sqrt( x*m +k) but then I'm stuck doing number guessing for k and m and I feel I might be wrong anyway as I get close but never hits the spot.

    Read the article

  • Using Optical Flow in EmguCV

    - by Meko
    HI. I am trying to create simple touch game using EmguCV.Should I use optical flow to determine for interaction between images on screen and with my hand ,if changes of points somewhere on screen more than 100 where the image, it means my hand is over image? But how can I track this new points? I can draw on screen here the previous points and new points but It shows on my head more points then my hand and I can not track my hands movements. void Optical_Flow_Worker(object sender, EventArgs e) { { Input_Capture.SetCaptureProperty(Emgu.CV.CvEnum.CAP_PROP.CV_CAP_PROP_POS_FRAMES, ActualFrameNumber); ActualFrame = Input_Capture.QueryFrame(); ActualGrayFrame = ActualFrame.Convert<Gray, Byte>(); NextFrame = Input_Capture.QueryFrame(); NextGrayFrame = NextFrame.Convert<Gray, Byte>(); ActualFeature = ActualGrayFrame.GoodFeaturesToTrack(500, 0.01d, 0.01, 5); ActualGrayFrame.FindCornerSubPix(ActualFeature, new System.Drawing.Size(10, 10), new System.Drawing.Size(-1, -1), new MCvTermCriteria(20, 0.3d)); OpticalFlow.PyrLK(ActualGrayFrame, NextGrayFrame, ActualFeature[0], new System.Drawing.Size(10, 10), 3, new MCvTermCriteria(20, 0.03d), out NextFeature, out Status, out TrackError); OpticalFlowFrame = new Image<Bgr, Byte>(ActualFrame.Width, ActualFrame.Height); OpticalFlowFrame = NextFrame.Copy(); for (int i = 0; i < ActualFeature[0].Length; i++) DrawFlowVectors(i); ActualFrameNumber++; pictureBox1.Image = ActualFrame.Resize(320, 400).ToBitmap() ; pictureBox3.Image = OpticalFlowFrame.Resize(320, 400).ToBitmap(); } } private void DrawFlowVectors(int i) { System.Drawing.Point p = new Point(); System.Drawing.Point q = new Point(); p.X = (int)ActualFeature[0][i].X; p.Y = (int)ActualFeature[0][i].Y; q.X = (int)NextFeature[i].X; q.Y = (int)NextFeature[i].Y; p.X = (int)(q.X + 6 * Math.Cos(angle + Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle + Math.PI / 4)); p.X = (int)(q.X + 6 * Math.Cos(angle - Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle - Math.PI / 4)); OpticalFlowFrame.Draw(new Rectangle(q.X,q.Y,1,1), new Bgr(Color.Red), 1); OpticalFlowFrame.Draw(new Rectangle(p.X, p.Y, 1, 1), new Bgr(Color.Blue), 1); }

    Read the article

  • Neural Networks in C# using NeuronDotNet

    - by kingrichard2005
    Hello, I'm testing the NeuronDotNet library for a class assignment using C#. I have a very simple console application that I'm using to test some of the code snippets provided in the manual fro the library, the goal of the assignment is to teach the program how to distinguish between random points in a square which may or may not be within a circle that is also inside the square. So basically, which points inside the square are also inside the circle. Here is what I have so far: namespace _469_A7 { class Program { static void Main(string[] args) { //Initlaize the backpropogation network LinearLayer inputLayer = new LinearLayer(2); SigmoidLayer hiddenLayer = new SigmoidLayer(8); SigmoidLayer outputLayer = new SigmoidLayer(2); new BackpropagationConnector(inputLayer, hiddenLayer); new BackpropagationConnector(hiddenLayer, outputLayer); BackpropagationNetwork network = new BackpropagationNetwork(inputLayer, outputLayer); //Generate a training set for the ANN TrainingSet trainingSet = new TrainingSet(2, 2); //TEST: Generate random set of points and add to training set, //for testing purposes start with 10 samples; Point p; Program program = new Program(); //Used to access randdouble function Random rand = new Random(); for(int i = 0; i < 10; i++) { //These points will be within the circle radius Type A if(rand.NextDouble() > 0.5) { p = new Point(rand.NextDouble(), rand.NextDouble()); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 1, 0 })); continue; } //These points will either be on the border or outside the circle Type B p = new Point(program.randdouble(1.0, 4.0), program.randdouble(1.0, 4.0)); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 0, 1 })); } //Start network learning network.Learn(trainingSet, 100); //Stop network learning //network.StopLearning(); } //generates a psuedo-random double between min and max public double randdouble(double min, double max) { Random rand = new Random(); if (min > max) { return rand.NextDouble() * (min - max) + max; } else { return rand.NextDouble() * (max - min) + min; } } } //Class defines a point in X/Y coordinates public class Point { private double X; private double Y; public Point(double xVal, double yVal) { this.X = xVal; this.Y = yVal; } public double getX() { return X; } public double getY() { return Y; } } } This is basically all that I need, the only question I have is how to handle output?? More specifically, I need to output the value of the "step size" and the momentum, although it would be nice to output other information as well. Anyone with experience using NeuronDotNet, your input is appreciated.

    Read the article

  • Vector math, finding coördinates on a planar between 2 vectors

    - by Will Kru
    I am trying to generate a 3d tube along a spline. I have the coördinates of the spline (x1,y1,z1 - x2,y2,z2 - etc) which you can see in the illustration in yellow. At those points I need to generate circles, whose vertices are to be connected at a later stadium. The circles need to be perpendicular to the 'corners' of two line segments of the spline to form a correct tube. Note that the segments are kept low for illustration purpose. [apparently I'm not allowed to post images so please view the image at this link] http://img191.imageshack.us/img191/6863/18720019.jpg I am as far as being able to calculate the vertices of each ring at each point of the spline, but they are all on the same planar ie same angled. I need them to be rotated according to their 'legs' (which A & B are to C for instance). I've been thinking this over and thought of the following: two line segments can be seen as 2 vectors (in illustration A & B) the corner (in illustraton C) is where a ring of vertices need to be calculated I need to find the planar on which all of the vertices will reside I then can use this planar (=vector?) to calculate new vectors from the center point, which is C and find their x,y,z using radius * sin and cos However, I'm really confused on the math part of this. I read about the dot product but that returns a scalar which I don't know how to apply in this case. Can someone point me into the right direction? [edit] To give a bit more info on the situation: I need to construct a buffer of floats, which -in groups of 3- describe vertex positions and will be connected by OpenGL ES, given another buffer with indices to form polygons. To give shape to the tube, I first created an array of floats, which -in groups of 3- describe control points in 3d space. Then along with a variable for segment density, I pass these control points to a function that uses these control points to create a CatmullRom spline and returns this in the form of another array of floats which -again in groups of 3- describe vertices of the catmull rom spline. On each of these vertices, I want to create a ring of vertices which also can differ in density (amount of smoothness / vertices per ring). All former vertices (control points and those that describe the catmull rom spline) are discarded. Only the vertices that form the tube rings will be passed to OpenGL, which in turn will connect those to form the final tube. I am as far as being able to create the catmullrom spline, and create rings at the position of its vertices, however, they are all on a planars that are in the same angle, instead of following the splines path. [/edit] Thanks!

    Read the article

  • Rotation Matrix calculates by column not by row

    - by pinnacler
    I have a class called forest and a property called fixedPositions that stores 100 points (x,y) and they are stored 250x2 (rows x columns) in MatLab. When I select 'fixedPositions', I can click scatter and it will plot the points. Now, I want to rotate the plotted points and I have a rotation matrix that will allow me to do that. The below code should work: theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; But it wont. I get this error. ??? Error using == mtimes Inner matrix dimensions must agree. Error in == landmarkslandmarks.get.apparentPositions at 22 apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; When I alter forest.fixedPositions to store the variables 2x250 instead of 250x2, the above code will work, but it wont plot. I'm going to be plotting fixedPositions constantly in a simulation, so I'd prefer to leave it as it, and make the rotation work instead. Any ideas? Also, fixed positions, is the position of the xy points as if you were looking straight ahead. i.e. heading = 0. heading is set to 45, meaning I want to rotate points clockwise 45 degrees. Here is my code: classdef landmarks properties fixedPositions %# positions in a fixed coordinate system. [x, y] heading = 45; %# direction in which the robot is facing end properties (Dependent) apparentPositions end methods function obj = landmarks(numberOfTrees) %# randomly generates numberOfTrees amount of x,y coordinates and set %the array or matrix (not sure which) to fixedPositions obj.fixedPositions = 100 * rand([numberOfTrees,2]) .* sign(rand([numberOfTrees,2]) - 0.5); end function obj = set.apparentPositions(obj,~) theta = obj.heading * pi/180; [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end function apparent = get.apparentPositions(obj) %# rotate obj.positions using obj.facing to generate the output theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end end end P.S. If you change one line to this: obj.fixedPositions = 100 * rand([2,numberOfTrees]) .* sign(rand([2,numberOfTrees]) - 0.5); Everything will work fine... it just wont plot.

    Read the article

  • open layers LineString not working

    - by AlexS
    Sorry to bother you guys, but I'm stuck with his problem for half a day. I want to draw poly line in OpenLayers using LineString object, so I've copied the example from documentation. It runs ok but i can't see the line on the screen Code looks like this <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> var map; var lineLayer ; var points; var style; var polygonFeature function test() { lineLayer = new OpenLayers.Layer.Vector("Line Layer"); style = { strokeColor: '#0000ff', strokeOpacity: 1, strokeWidth: 10 }; map.addLayer(lineLayer); points = new Array(); points[0] =new OpenLayers.LonLat(-2.460181,27.333984 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; points[1] = new OpenLayers.LonLat(-3.864255,-22.5 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; var linear_ring = new OpenLayers.Geometry.LinearRing(points); polygonFeature = new OpenLayers.Feature.Vector( new OpenLayers.Geometry.Polygon([linear_ring]), null, style); lineLayer.addFeatures([polygonFeature]); alert("1"); } function initialize() { map = new OpenLayers.Map ("map_canvas", { controls:[ new OpenLayers.Control.Navigation(), new OpenLayers.Control.PanZoomBar(), new OpenLayers.Control.LayerSwitcher(), new OpenLayers.Control.Attribution()], maxExtent: new OpenLayers.Bounds(-20037508.34,-20037508.34,20037508.34,20037508.34), maxResolution: 156543.0399, numZoomLevels: 19, units: 'm', projection: new OpenLayers.Projection("EPSG:900913"), displayProjection: new OpenLayers.Projection("EPSG:4326") }); // Define the map layer // Here we use a predefined layer that will be kept up to date with URL changes layerMapnik = new OpenLayers.Layer.OSM.Mapnik("Mapnik"); map.addLayer(layerMapnik); var lonLat = new OpenLayers.LonLat(0, 0).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject()); map.zoomTo(3); map.setCenter(lonLat, 19); test(); } </head> <body onload="initialize()" > <div id="map_canvas" style="width: 828px; height: 698px"></div> I'm sure I'm missing some parameter in creation of map or something but I really can't figure which one.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Oracle WebCenter - Well Connected

    - by Brian Dirking
    800x600 Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-bidi-font-family:"Times New Roman";} An good post from Dan Elam on the state of the ECM industry (http://www.aiim.org/community/blogs/community/ECM-Vendors-go-to-War) . For those of you who don’t know Dan, he is one of the major forces in the content management industry. He founded eVisory and IMERGE Consulting, he is an AIIM Fellow and a former US Technical Expert to the International Standards Organization (ISO), and has been a driving force behind EmTag, AIIM’s Emerging Technologies Group. His post is interesting – it starts out talking about our Moveoff Documentum campaign, but then it becomes a much deeper insight into the ECM industry. Dan points out that Oracle has been making quiet strides in the ECM industry. In fact, analysts share this view Oracle, pointing out Oracle is growing greater than 20% annually while many of the big vendors are shrinking. And as Dan points out, this cements Oracle as one of the big five in the ECM space – the same week that Autonomy was removed from the Gartner Magic Quadrant for ECM. One of the key things points out is that Oracle WebCenter is well connected. WebCenter has out-of-the-box connections to key enterprise applications such as E-Business Suite, PeopleSoft, Siebel and JD Edwards. Those out-of-the-box integrations make it easy for organizations to drive content right into the places where it is needed, in the midst of business processes. At the same time, WebCenter provides composite interface capabilities to bring together two or more of these enterprise applications onto the same screen. Combine that with the capabilities of Oracle Social Network, you start to see how Oracle is providing a full platform for user engagement. But beyond those connections, WebCenter can also connect to other content management systems. It can index and search those systems from a single point of search, bringing back results in a single combined hitlist. WebCenter can also extend records management capabilities into Documentum, SharePoint, and email archiving systems. From a single console, records managers can define a series, set a retention schedule, and place holds – without having to go to each system to make these updates. Dan points out that there are some new competitive dynamics – to be sure. And it is interesting when a system can interact with another system, enforce dispositions and holds, and enable users to search and retrieve content. Oracle WebCenter is providing the infrastructure to build on, and the interfaces to drive user engagement. It’s an interesting time.

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >