Search Results

Search found 1459 results on 59 pages for 'zack the human'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 28/59 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Write easily readable XML in Python

    - by dutch
    Is there any way other than creating a method myself to write XML using python which are easily readable? xMLFile.write(xmlDom.toxml()) does create proper xml but reading them is pretty difficult. I tried toprettyxml but doesn't seem like it does much. e.g. following is what I would consider a human readable xml:

    Read the article

  • Multi language CMS?

    - by Adam
    Is there any CMS such as expression engine or wordpress that allows a user to click a button and convert all the text to another language (it would have to be human generated otherwise it has too many mistakes probably). I'd like to know if there are any good solutions out there that work for real world use, in like business company websites.

    Read the article

  • sequential minimal optimization C++

    - by Anton
    Hello. I want to implement the method of SVM. But the problem appeared in his training. It was originally planned to use SMO, but did not find ready-made libraries for C++. If there is a ready, then share it. Thank you in advance. The problem of finding an object in the picture (probably human)

    Read the article

  • Changing keyboard layout on application focus

    - by Anonymous Coward
    Hi Everyone As everybody knows the en-US Keyboard-layout is the best one for programming. So I'd like to use it in my IDEs. But since I live in a non-en-US country I need the de-CH layout for all other applications. Now I wonder if it is possible to set the layout depending to which application currently has the focus. If that is possible, can a human brain adapt to such a behaviour or is it just confusing? cheers, AC

    Read the article

  • Is it possible to edit a sound file based on frequency???

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Digital clocking systems/software? (employee clocking)

    - by Bill
    How does a digital clocking system deal with user error such as someone forgetting to clock out or someone erroneously entering their code causing them to clock someone else in/out (who might not even be on the schedule that day). Its obvious there could be issues of dishonesty, but what about human error?

    Read the article

  • Where can I find some good tutorials for C++

    - by Rob
    My friend has convinced me to start learning some C++, so my question is simple: where can I find some good tutorials for it? But please don't link me to the usual dry boring tutorials that only tells you the function syntax, I need more thorough explanations. I get sidetracked very easily, and I need tutorials that are more on a human level, that I'll not only learn from, but enjoy reading as well. So I'd appreciate any links that would help :)

    Read the article

  • How do I detect bots programatically

    - by Tom
    we have a situation where we log visits and visitors on page hits and bots are clogging up our database. We can't use captcha or other techniques like that because this is before we even ask for human input, basically we are logging page hits and we would like to only log page hits by humans. Is there a list of known bot IP out there? Does checking known bot user-agents work?

    Read the article

  • Money Transaction without using in-app purchase for iphone app

    - by Jaydevsinh Gohil
    I want to implement the payment gateway like functionality in my iphone application other than In-App Purchase feature provided by Apple. So, i have one Question regarding the application approval on Appstore that, if i will redirect user to the UIwebview for payment related functionality, then apple will reject this application for not following the human interface guideline or it will allow this. Other way i can do it by calling web-service for the transaction of money. So, again there is any chance of app rejection on AppStore. Please share your thought on this

    Read the article

  • Windows Azure and dynamic elasticity

    - by Ryan Elkins
    Is there a way do do dynamic elasticity in Windows Azure? If my workers begin to get overloaded, or queues start to get too full, or too many workers have no work to do, is there a way to dynamically add or remove workers through code or is that just done manually (requires human intervention) right now? Does anyone know of any plans to add that if its not currently available?

    Read the article

  • How should I interpret site analytics with 11 pageviews in an 3 second visit?

    - by Juank
    I'm using google analytics and recently i've noticed some weird trends going on. I have a lot of visits that last mere seconds but mark several page views... more than a normal human can see in that range of time. A specific case is that the only visitor from Ireland i've had until now recorded 11 pageviews in a 3 second visit. Are these crawlers? Shouldn't google analytics filter those out?

    Read the article

  • How to access the database when developing on a phone?

    - by Pentium10
    I am having trouble accessing the database while I am developing on the phone. Whenever I execute cd /data/data/com.mycompck/databases then if I try to run ls I get opendir failed, Permission denied Or whenever I type in: sqlite3 I get sqlite3: permission denied What I am doing wrong? Are there some applications that can help me getting a human view of content resolvers values and/or SQLite databases?

    Read the article

  • Java: Writing a DOM to an XML file (formatting issues)

    - by Vhaerun
    I'm using org.w3c XML API to open an existing XML file. I'm removing some nodes , and I'm adding others instead . The problem is that the new nodes that are added are written one after another , with no newline and no indentation what so ever. While it's true that the XML file is valid , it is very hard for a human to examnine it. Is there anyway to add indentation , or at least a newline after each node ?

    Read the article

  • Hashing (hidding) strings in Python

    - by Lucas
    What I need is to hash a string. It doesn't really have to be secure because its just going to be a hidden pharse in the text file (simply it doesn't have to be recognizable for a human-eye). It should not be just a random string because when user will be typing the string I would like to hash it and compare it with already hashed one (in the text file). What would be the best for this purpose? Can it be done with the own class?

    Read the article

  • PHP/regex: matching/replacing 24-hour times

    - by confusedphpnoob
    Hi, How can I take a line like this: Digital Presentation (10:45), (11:30), 12:00, 12:40, 13:20, 14:00, 14:40, 15:20, 16:00, 16:40, 17:20, 18:00, 18:40, 19:20, 20:00, 20:40, 21:20, 22:00, 22:40, 23:10, 23:40. And match all the 24 hour times so I can convert to a more human readable format using date()? Also I want to match times in the 24:00-24:59 range too Thanks!

    Read the article

  • Week in Geek: New Security Flaw Confirmed for Internet Explorer Edition

    - by Asian Angel
    This week we learned how to use a PC to stay entertained while traveling for the holidays, create quality photo prints with free software, share links between any browser and any smartphone, create perfect Christmas photos using How-To Geek’s 10 best how-to photo guides, and had fun decorating Firefox with a collection of Holiday 2010 Personas themes. Photo by Repoort. Random Geek Links Photo by Asian Angel. Critical 0-Day Flaw Affects All Internet Explorer Versions, Microsoft Warns Microsoft has confirmed a zero-day vulnerability affecting all supported versions of Internet Explorer, including IE8, IE7 and IE6. Note: Article contains link to Microsoft Security Advisory detailing two work-arounds until a security update is released. Hackers targeting human rights, indie media groups Hackers are increasingly hitting the Web sites of human rights and independent media groups in an attempt to silence them, says a new study released this week by Harvard University’s Berkman Center for Internet & Society. OpenBSD: audits give no indication of back doors So far, the analyses of OpenBSD’s crypto and IPSec code have not provided any indication that the system contains back doors for listening to encrypted VPN connections. But the developers have already found two bugs during their current audits. Sophos: Beware Facebook’s new facial-recognition feature Facebook’s new facial recognition software might result in undesirable photos of users being circulated online, warned a security expert, who urged users to keep abreast with the social network’s privacy settings to prevent the abovementioned scenario from becoming a reality. Microsoft withdraws flawed Outlook update Microsoft has withdrawn update KB2412171 for Outlook 2007, released last Patch Tuesday, after a number of user complaints. Skype: Millions still without service Skype was still working to right itself going into the holiday weekend from a major outage that began this past Wednesday. Mozilla improves sync setup and WebGL in Firefox 4 beta 8 Firefox 4.0 beta 8 brings better support for WebGL and introduces an improved setup process for Firefox Sync that simplifies the steps for configuring the synchronization service across multiple devices. Chrome OS the litmus test for cloud The success or failure of Google’s browser-oriented Chrome OS will be the litmus test to decide if the cloud is capable of addressing user needs for content and services, according to a new Ovum report released Monday. FCC Net neutrality rules reach mobile apps The Federal Communications Commission (FCC) finally released its long-expected regulations on Thursday and the related explanations total a whopping 194 pages. One new item that was not previously disclosed: mobile wireless providers can’t block “applications that compete with the provider’s” own voice or video telephony services. KDE and the Document Foundation join Open Invention Network The KDE e.V. and the Document Foundation (TDF) have both joined the Open Invention Network (OIN) as licensees, expanding the organization’s roster of supporters. Report: SEC looks into Hurd’s ousting from HP The scandal surrounding Mark Hurd’s departure from the world’s largest technology company in August has officially drawn attention from the U.S. Securities and Exchange Commission. Report: Google requests delay of new Google TVs Google TV is apparently encountering a bit of static that has resulted in a programming change. Geek Video of the Week This week we have a double dose of geeky video goodness for you with the original Mac vs PC video and the trailer for the sequel. Photo courtesy of Peacer. Mac vs PC Photo courtesy of Peacer. Mac vs PC 2 Trailer Random TinyHacker Links Awesome Tools To Extract Audio From Video Here’s a list of really useful, and free tools to rip audio from videos. Getting Your iPhone Out of Recovery Mode Is your iPhone stuck in recovery mode? This tutorial will help you get it out of that state. Google Shared Spaces Quickly create a shared space and collaborate with friends online. McAfee Internet Security 2011 – Upgrade not worthy of a version change McAfee has released their 2011 version of security products. And as this review details, the upgrades are minimal when compared to their 2010 products. For more information, check out the review. 200 Countries Plotted Hans Rosling’s famous lectures combine enormous quantities of public data with a sport’s commentator’s style to reveal the story of the world’s past, present and future development. Now he explores stats in a way he has never done before – using augmented reality animation. Super User Questions Enjoy looking through this week’s batch of popular questions and answers from Super User. How to restore windows 7 to a known working state every time it boots? Is there an easy way to mass-transfer all files between two computers? Coffee spilled inside computer, damaged hard drive Computer does not boot after ram upgrade Keyboard not detected when trying to install Ubuntu 10.10 How-To Geek Weekly Article Recap Have you had a super busy week while preparing for the holiday weekend? Then here is your chance to get caught up on your reading with our five hottest articles for the week. Ask How-To Geek: Rescuing an Infected PC, Installing Bloat-free iTunes, and Taming a Crazy Trackpad How to Use the Avira Rescue CD to Clean Your Infected PC Eight Geektacular Christmas Projects for Your Day Off VirtualBox 4.0 Rocks Extensions and a Simplified GUI Ask the Readers: How Many Monitors Do You Use with Your Computer? One Year Ago on How-To Geek Here are more great articles from one year ago for you to read and enjoy during the holiday break. Enjoy Distraction-Free Writing with WriteMonkey Shutter is a State of Art Screenshot Tool for Ubuntu Get Hex & RGB Color Codes the Easy Way Find User Scripts for Your Favorite Websites the Easy Way Access Your Unsorted Bookmarks the Easy Way (Firefox) The Geek Note That “wraps” things up for this week and we hope that everyone enjoys the rest of their holiday break! Found a great tip during the break? Then be sure to send it in to us at [email protected]. Photo by ArSiSa7. Latest Features How-To Geek ETC How to Use the Avira Rescue CD to Clean Your Infected PC The Complete List of iPad Tips, Tricks, and Tutorials Is Your Desktop Printer More Expensive Than Printing Services? 20 OS X Keyboard Shortcuts You Might Not Know HTG Explains: Which Linux File System Should You Choose? HTG Explains: Why Does Photo Paper Improve Print Quality? Simon’s Cat Explores the Christmas Tree! [Video] The Outdoor Lights Scene from National Lampoon’s Christmas Vacation [Video] The Famous Home Alone Pizza Delivery Scene [Classic Video] Chronicles of Narnia: The Voyage of the Dawn Treader Theme for Windows 7 Cardinal and Rabbit Sharing a Tree on a Cold Winter Morning Wallpaper An Alternate Star Wars Christmas Special [Video]

    Read the article

  • So, how is the Oracle HCM Cloud User Experience? In a word, smokin’!

    - by Edith Mireles-Oracle
    By Misha Vaughan, Oracle Applications User Experience Oracle unveiled its game-changing cloud user experience strategy at Oracle OpenWorld 2013 (remember that?) with a new simplified user interface (UI) paradigm.  The Oracle HCM cloud user experience is about light-weight interaction, tailored to the task you are trying to accomplish, on the device you are comfortable working with. A key theme for the Oracle user experience is being able to move from smartphone to tablet to desktop, with all of your data in the cloud. The Oracle HCM Cloud user experience provides designs for better productivity, no matter when and how your employees need to work. Release 8  Oracle recently demonstrated how fast it is moving development forward for our cloud applications, with the availability of release 8.  In release 8, users will see expanded simplicity in the HCM cloud user experience, such as filling out a time card and succession planning. Oracle has also expanded its mobile capabilities with task flows for payslips, managing absences, and advanced analytics. In addition, users will see expanded extensibility with the new structures editor for simplified pages, and the with the user interface text editor, which allows you to update language throughout the UI from one place. If you don’t like calling people who work for you “employees,” you can use this tool to create a term that is suited to your business.  Take a look yourself at what’s available now. What are people saying?Debra Lilley (@debralilley), an Oracle ACE Director who has a long history with Oracle Applications, recently gave her perspective on release 8: “Having had the privilege of seeing a preview of release 8, I am again impressed with the enhancements around simplified UI. Even more so, at a user group event in London this week, an existing Cloud HCM customer speaking publically about his implementation said he was very excited about release 8 as the absence functionality was so superior and simple to use.”  In an interview with Lilley for a blog post by Dennis Howlett  (@dahowlett), we probably couldn’t have asked for a more even-handed look at the Oracle Applications Cloud and the impact of user experience. Take the time to watch all three videos and get the full picture.  In closing, Howlett’s said: “There is always the caveat that getting from the past to Fusion [from the editor: Fusion is now called the Oracle Applications Cloud] is not quite as simple as may be painted, but the outcomes are much better than anticipated in large measure because the user experience is so much better than what went before.” Herman Slange, Technical Manager with Oracle Applications partner Profource, agrees with that comment. “We use on-premise Financials & HCM for internal use. Having a simple user interface that works on a desktop as well as a tablet for (very) non-technical users is a big relief. Coming from E-Business Suite, there is less training (none) required to access HCM content.  From a technical point of view, having the abilities to tailor the simplified UI very easy makes it very efficient for us to adjust to specific customer needs.  When we have a conversation about simplified UI, we just hand over a tablet and ask the customer to just use it. No training and no explanation required.” Finally, in a story by Computer Weekly  about Oracle customer BG Group, a natural gas exploration and production company based in the UK and with a presence in 20 countries, the author states: “The new HR platform has proved to be easier and more intuitive for HR staff to use than the previous SAP-based technology.” What’s Next for Oracle’s Applications Cloud User Experiences? This is the question that Steve Miranda, Oracle Executive Vice President, Applications Development, asks the Applications User Experience team, and we’ve been hard at work for some time now on “what’s next.”  I can’t say too much about it, but I can tell you that we’ve started talking to customers and partners, under non-disclosure agreements, about user experience concepts that we are working on in order to get their feedback. We recently had a chance to talk about possibilities for the Oracle HCM Cloud user experience at an Oracle HCM Southern California Customer Success Summit. This was a fantastic event, hosted by Shane Bliss and Vance Morossi of the Oracle Client Success Team. We got to use the uber-slick facilities of Allergan, our hosts (of Botox fame), headquartered in Irvine, Calif., with a presence in more than 100 countries. Photo by Misha Vaughan, Oracle Applications User Experience Vance Morossi, left, and Shane Bliss, of the Oracle Client Success Team, at an Oracle HCM Southern California Customer Success Summit.  We were treated to a few really excellent talks around human resources (HR). Alice White, VP Human Resources, discussed Allergan's process for global talent acquisition -- how Allergan has designed and deployed a global process, and global tools, along with Oracle and Cognizant, and are now at the end of a global implementation. She shared a couple of insights about the journey for Allergan: “One of the major areas for improvement was on role clarification within the company.” She said the company is “empowering managers and deputizing them as recruiters. Now it is a global process that is nimble and efficient."  Deepak Rammohan, VP Product Management, HCM Cloud, Oracle, also took the stage to talk about pioneering modern HR. He reflected modern HR problems of getting the right data about the workforce, the importance of getting the right talent as a key strategic initiative, and other workforce insights. "How do we design systems to deal with all of this?” he asked. “Make sure the systems are talent-centric. The next piece is collaborative, engaging, and mobile. A lot of this is influenced by what users see today. The last thing is around insight; insight at the point of decision-making." Rammohan showed off some killer HCM Cloud talent demos focused on simplicity and mobility that his team has been cooking up, and closed with a great line about the nature of modern recruiting: "Recruiting is a team sport." Deepak Rammohan, left, and Jake Kuramoto, both of Oracle, debate the merits of a Google Glass concept demo for recruiters on-the-go. Later, in an expo-style format, the Apps UX team showed several concepts for next-generation HCM Cloud user experiences, including demos shown by Jake Kuramoto (@jkuramoto) of The AppsLab, and Aylin Uysal (@aylinuysal), Director, HCM Cloud user experience. We even hauled out our eye-tracker, a research tool used to show where the eye is looking at a particular screen, thanks to teammate Michael LaDuke. Dionne Healy, HCM Client Executive, and Aylin Uysal, Director, HCM Cloud user experiences, Oracle, take a look at new HCM Cloud UX concepts. We closed the day with Jeremy Ashley (@jrwashley), VP, Applications User Experience, who brought it all back together by talking about the big picture for applications cloud user experiences. He covered the trends we are paying attention to now, what users will be expecting of their modern enterprise apps, and what Oracle’s design strategy is around these ideas.   We closed with an excellent reception hosted by ADP Payroll services at Bistango. Want to read more?Want to see where our cloud user experience is going next? Read more on the UsableApps web site about our latest design initiative: “Glance, Scan, Commit.” Or catch up on the back story by looking over our Applications Cloud user experience content on the UsableApps web site.  You can also find out where we’ll be next at the Events page on UsableApps.

    Read the article

  • Beyond Chatting: What ‘Social’ Means for CRM

    - by Natalia Rachelson
    Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} A guest post by Steve Diamond, Senior Director, Outbound Product Management, Oracle In a recent post on this blog, my colleague Steve Boese asked three questions related to the widespread popularity and incredibly rapid growth of Facebook, Pinterest, and LinkedIn. Steve then addressed the many applications for collaborative solutions in the area of Human Capital Management. So, in turning to a conversation about Customer Relationship Management (CRM) and Sales Force Automation (SFA), let me ask you one simple question. How many sales people, particularly at business-to-business companies, consistently meet or beat their quotas in their roles by working alone, with no collaboration among fellow sales people, sales executives, employees in product groups, in service, in Legal, third-party partners, etc.? Hello? Is anybody out there? What’s that cricket noise I hear? That’s correct. Nobody! When it comes to Sales, introverts arguably have a distinct disadvantage. While it’s certainly a truism that “success” in most professional endeavors requires working with people, it’s a mandatory success factor in Sales. This fact became abundantly clear to me one early morning in the late 1990s when I joined the former Hyperion Solutions (now part of Oracle) and attended a Sales Award Ceremony. The Head of Sales at that time gave out dozens of awards – none of them to individuals and all of them to TEAMS of individuals. That’s how it works in Sales. Your colleagues help provide you with product intelligence and competitive intelligence. They help you build the best presentations, pitches, and proposals. They help you develop the most killer RFPs. They align you with the best product people to ensure you’re matching the best products for the opportunity and join you in critical meetings. They help knock the socks of your prospects in “bake off” demo’s. They bring in the best partners to either add complementary products to your opportunity or help you implement a solution. They work with you as a collective team. And so how is all this collaboration STILL typically done today? Through email. And yet we all silently or not so silently grimace about email. It’s relatively siloed. It’s painful to search. It’s difficult to align by topic. And it’s nearly impossible to re-trace meaningful and helpful conversations that occurred among a group or a team at some point in history. This is where social networking for Sales comes into play. It’s about PURPOSEFUL social networking versus chattering. What is purposeful social networking? It’s collaboration that’s built around opportunities, accounts, and contacts. It’s collaboration that delivers valuable context – on the target company, and on key competitors – just to name two examples. It’s collaboration that can scale to provide coaching for larger numbers of sales representatives, both for general purposes, and as we’ve largely discussed here, for specific ‘deals.’ And it’s collaboration that allows a team of people to collectively edit and iterate on a document like an RFP or a soon-to-be killer presentation that is maintained in a central repository, with no time wasted searching for it or worrying about version control. But lest we get carried away, let’s remember that collaboration “happens” among sales people whether there is specialized software to support it or not. The human practice of sales has not changed much in the last 80 to 90 years. Collaboration has been a mainstay during this entire time. But what social networking in general, and Oracle Social Networking in particular delivers, is the opportunity for sales teams to dramatically increase their effectiveness and efficiency – to identify and close more high quality and lucrative opportunities more quickly. For most sales organizations, this is how the game is won. To learn more please visit Oracle Social Network and Oracle Fusion Customer Relationship Management on oracle.com Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >