Search Results

Search found 9124 results on 365 pages for 'big sal'.

Page 280/365 | < Previous Page | 276 277 278 279 280 281 282 283 284 285 286 287  | Next Page >

• Some general C questions.

  - by b-gen-jack-o-neill

  Hello. I am trying to fully understand the process pro writing code in some language to execution by OS. In my case, the language would be C and the OS would be Windows. So far, I read many different articles, but I am not sure, whether I understand the process right, and I would like to ask you if you know some good articles on some subjects I couldn´t find. So, what I think I know about C (and basically other languages): C compiler itself handles only data types, basic math operations, pointers operations, and work with functions. By work with functions I mean how to pass argument to it, and how to get output from function. During compilation, function call is replaced by passing arguments to stack, and than if function is not inline, its call is replaced by some symbol for linker. Linker than find the function definition, and replace the symbol to jump adress to that function (and of course than jump back to program). If the above is generally true and I get it right, where to final .exe file actually linker saves the functions? After the main() function? And what creates the .exe header? Compiler or Linker? Now, additional capabilities of C, today known as C standart library is set of functions and the declarations of them, that other programmers wrote to extend and simplify use of C language. But these functions like printf() were (or could be?) written in different language, or assembler. And there comes my next question, can be, for example printf() function be written in pure C without use of assembler? I know this is quite big question, but I just mostly want to know, wheather I am right or not. And trust me, I read a lots of articles on the web, and I would not ask you, If I could find these infromation together on one place, in one article. Insted I must piece by piece gather informations, so I am not sure if I am right. Thanks.

  Read the article

• Google Chrome, IE problem with adjusting style before AJAX

  - by orokusaki

  When I'm using AJAX, I typically do something before each request to let the user know that they'll be waiting for a second. This is usually done by just adding an animated loading gif. When I do this, Firefox does what you'd expect and adds the gif before moving control to the next line (where the AJAX is called). In Chrome, it locks the browser and doesn't make any DOM changes at all (let alone load an image), including even changing the color of something, until the AJAX is done. This isn't just AJAX though. It's anything that holds control, and it never makes DOM changes until the control is given back to the window. Example (using jQuery): function submit_order() { $('#my_element').css('color', '#FF0000'); // Make text red before calling AJAX $.getJSON('/api/', my_callback) // Note, in IE and Chrome #my_element isn't turned red until the AJAX finishes and my_callback is run } Why does this happen, and how can I solve it? I can't use ASYNC because of the nature of the data (it would be a big mess). I experimented with using window.setTimeout(myajaxfunc, 150) after setting the style, to see if it would set the style, then do the timeout, but it appears it isn't an issue with just AJAX, but rather the control of the script in general (I think, hence the title making mention to AJAX because this is the only time I ever run into this problem). This doesn't have anything to do with it being in a function BTW.

  Read the article

• How to Create Deterministic Guids

  - by desigeek

  In our application we are creating Xml files with an attribute that has a Guid value. This value needed to be consistent between file upgrades. So even if everything else in the file changes, the guid value for the attribute should remain the same. One obvious solution was to create a static dictionary with the filename and the Guids to be used for them. Then whenever we generate the file, we look up the dictionary for the filename and use the corresponding guid. But this is not feasible coz we might scale to 100's of files and didnt want to maintain big list of guids. So another approach was to make the Guid the same based on the path of the file. Since our file paths and application directory structure are unique, the Guid should be unique for that path. So each time we run an upgrade, the file gets the same guid based on its path. I found one cool way to generate such 'Deterministic Guids' (Thanks Elton Stoneman). It basically does this: private Guid GetDeterministicGuid(string input) { //use MD5 hash to get a 16-byte hash of the string: MD5CryptoServiceProvider provider = new MD5CryptoServiceProvider(); byte[] inputBytes = Encoding.Default.GetBytes(input); byte[] hashBytes = provider.ComputeHash(inputBytes); //generate a guid from the hash: Guid hashGuid = new Guid(hashBytes); return hashGuid; } So given a string, the Guid will always be the same. Are there any other approaches or recommended ways to doing this? What are the pros or cons of that method?

  Read the article

• Product Catalog Schema design

  - by FlySwat

  I'm building a proof of concept schema for a product catalog to possibly replace a very aging and crufty one we use. In our business, we sell both physical materials and services (one time and reoccurring charges). The current catalog schema has each distinct category broken out into individual tables, while this is nicely normalized and performs well, it is fairly difficult to extend. Adding a new attribute to a particular product involves changing the table schema and backpopulating old data. An idea I've been toying with has been something along the line of a base set of entity tables in 3rd normal form, these will contain the facts that are common among ALL products. Then, I'd like to build an Attribute-Entity-Value schema that allows each entity type to be extended in a flexible way using just data and no schema changes. Finally, I'd like to denormalize this data model into materialized views for each individual entity type. This views are what the application would access. We also have many tables that contain business rules and compatibility rules. These would join against the base entity tables instead of the views. My big concerns here are: Performance - Attribute-Entity-Value schemas are flexible, but typically perform poorly, should I be concerned? More Performance - Denormalizing using materialized views may have some risks, I'm not positive on this yet. Complexity - While this schema is flexible and maintainable using just data, I worry that the complexity of the design might make future schema changes difficult. For those who have designed product catalogs for large scale enterprises, am I going down the totally wrong path? Is there any good best practice schema design reading available for product catalogs?

  Read the article

• sed/awk or other: one-liner to increment a number by 1 keeping spacing characters

  - by WizardOfOdds

  EDIT: I don't know in advance at which "column" my digits are going to be and I'd like to have a one-liner. Apparently sed doesn't do arithmetic, so maybe a one-liner solution based on awk? I've got a string: (notice the spacing) eh oh 37 and I want it to become: eh oh 36 (so I want to keep the spacing) Using awk I don't find how to do it, so far I have: echo "eh oh 37" | awk '$3>=0&&$3<=99 {$3--} {print}' But this gives: eh oh 36 (the spacing characters where lost, because the field separator is ' ') Is there a way to ask awk something like "print the output using the exact same field separators as the input had"? Then I tried yet something else, using awk's sub(..,..) method: ' sub(/[0-9][0-9]/, ...) {print}' but no cigar yet: I don't know how to reference the regexp and do arithmetic on it in the second argument (which I left with '...' for now). Then I tried with sed, but got stuck after this: echo "eh oh 37" | sed -e 's/\([0-9][0-9]\)/.../' Can I do arithmetic from sed using a reference to the matching digits and have the output not modify the number of spacing characters? Note that it's related to my question concerning Emacs and how to apply this to some (big) Emacs region (using a replace region with Emacs's shell-command-on-region) but it's not an identical question: this one is specifically about how to "keep spaces" when working with awk/sed/etc.

  Read the article

• Caching a column in a polymorphic relationship

  - by Brendon Muir

  I have content management system application that uses a polymorphic tree table as the core of its arrangement. I've come into a problem where once the tree grows quite large, and because we have quite a few different modules (about 25), just doing :include = :instance doesn't cut the mustard. Instance is the name of our polymorphic relationship. The funny part is that in most cases when I want a large list of these items, all I really want is their name from the associated table (for the purposes of an index bar for example), all the rest is in the central table. So I thought that I should probably implement some sort of column cache for the name in the central table. (Like a counter cache that rails already does). I was just wondering if a plugin exists to manage this already? If not, I was just going to add a 'name' column to the central table and because all the polymorphic models inherit off a superclass, just add a callback that pushes the name across to the central table whenever the item is created or updated. I'd then just do a big migration to populate it in the first place? Any flaws to that design? I suppose to be more flexible the column could be some kind of serialised cache where I could store other things later on if need be? Gah! :D

  Read the article

• WPF DataValidation on a DataTemplate object in an ItemsControl

  - by Matt H.

  I have two datatemplates, both very similar... here is one of them: <DataTemplate x:Key="HeadingTemplate"> <Grid x:Name="mainHeadingGrid" Margin="5,5,30,0" HorizontalAlignment="Stretch"> <Grid.ColumnDefinitions> <ColumnDefinition Width="Auto" /> <ColumnDefinition /> </Grid.ColumnDefinitions> <TextBlock Grid.Column="1" Margin="30,3,10,0" Foreground="Black" FontWeight="Bold" HorizontalAlignment="Left" TextWrapping="Wrap"> <TextBlock.Text> <MultiBinding Converter="{StaticResource myHeadingConverter}" ConverterParameter="getRNHeadingTitle" Mode="TwoWay"> <Binding Path="num"/> <Binding Path="name"/> </MultiBinding> </TextBlock.Text> </TextBlock> <TextBox Grid.Column="1" Text="{Binding Path=moreInfo}"/> </Grid> </DataTemplate> I use an selector in my ItemsControl to choose between the two, based on the object it is bound to. I want to use validation to check through all of the properties and put a big exclamation point in front of the whole datatemplate as it is displayed in the itemscontrol. how do I do this? All of the examples I've found explain how to set a ValidationRule on a specific control in the datatemplate, in that control's binding. I want to apply my validation rule to the entire template... Help! :)

  Read the article

• Modularity in Flex

  - by Fernando

  I'm working on a pretty big application for Flex/Air. We are using GraniteDS and Tide to interact with the model from our Java EE server. I've been reading about modularization and Modules in Flex. The application has already been built, and I'm figuring a way out to re-design some classes and parts. From what I've read so far, I understand a Module is a different swf which can be dynamically load. Most of the tutorials/documentation are oriented to Flash "programmers" who are using Flex or Air instead of real developers, so that makes online resources harder to get. What I can't understand - yet - is how to encapsulate ActionScript classes or MXML views under this module. I've separated some of the code into libraries. For example, the generated code from Granite is in a "server" library. But I would like to separate parts of the logic with its Moderators, Controllers and Views. Are modules the way to go? Is there a "modules for dummies" or "head first Flex Modules for programmers" like tutorial in order to get a better perspective in order to build my architecture? When to choose libraries and when to choose modules? I'm using Flex 3.5, and a migration to Flex 4 is way far into the future, so no Flex 4 answers please, thanks!

  Read the article

• Free solution for automatic updates with a .NET/C# app?

  - by a2h

  Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

  Read the article

• CSS compilers and converting IE hacks to conditional css

  - by xckpd7

  Skip to bottom for question, but first, a little context. So I have been looking into CSS compilers (like Sass & Less) for a while, and have been really interested in them, not because they help me understand anything easier (I've been doing css for a couple of years now) but rather they cut down on cruft and help me see things easier. I recently have been looking into reliably implementing inline-block (and clearfix), which require lots of extraneous code & hacks. Now according to all the authorities in the field, I shouldn't put IE hacks in the same page I do my CSS in, I should make them conditional. But for me that is a really big hassle to go through and manage all this additional code, which is why I really like things like Less. Instead of applying unsemantic classes, you specify a mixin and apply it once, and you're all set. So I guess I got a little of the track (I wanted to explain my points) but bascially, I'm at the point where these CSS compilers are very useful for me, and allow me to abstract a lot of the cruft away, and reliably apply them once and then just compile it. I would like to have a way to be able to compile IE specific styles into their own conditional files (ala Less / Sass) so I don't have to deal with managing 2 files for no reason. Does anything like a script/applcation that runs and can make underscore / star hacks apart of their own file exist?

  Read the article

• Alternative to array_shift function

  - by SoLoGHoST

  Ok, I need keys to be preserved within this array and I just want to shift the 1st element from this array. Actually I know that the first key of this array will always be 1 when I do this: // Sort it by 1st group and 1st layout. ksort($disabled_sections); foreach($disabled_sections as &$grouplayout) ksort($grouplayout); Basically I'd rather not have to ksort it in order to grab this array where the key = 1. And, honestly, I'm not a big fan of array_shift, it just takes to long IMO. Is there another way. Perhaps a way to extract the entire array where $disabled_sections[1] is found without having to do a foreach and sorting it, and array_shift. I just wanna add $disabled[1] to a different array and remove it from this array altogether. While keeping both arrays keys structured the way they are. Technically, it would even be fine to do this: $array = array(); $array = $disabled_sections[1]; But it needs to remove it from $disabled_sections. Can I use something like this approach... $array = array(); $array = $disabled_sections[1]; $disabled_sections -= $disabled_sections[1]; Is something like the above even possible?? Thanks.

  Read the article

• Finding distance to the closest point in a point cloud on an uniform grid

  - by erik

  I have a 3D grid of size AxBxC with equal distance, d, between the points in the grid. Given a number of points, what is the best way of finding the distance to the closest point for each grid point (Every grid point should contain the distance to the closest point in the point cloud) given the assumptions below? Assume that A, B and C are quite big in relation to d, giving a grid of maybe 500x500x500 and that there will be around 1 million points. Also assume that if the distance to the nearest point exceds a distance of D, we do not care about the nearest point distance, and it can safely be set to some large number (D is maybe 2 to 10 times d) Since there will be a great number of grid points and points to search from, a simple exhaustive: for each grid point: for each point: if distance between points < minDistance: minDistance = distance between points is not a good alternative. I was thinking of doing something along the lines of: create a container of size A*B*C where each element holds a container of points for each point: define indexX = round((point position x - grid min position x)/d) // same for y and z add the point to the correct index of the container for each grid point: search the container of that grid point and find the closest point if no points in container and D > 0.5d: search the 26 container indices nearest to the grid point for a closest point .. continue with next layer until a point is found or the distance to that layer is greater than D Basically: put the points in buckets and do a radial search outwards until a points is found for each grid point. Is this a good way of solving the problem, or are there better/faster ways? A solution which is good for parallelisation is preferred.

  Read the article

• feedparser fails during script run, but can't reproduce in interactive python console

  - by Rhubarb

  It's failing with this when I run eclipse or when I run my script in iPython: 'ascii' codec can't decode byte 0xe2 in position 32: ordinal not in range(128) I don't know why, but when I simply execute the feedparse.parse(url) statement using the same url, there is no error thrown. This is stumping me big time. The code is as simple as: try: d = feedparser.parse(url) except Exception, e: logging.error('Error while retrieving feed.') logging.error(e) logging.error(formatExceptionInfo(None)) logging.error(formatExceptionInfo1()) Here is the stack trace: d = feedparser.parse(url) File "C:\Python26\lib\site-packages\feedparser.py", line 2623, in parse feedparser.feed(data) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 143, in goahead k = self.parse_endtag(i) File "C:\Python26\lib\sgmllib.py", line 320, in parse_endtag self.finish_endtag(tag) File "C:\Python26\lib\sgmllib.py", line 360, in finish_endtag self.unknown_endtag(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 476, in unknown_endtag method() File "C:\Python26\lib\site-packages\feedparser.py", line 1318, in _end_content value = self.popContent('content') File "C:\Python26\lib\site-packages\feedparser.py", line 700, in popContent value = self.pop(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 641, in pop output = _resolveRelativeURIs(output, self.baseuri, self.encoding) File "C:\Python26\lib\site-packages\feedparser.py", line 1594, in _resolveRelativeURIs p.feed(htmlSource) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 138, in goahead k = self.parse_starttag(i) File "C:\Python26\lib\sgmllib.py", line 296, in parse_starttag self.finish_starttag(tag, attrs) File "C:\Python26\lib\sgmllib.py", line 338, in finish_starttag self.unknown_starttag(tag, attrs) File "C:\Python26\lib\site-packages\feedparser.py", line 1588, in unknown_starttag attrs = [(key, ((tag, key) in self.relative_uris) and self.resolveURI(value) or value) for key, value in attrs] File "C:\Python26\lib\site-packages\feedparser.py", line 1584, in resolveURI return _urljoin(self.baseuri, uri) File "C:\Python26\lib\site-packages\feedparser.py", line 286, in _urljoin return urlparse.urljoin(base, uri) File "C:\Python26\lib\urlparse.py", line 215, in urljoin params, query, fragment)) File "C:\Python26\lib\urlparse.py", line 184, in urlunparse return urlunsplit((scheme, netloc, url, query, fragment)) File "C:\Python26\lib\urlparse.py", line 192, in urlunsplit url = scheme + ':' + url File "C:\Python26\lib\encodings\cp1252.py", line 15, in decode return codecs.charmap_decode(input,errors,decoding_table)

  Read the article

• Form is submitting when the page loads

  - by RailAddict

  I have a really simple Rails app. Basically an article with comments. I want the article page to show the article, comments underneath and then a textbox to write a comment and a submit button to submit it. I got it all working except for one (big) problem. When the page loads.. example.com/article/1 a blank comment is submitted to the database. I fixed that by including "validates_presence_of :body" in the Comment model. But that results in the following image when the page loads: This is my code by the way: def show @place = Article.find(params[:id]) @comment = Article.find(params[:id]).comments.create(params[:comment]) respond_to do |format| format.html # show.html.erb format.xml { render :xml => @article } end end and <% form_for([@article, @comment]) do |f| %> <p> <%= f.label :commenter %><br /> <%= f.text_field :commenter %> </p> <p> <%= f.label :body %><br /> <%= f.text_area :body %> </p> <p> <%= f.submit "Create" %> </p> <% end %>

  Read the article

• Multimedia files written over WAN are getting truncated

  - by Dean

  I use the windows Multimedia API to create .wav files. 1. Open file with mmsioOpen 2. Creates WAVE,frm and data chunks using mmioCreateChunk 3. Write audio data using mmioWrite 4. Ascend out of the chunks using mmioAscend 5. Close file using mmioClose The file is being written into a temporary location, so after it has been closed it gets copied to another location using the CopyFile. This program is written in C++ and works great until the file it is writing resides over a WAN in a different city or country. The end result is a wav file that should be 20-30 seconds long ends up being 4 secodns long. It is always the last bit that is missing, so when you play it back it just stops before then of the recording. I initially thought that maybe I was copying the file too soon so as a test I put in a pause of 30 seconds after closing the file using Sleep(30000), but this made no difference to either it being truncated or by how much. I have modified the program to write to a file in parrallel using CreateFile and WriteFile, and the result is the same, so it is not an issue specifically with the mmio API's. Does anyone have any ideas why this is happening and if there is a work-around to it? I suspect that I may end up having the temporary location on the local drive, but this is quite a big change to the application as well as existing deployments. thanks for everyones time Dean

  Read the article

• Cannot install XML::LibXML module on Windows

  - by Deepak Konidena

  I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

  Read the article

• Where are tables in Mnesia located?

  - by Sanoj

  I try to compare Mnesia with more traditional databases. As I understand it tables in Mnesia can be located to: ram_copies - tables are stored in RAM only, so no durability as in ACID. disc_copies - tables are located on disc and a copy is located in RAM, so the table can not be bigger than the available memory? disc_only_copies - tables are located to disc only, so no caching in memory and worse performance? And the size of the table are limited to the size of dets or the table has to be fragmented. So if I want the performance of doing reads from RAM and the durability of writes to disc, then the size of the tables are very limited compared to a traditional RDBMS like MySQL or PostgreSQL. I know that Mnesia aren't meant to replace traditional RDBMS:s, but can it be used as a big RDBMS or do I have to look for another database? The server I will use is a VPS with limited amount of memory, around 512MB, but I want good database performance. Are disc_copies and the other types of tables in Mnesia so limited as I have understood?

  Read the article

• detecting pauses in a spoken word audio file using pymad, pcm, vad, etc

  - by james

  First I am going to broadly state what I'm trying to do and ask for advice. Then I will explain my current approach and ask for answers to my current problems. Problem I have an MP3 file of a person speaking. I'd like to split it up into segments roughly corresponding to a sentence or phrase. (I'd do it manually, but we are talking hours of data.) If you have advice on how to do this programatically or for some existing utilities, I'd love to hear it. (I'm aware of voice activity detection and I've looked into it a bit, but I didn't see any freely available utilities.) Current Approach I thought the simplest thing would be to scan the MP3 at certain intervals and identify places where the average volume was below some threshold. Then I would use some existing utility to cut up the mp3 at those locations. I've been playing around with pymad and I believe that I've successfully extracted the PCM (pulse code modulation) data for each frame of the mp3. Now I am stuck because I can't really seem to wrap my head around how the PCM data translates to relative volume. I'm also aware of other complicating factors like multiple channels, big endian vs little, etc. Advice on how to map a group of pcm samples to relative volume would be key. Thanks!

  Read the article

• Persisting complex data between postbacks in ASP.NET MVC

  - by Robert Wagner

  I'm developing an ASP.NET MVC 2 application that connects to some services to do data retrieval and update. The services require that I provide the original entity along with the updated entity when updating data. This is so it can do change tracking and optimistic concurrency. The services cannot be changed. My problem is that I need to somehow store the original entity between postbacks. In WebForms, I would have used ViewState, but from what I have read, that is out for MVC. The original values do not have to be tamper proof as the services treat them as untrusted. The entities would be (max) 1k and it is an intranet app. The options I have come up are: Session - Ruled out - Store the entity in the Session, but I don't like this idea as there are no plans to share session between URL - Ruled out - Data is too big HiddenField - Store the serialized entity in a hidden field, perhaps with encryption/encoding HiddenVersion - The entities have a (SQL) version field on them, which I could put into a hidden field. Then on a save I get "original" entity from the services and compare the versions, doing my own optimistic concurrency. Cookies - Like 3 or 4, but using a cookie instead of a hidden field I'm leaning towards option 4, although 3 would be simpler. Are these valid options or am I going down the wrong track? Is there a better way of doing this?

  Read the article

• Frame Showing Problem

  - by Nitz

  Hey Guys I have made one project which is showing the inventory of the stock of one store. In that inventory the software should store data of the products with their images. There is one problem... Bcz of the lots of stock, the screen on which is image is loading taking a lot of time. So, i thought i should give the frame in which there will be on label which will show the "Loading Software". But now when i am setting visible = true for that frame, but bcz of that images screen class loading problem my frame is not showing correctly. I have put screen shot, now my code. JFrame f; try{ f = new JFrame("This is a test"); f.setSize(300, 300); Container content = f.getContentPane(); content.setBackground(Color.white); content.setLayout(new FlowLayout()); JLabel jl = new JLabel(); jl.setText("Loading Please Wait...."); content.add(jl); f.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); f.setVisible(true); }catch(Exception e){ e.printStackTrace(); } initComponents(); try { addInverntory = new AddInventoryScreen(); showstock = new showStock(); // this class will take big time. mf = new mainForm(); f.setVisible(false); }catch (Exception ex) { ex.printStackTrace(); } How Can show some message that, other class is loading or "Loading Software" kind of thing in this situation. Just For the know....this class is not screen on which the image will load.

  Read the article

• Perl XML SAX parser emulating XML::Simple record for record

  - by DVK

  Short Q summary: I am looking a fast XML parser (most likely a wrapper around some standard SAX parser) which will produce per-record data structure 100% identical to those produced by XML::Simple. Details: We have a large code infrastructure which depends on processing records one-by-one and expects the record to be a data structure in a format produced by XML::Simple since it always used XML::Simple since early Jurassic era. An example simple XML is: <root> <rec><f1>v1</f1><f2>v2</f2></rec> <rec><f1>v1b</f1><f2>v2b</f2></rec> <rec><f1>v1c</f1><f2>v2c</f2></rec> </root> And example rough code is: sub process_record { my ($obj, $record_hash) = @_; # do_stuff } my $records = XML::Simple->XMLin(@args)->{root}; foreach my $record (@$records) { $obj->process_record($record) }; As everyone knows XML::Simple is, well, simple. And more importantly, it is very slow and a memory hog - due to being a DOM parser and needing to build/store 100% of data in memory. So, it's not the best tool for parsing an XML file consisting of large amount of small records record-by-record. However, re-writing the entire code (which consist of large amount of "process_record"-like methods) to work with standard SAX parser seems like an big task not worth the resources, even at the cost of living with XML::Simple. What I'm looking for is an existing module which will probably be based on a SAX parser (or anything fast with small memory footprint) which can be used to produce $record hashrefs one by one based on the XML pictured above that can be passed to $obj->process_record($record) and be 100% identical to what XML::Simple's hashrefs would have been.

  Read the article

• What are the best open-source software non-profits for making financial contributions and/or facilitating useful work?

  - by Jason S

  I'm not a great programmer myself (my main job is more electrical engineering) and have never really helped out with any open source projects, but I've benefited greatly from free and/or open-source software (MySQL, OpenOffice, Firefox, Apache, PHP, Java, etc.) and at some point would like to make some modest financial contributions to help keep this stuff going. I'm wondering, what are the best non-profits to make financial contributions? I'm aware of: Open Source Initiative (founded 10 years ago by several prominent figures including programmer and "The Cathedral and the Bazaar" author Eric S. Raymond) Free Software Foundation Mozilla Foundation Apache Foundation Anyone have a particular favorite? Ideally I'd like to give money to a non-profit that would foster some of the smaller but promising open-source and/or free software projects. The big projects like Firefox and Apache are already well-established. There are a few small individual shareware programs I've already paid for directly. But it's those middle-ground projects that I would really like my contributions to support. (one that comes to mind is a good GUI for Subversion or Mercurial.) It's one thing for a single person to donate a little $$ to a small project. It's another for a foundation or something to give larger grants to projects that give a good bang for the buck. Conservation organizations like The Nature Conservancy, or the Trust for Public Lands, have really honed this approach, but I'm not really sure if there's an equivalent model in software-land.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Creative ways to punish (or just curb) laziness in coworkers

  - by FerretallicA

  Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

  Read the article

• Where's the Win32 resource for the mouse cursor for dragging splitters?

  - by Luther Baker

  I am building a custom win32 control/widget and would like to change the cursor to a horizontal "splitter" symbol when hovering over a particular vertical line in the control. IE: I want to drag this vertical line (splitter bar) left and right (WEST and EAST). Of the the system cursors (OCR_*), the only cursor that makes sense is the OCR_SIZEWE. Unfortunately, that is the big, awkward cursor the system uses when resizing a window. Instead, I am looking for the cursor that is about 20 pixels tall and around 3 or 4 pixel wide with two small arrows pointing left and right. I can easily draw this and include it as a resource in my application but the cursor itself is so prevalent that I wanted to be sure it wasn't missing something. For example: when you use the COM drag and drop mechanism (CLSID_DragDropHelper, IDropTarget, etc) you implicitly have access to the "drag" icon (little box under the pointer). I didn't see an explicit OCR_* constant for this guy ... so likewise, if I can't find this splitter cursor outright, I am wondering if it is part of a COM object or something else in the win32 lib.

  Read the article

< Previous Page | 276 277 278 279 280 281 282 283 284 285 286 287  | Next Page >