Search Results

Search found 21947 results on 878 pages for 'static import'.

Page 280/878 | < Previous Page | 276 277 278 279 280 281 282 283 284 285 286 287  | Next Page >

  • C# Interop with dll

    - by Jim Jones
    Using VS2008 C# am attempting to interop a C++ dll. Have a C++ class constructor: make_summarizer(const char* rdir, const char* lic, const char* key); Need to retain a reference to the object that is created so I can use it in a follow-on function. When I did this in JNI the c code was: declare a static pointer to the object: static summarizer* summrzr; Then in one of the functions I called this constructor as follows: summrzr = make_summarizer(crdir, clic, ckey); Where the parameters all where the requisite const char* type; So in C# using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Runtime.InteropServices; using System.Configuration; namespace SummarizerApp { class SummApp { private IntPtr summarzr; public SummApp() { string resource_dir = ConfigurationManager.AppSettings["resource_dir"]; string license = ConfigurationManager.AppSettings["license"]; string key = ConfigurationManager.AppSettings["key"]; createSummarizer(resource_dir, license, key); } [System.Runtime.InteropServices.DllImportAttribute("lib\\summarizer37.dll", EntryPoint = "#1")] public static extern IntPtr make_summarizer( [InAttribute()][MarshalAsAttribute(UnmanagedType.LPTStr)] string rdir, [InAttribute()][MarshalAsAttribute(UnmanagedType.LPTStr)] string lic, [InAttribute()][MarshalAsAttribute(UnmanagedType.LPTStr)] string key); public void createSummarizer(string resource_dir, string license, string key) { try { this.summarzr = make_summarizer(resource_dir, license, key); } catch (AccessViolationException e) { Console.WriteLine(e.Message); Console.WriteLine(e.StackTrace); } } Have also tried using IntPtr created using Marshal.StringToHGlobalAnsi(string). Regardless I get a AccessViolationException on the line where I call the native constructor; So what am I doing wrong? Jim

    Read the article

  • run .net consolapp out of a cgi script

    - by Nico
    Hello there, i have written a simple cgi python script which looks like this #!c:/Python25/python.exe -u import cgi import os def main(): print "Content-type: text/html\n" form = cgi.FieldStorage() print form["firstname"].value os.execvp("D:\\path\\to\\my\\consolapp.exe", [""]) main() As you can se i'd like to start a consoleapp which i have written in .net. But my consoleapp crashs when i call the cgi script. So i did a little debuging and write a text file after some actions i do in my .net program. The result was that my programm crash everytime i'd like to open a access mdb file. It told me that i need the Microsoft Data Access Components (MDAC). But i cant belive this message because my .net consoleapp runs without errors if i start it from my own. So can anybody give me some advise how i can call my .net consol ab through a webscript. I'm happy for every advise So it don't have to be a solution using a cgi script. Regards, Nico

    Read the article

  • "TypeError: draw() takes exactly 1 non-keyword argument (3 given)"

    - by Amorack
    I wrote this code to open a window with Pyglet in Python... import pyglet from pyglet import window class Window(pyglet.window.Window): def __init__(self): super(Window, self).__init__() myLabel = pyglet.text.Label("Prototype") windowText = myLabel.draw(Window, "Hello World", font_name = "Times New Roman", font_size = 36, color = (193, 205, 193, 255)) def on_draw(self): self.clear() self.label.draw() if __name__ == '__main__': window = Window() pyglet.app.run() however every time I run it I get this error: TypeError: draw() takes exactly 1 non-keyword argument (3 given) AFAIK the "(3 given)" means the problem is with the font_size or color arguments but I'm not sure. Could someone explain what's wrong and help me make this work?

    Read the article

  • AttributeError while adding colorbar in matplotlib

    - by bgbg
    The following code fails to run on Python 2.5.4: from matplotlib import pylab as pl import numpy as np data = np.random.rand(6,6) fig = pl.figure(1) fig.clf() ax = fig.add_subplot(1,1,1) ax.imshow(data, interpolation='nearest', vmin=0.5, vmax=0.99) pl.colorbar() pl.show() The error message is C:\temp>python z.py Traceback (most recent call last): File "z.py", line 10, in <module> pl.colorbar() File "C:\Python25\lib\site-packages\matplotlib\pyplot.py", line 1369, in colorbar ret = gcf().colorbar(mappable, cax = cax, ax=ax, **kw) File "C:\Python25\lib\site-packages\matplotlib\figure.py", line 1046, in colorbar cb = cbar.Colorbar(cax, mappable, **kw) File "C:\Python25\lib\site-packages\matplotlib\colorbar.py", line 622, in __init__ mappable.autoscale_None() # Ensure mappable.norm.vmin, vmax AttributeError: 'NoneType' object has no attribute 'autoscale_None' How can I add colorbar to this code? Following is the interpreter information: Python 2.5.4 (r254:67916, Dec 23 2008, 15:10:54) [MSC v.1310 32 bit (Intel)] on win32 Type "help", "copyright", "credits" or "license" for more information. >>>

    Read the article

  • Ho to stop scrolling in a Gallery Widget?

    - by Alexi
    I loaded some images into a gallery. Now I'm able to scroll but once started scrolling the scrolling won't stop. I would like the gallery to just scroll to the next image and then stop until the user does the scroll gesture again. this is my code import android.widget.ImageView; import android.widget.Toast; import android.widget.AdapterView.OnItemClickListener; public class GalleryExample extends Activity { private Gallery gallery; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); gallery = (Gallery) findViewById(R.id.examplegallery); gallery.setAdapter(new AddImgAdp(this)); gallery.setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView parent, View v, int position, long id) { Toast.makeText(GalleryExample.this, "Position=" + position, Toast.LENGTH_SHORT).show(); } }); } public class AddImgAdp extends BaseAdapter { int GalItemBg; private Context cont; private Integer[] Imgid = { R.drawable.a_1, R.drawable.a_2, R.drawable.a_3, R.drawable.a_4, R.drawable.a_5, R.drawable.a_6, R.drawable.a_7 }; public AddImgAdp(Context c) { cont = c; TypedArray typArray = obtainStyledAttributes(R.styleable.GalleryTheme); GalItemBg = typArray.getResourceId(R.styleable.GalleryTheme_android_galleryItemBackground, 0); typArray.recycle(); } public int getCount() { return Imgid.length; } public Object getItem(int position) { return position; } public long getItemId(int position) { return position; } public View getView(int position, View convertView, ViewGroup parent) { ImageView imgView = new ImageView(cont); imgView.setImageResource(Imgid[position]); i.setScaleType(ImageView.ScaleType.FIT_CENTER); imgView.setBackgroundResource(GalItemBg); return imgView; } } } and the xmlLayout file <?xml version="1.0" encoding="utf-8"?> <LinearLayout android:id="@+id/LinearLayout01" android:layout_width="fill_parent" android:layout_height="fill_parent" xmlns:android="http://schemas.android.com/apk/res/android" > <Gallery xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/examplegallery" android:layout_width="fill_parent" android:layout_height="fill_parent" /> </LinearLayout>

    Read the article

  • Why is django giving me an attribute error when I call _set.all() for its children models?

    - by user1876508
    I have two models defined from django.db import models class Blog(models.Model): title = models.CharField(max_length=144) @property def posts(self): self.Post_set.all() class Post(models.Model): title = models.CharField(max_length=144) text = models.TextField() blog = models.ForeignKey('Blog') but the problem is, when I run shell, and enter >>> blog = Blog(title="My blog") >>> post = Post(title="My first post", text="Here is the main text for my blog post", blog=blog) >>> blog.posts I get the error Traceback (most recent call last): File "<console>", line 1, in <module> File "/home/lucas/Programming/Python/Django/djangorestfun/blog/models.py", line 9, in posts self.Post_set.all() AttributeError: 'Blog' object has no attribute 'Post_set' >>> Now I am having the following problem >>> from blog.models import * >>> blog = Blog(title="gewrhter") >>> blog.save() >>> blog.__dict__ {'_state': <django.db.models.base.ModelState object at 0x259be10>, 'id': 1, 'title': 'gewrhter'} >>> blog._state.__dict__ {'adding': False, 'db': 'default'} >>> post = Post(title="sdhxcvb", text="hdbfdgb", blog=blog) >>> post.save() >>> post.__dict__ {'blog_id': 1, 'title': 'sdhxcvb', 'text': 'hdbfdgb', '_blog_cache': <Blog: Blog object>, '_state': <django.db.models.base.ModelState object at 0x259bed0>, 'id': 1} >>> blog.posts >>> print blog.posts None Second update So I followed your guide, but I am still getting nothing. In addition, blog.posts gives me an error. >>> from blog.models import * >>> blog = Blog(title="asdf") >>> blog.save() >>> post = Post(title="asdf", text="sdxcvb", blog=blog) >>> post.save() >>> blog.posts Traceback (most recent call last): File "<console>", line 1, in <module> AttributeError: 'Blog' object has no attribute 'posts' >>> print blog.all_posts None

    Read the article

  • C# Random Number Generator getting stuck in a cycle

    - by Jean Azzopardi
    Hi, I am using .NET to create an artificial life program and I am using C#'s pseudo random class defined in a Singleton. The idea is that if I use the same random number generator throughout the application, I could merely save the seed and then reload from the seed to recompute a certain interesting run. public sealed class RandomNumberGenerator : Random { private static readonly RandomNumberGenerator instance = new RandomNumberGenerator(); RandomNumberGenerator() { } public static RandomNumberGenerator Instance { get { return instance; } } } I also wanted a method that could give me two different random numbers. public static Tuple<int, int> TwoDifferentRandomNumbers(this Random rnd, int minValue, int maxValue) { if (minValue >= maxValue) throw new ArgumentOutOfRangeException("maxValue", "maxValue must be greater than minValue"); if (minValue + 1 == maxValue) return Tuple.Create<int, int>(minValue, maxValue); int rnd1 = rnd.Next(minValue, maxValue); int rnd2 = rnd.Next(minValue, maxValue); while (rnd1 == rnd2) { rnd2 = rnd.Next(minValue, maxValue); } return Tuple.Create<int, int>(rnd1, rnd2); } The problem is that sometimes rnd.Next(minValue,maxValuealways returns minValue. If I breakpoint at this point and try creating a double and setting it to rnd.NextDouble(), it returns 0.0. Anyone know why this is happening? I know that it is a pseudo random number generator, but frankly, I hadn't expected it to lock at 0. The random number generator is being accessed from multiple threads... could this be the source of the problem?

    Read the article

  • not able to Deserialize xml into object

    - by Ravisha
    I am having following peice of code ,where in i am trying to serialize and deserailize object of StringResource class. Please note Resource1.stringXml = its coming from resource file.If i pass strelemet.outerXMl i get the object from Deserialize object ,but if i pass Resource1.stringXml i am getting following exception {"< STRING xmlns='' was not expected."} System.Exception {System.InvalidOperationException} class Program { static void Main(string[] args) { StringResource str = new StringResource(); str.DELETE = "CanDelete"; str.ID= "23342"; XmlElement strelemet = SerializeObjectToXmlNode (str); StringResource strResourceObject = DeSerializeXmlNodeToObject<StringResource>(Resource1.stringXml); Console.ReadLine(); } public static T DeSerializeXmlNodeToObject<T>(string objectNodeOuterXml) { try { TextReader objStringsTextReader = new StringReader(objectNodeOuterXml); XmlSerializer stringResourceSerializer = new XmlSerializer(typeof(T),string.Empty); return (T)stringResourceSerializer.Deserialize(objStringsTextReader); } catch (Exception excep) { return default(T); } } public static XmlElement SerializeObjectToXmlNode(object obj) { using (MemoryStream memoryStream = new MemoryStream()) { try { XmlSerializerNamespaces xmlNameSpace = new XmlSerializerNamespaces(); xmlNameSpace.Add(string.Empty, string.Empty); XmlWriterSettings writerSettings = new XmlWriterSettings(); writerSettings.CloseOutput = false; writerSettings.Encoding = System.Text.Encoding.UTF8; writerSettings.Indent = false; writerSettings.OmitXmlDeclaration = true; XmlWriter writer = XmlWriter.Create(memoryStream, writerSettings); XmlSerializer xmlserializer = new XmlSerializer(obj.GetType()); xmlserializer.Serialize(writer, obj, xmlNameSpace); writer.Close(); memoryStream.Position = 0; XmlDocument serializeObjectDoc = new XmlDocument(); serializeObjectDoc.Load(memoryStream); return serializeObjectDoc.DocumentElement; } catch (Exception excep) { return null; } } } } public class StringResource { [XmlAttribute] public string DELETE; [XmlAttribute] public string ID; } < STRING ID="1" DELETE="True" /

    Read the article

  • Python class design - Splitting up big classes into multiple ones to group functionality

    - by Ivo Wetzel
    OK I've got 2 really big classes 1k lines each that I currently have split up into multiple ones. They then get recombined using multiple inheritance. Now I'm wondering, if there is any cleaner/better more pythonic way of doing this. Completely factoring them out would result in endless amounts of self.otherself.do_something calls, which I don't think is the way it should be done. To make things clear here's what it currently looks like: from gui_events import GUIEvents # event handlers from gui_helpers import GUIHelpers # helper methods that don't directly modify the GUI # GUI.py class GUI(gtk.Window, GUIEvents, GUIHelpers): # general stuff here stuff here One problem that is result of this is Pylint complaining giving me trillions of "init not called" / "undefined attribute" / "attribute accessed before definition" warnings.

    Read the article

  • Predicate problem in ToSelectList

    - by Stefanvds
    the ToSelectList method I have: public static IList<SelectListItem> ToSelectList<T>(this IEnumerable<T> itemsToMap, Func<T, string> textProperty, Func<T, string> valueProperty, Predicate<T> isSelected) { var result = new List<SelectListItem>(); foreach (var item in itemsToMap) { result.Add(new SelectListItem { Value = valueProperty(item), Text = textProperty(item), Selected = isSelected(item) }); } return result; } when I call this method here: public static List<SelectListItem> lesgeverList(int selectedID) { NASDataContext _db = new NASDataContext(); var lesg = (from l in _db.Lesgevers where l.LG_Naam != "leeg" orderby l.LG_Naam select l).ToSelectList(m => m.LG_Naam + " " + m.LG_Vnaam, m => m.LG_ID.ToString(), m => m.LG_ID == selectedID); return lesg.ToList(); } the selectlist I get has the selectedID as selected. now, when I want to have multiple selected items, I give a list of Lesgevers public static List<SelectListItem> lesgeverList(List<Lesgever> lg) { NASDataContext _db = new NASDataContext(); var test = (from l in _db.Lesgevers where l.LG_Naam != "leeg" && lg.Contains(l) orderby l.LG_Naam, l.LG_Vnaam select l).ToList(); var lesg = (from l in _db.Lesgevers where l.LG_Naam != "leeg" orderby l.LG_Naam, l.LG_Vnaam select l).ToSelectList(m => m.LG_Naam + " " + m.LG_Vnaam, m => m.LG_ID.ToString(), m => lg.Contains(m)); return lesg.ToList(); } the var test does return the Lesgevers that i have in the lg List, in my 'var lesg', there are no selectlistitem's selected at all. where is my mistake? :) how do I fix thix?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Django Managers

    - by owca
    I have the following models code : from django.db import models from categories.models import Category class MusicManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Music') def count_music(self): return self.all().count() class SportManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Sport') class Event(models.Model): title = models.CharField(max_length=120) category = models.ForeignKey(Category) objects = models.Manager() music = MusicManager() sport = SportManager() Now by registering MusicManager() and SportManager() I am able to call Event.music.all() and Event.sport.all() queries. But how can I create Event.music.count() ? Should I call self.all() in count_music() function of MusicManager to query only on elements with 'Music' category or do I still need to filter through them in search for category first ?

    Read the article

  • Is this a good way to do a game loop for an iPhone game?

    - by Danny Tuppeny
    Hi all, I'm new to iPhone dev, but trying to build a 2D game. I was following a book, but the game loop it created basically said: function gameLoop update() render() sleep(1/30th second) gameLoop The reasoning was that this would run at 30fps. However, this seemed a little mental, because if my frame took 1/30th second, then it would run at 15fps (since it'll spend as much time sleeping as updating). So, I did some digging and found the CADisplayLink class which would sync calls to my gameLoop function to the refresh rate (or a fraction of it). I can't find many samples of it, so I'm posting here for a code review :-) It seems to work as expected, and it includes passing the elapsed (frame) time into the Update method so my logic can be framerate-independant (however I can't actually find in the docs what CADisplayLink would do if my frame took more than its allowed time to run - I'm hoping it just does its best to catch up, and doesn't crash!). // // GameAppDelegate.m // // Created by Danny Tuppeny on 10/03/2010. // Copyright Danny Tuppeny 2010. All rights reserved. // #import "GameAppDelegate.h" #import "GameViewController.h" #import "GameStates/gsSplash.h" @implementation GameAppDelegate @synthesize window; @synthesize viewController; - (void) applicationDidFinishLaunching:(UIApplication *)application { // Create an instance of the first GameState (Splash Screen) [self doStateChange:[gsSplash class]]; // Set up the game loop displayLink = [CADisplayLink displayLinkWithTarget:self selector:@selector(gameLoop)]; [displayLink setFrameInterval:2]; [displayLink addToRunLoop:[NSRunLoop currentRunLoop] forMode:NSDefaultRunLoopMode]; } - (void) gameLoop { // Calculate how long has passed since the previous frame CFTimeInterval currentFrameTime = [displayLink timestamp]; CFTimeInterval elapsed = 0; // For the first frame, we want to pass 0 (since we haven't elapsed any time), so only // calculate this in the case where we're not the first frame if (lastFrameTime != 0) { elapsed = currentFrameTime - lastFrameTime; } // Keep track of this frames time (so we can calculate this next time) lastFrameTime = currentFrameTime; NSLog([NSString stringWithFormat:@"%f", elapsed]); // Call update, passing the elapsed time in [((GameState*)viewController.view) Update:elapsed]; } - (void) doStateChange:(Class)state { // Remove the previous GameState if (viewController.view != nil) { [viewController.view removeFromSuperview]; [viewController.view release]; } // Create the new GameState viewController.view = [[state alloc] initWithFrame:CGRectMake(0, 0, IPHONE_WIDTH, IPHONE_HEIGHT) andManager:self]; // Now set as visible [window addSubview:viewController.view]; [window makeKeyAndVisible]; } - (void) dealloc { [viewController release]; [window release]; [super dealloc]; } @end Any feedback would be appreciated :-) PS. Bonus points if you can tell me why all the books use "viewController.view" but for everything else seem to use "[object name]" format. Why not [viewController view]?

    Read the article

  • GWT JsonpRequestBuilder Timeout issue

    - by Anthony Kong
    I am getting time out from using JsonpRequestBuilder. The entry point code goes like this: // private static final String SERVER_URL = "http://localhost:8094/data/view/"; private static final String SERVER_URL = "http://www.google.com/calendar/feeds/[email protected]/public/full?alt=json-in-script&callback=insertAgenda&orderby=starttime&max-results=15&singleevents=true&sortorder=ascending&futureevents=true"; private static final String SERVER_ERROR = "An error occurred while " + "attempting to contact the server. Please check your network " + "connection and try again."; /** * This is the entry point method. */ public void onModuleLoad() { JsonpRequestBuilder requestBuilder = new JsonpRequestBuilder(); // requestBuilder.setTimeout(10000); requestBuilder.requestObject(SERVER_URL, new Jazz10RequestCallback()); } class Jazz10RequestCallback implements AsyncCallback<Article> { @Override public void onFailure(Throwable caught) { Window.alert("Failed to send the message: " + caught.getMessage()); } @Override public void onSuccess(Article result) { // TODO Auto-generated method stub Window.alert(result.toString()); } The article class is simply: import com.google.gwt.core.client.JavaScriptObject; public class Article extends JavaScriptObject { protected Article() {}; } The gwt page, however, always hit the onFailure() callback and show this alert: Failed to send the message. Timeout while calling <url>. Fail to see anything on the Eclipse plugin console. I tried the url and it works perfectly. Would appreciate any tip on debugging technique or suggestion

    Read the article

  • Parsing Json Feeds with google Gson

    - by mnml
    I would like to know how to parse a json feed by items, eg. url / title / description for each item. I have had a look to the doc / api but, it didn't help me. This is what I got so far import com.google.gson.Gson; import com.google.gson.JsonObject; public class ImportSources extends Job { public void doJob() throws IOException { String json = stringOfUrl("http://feed.test/all.json"); JsonObject jobj = new Gson().fromJson(json, JsonObject.class); Logger.info(jobj.get("responseData").toString()); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } }

    Read the article

  • JavaScript/Dojo Module Pattern - how to debug?

    - by djna
    I'm working with Dojo and using the "Module Pattern" as described in Mastering Dojo. So far as I can see this pattern is a general, and widely used, JavaScript pattern. My question is: How do we debug our modules? So far I've not been able to persuade Firebug to show me the source of my module. Firebug seems to show only the dojo eval statement used to execute the factory method. Hence I'm not able to step through my module source. I've tried putting "debugger" statements in my module code, and Firebug seems to halt correctly, but does not show the source. Contrived example code below. This is just an example of sufficient complexity to make the need for debugging plausible, it's not intended to be useful code. The page <!-- Experiments with Debugging --> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <title>console me</title> <style type="text/css"> @import "../dojoroot/dojo/resources/dojo.css"; @import "../dojoroot/dijit/themes/tundra/tundra.css"; @import "edf.css"; </style> <script type="text/javascript" src="../dojoroot/dojo/dojo.js"> </script> <script type="text/javascript" > dojo.registerModulePath("mytest", "../../mytest"); dojo.require("mytest.example"); dojo.addOnLoad(function(){ mytest.example.greet(); }); </script> </head> <body class="tundra"> <div id="bulletin"> <p>Just Testing</p> </div> </body> </html> <!-- END: snip1 --> The java script I'd like to debug dojo.provide("mytest.example"); dojo.require("dijit.layout.ContentPane"); /** * define module */ (function(){ //define the main program functions... var example= mytest.example; example.greet= function(args) { var bulletin = dojo.byId("bulletin"); console.log("bulletin:" + bulletin); if ( bulletin) { var content = new dijit.layout.ContentPane({ id: "dummy", region: "center" }); content.setContent('Greetings!'); dojo._destroyElement(bulletin); dojo.place(content.domNode, dojo.body(), "first"); console.log("greeting done"); } else { console.error("no bulletin board"); } } })();

    Read the article

  • How to stop a QDialog from executing while still in the __init__ statement(or immediatly after)?

    - by Jonathan
    I am wondering how I can go about stopping a dialog from opening if certain conditions are met in its __init__ statement. The following code tries to call the 'self.close()' function and it does, but (I'm assuming) since the dialog has not yet started its event loop, that it doesn't trigger the close event? So is there another way to close and/or stop the dialog from opening without triggering an event? Example code: from PyQt4 import QtCore, QtGui class dlg_closeInit(QtGui.QDialog): ''' Close the dialog if a certain condition is met in the __init__ statement ''' def __init__(self): QtGui.QDialog.__init__(self) self.txt_mytext = QtGui.QLineEdit('some text') self.btn_accept = QtGui.QPushButton('Accept') self.myLayout = QtGui.QVBoxLayout(self) self.myLayout.addWidget(self.txt_mytext) self.myLayout.addWidget(self.btn_accept) self.setLayout(self.myLayout) # Connect the button self.connect(self.btn_accept,QtCore.SIGNAL('clicked()'), self.on_accept) self.close() def on_accept(self): # Get the data... self.mydata = self.txt_mytext.text() self.accept() def get_data(self): return self.mydata def closeEvent(self, event): print 'Closing...' if __name__ == '__main__': import sys app = QtGui.QApplication(sys.argv) dialog = dlg_closeInit() if dialog.exec_(): print dialog.get_data() else: print "Failed"

    Read the article

  • UniqueConstraint in EmbeddedConfiguration

    - by LantisGaius
    I just started using db4o on C#, and I'm having trouble setting the UniqueConstraint on the DB.. here's the db4o configuration static IObjectContainer db = Db4oEmbedded.OpenFile(dbase.Configuration(), "data.db4o"); static IEmbeddedConfiguration Configuration() { IEmbeddedConfiguration dbConfig = Db4oEmbedded.NewConfiguration(); // Initialize Replication dbConfig.File.GenerateUUIDs = ConfigScope.Globally; dbConfig.File.GenerateVersionNumbers = ConfigScope.Globally; // Initialize Indexes dbConfig.Common.ObjectClass(typeof(DAObs.Environment)).ObjectField("Key").Indexed(true); dbConfig.Common.Add(new Db4objects.Db4o.Constraints.UniqueFieldValueConstraint(typeof(DAObs.Environment), "Key")); return dbConfig; } and the object to serialize: class Environment { public string Key { get; set; } public string Value { get; set; } } everytime I get to commiting some values, an "Object reference not set to an instance of an object." Exception pops up, with a stack trace pointing to the UniqueFieldValueConstraint. Also, when I comment out the two lines after the "Initialize Indexes" comment, everything runs fine (Except you can save non-unique keys, which is a problem)~ Commit code (In case I'm doing something wrong in this part too:) public static void Create(string key, string value) { try { db.Store(new DAObs.Environment() { Key = key, Value = value }); db.Commit(); } catch (Db4objects.Db4o.Events.EventException ex) { System.Console.WriteLine (DateTime.Now + " :: Environment.Create\n" + ex.InnerException.Message +"\n" + ex.InnerException.StackTrace); db.Rollback(); } } Help please? Thanks in advance~

    Read the article

  • Generating %pc relative address of constant data

    - by Hudson
    Is there a way to have gcc generate %pc relative addresses of constants? Even when the string appears in the text segment, arm-elf-gcc will generate a constant pointer to the data, load the address of the pointer via a %pc relative address and then dereference it. For a variety of reasons, I need to skip the middle step. As an example, this simple function: const char * filename(void) { static const char _filename[] __attribute__((section(".text"))) = "logfile"; return _filename; } generates (when compiled with arm-elf-gcc-4.3.2 -nostdlib -c -O3 -W -Wall logfile.c): 00000000 <filename>: 0: e59f0000 ldr r0, [pc, #0] ; 8 <filename+0x8> 4: e12fff1e bx lr 8: 0000000c .word 0x0000000c 0000000c <_filename.1175>: c: 66676f6c .word 0x66676f6c 10: 00656c69 .word 0x00656c69 I would have expected it to generate something more like: filename: add r0, pc, #0 bx lr _filename.1175: .ascii "logfile\000" The code in question needs to be partially position independent since it will be relocated in memory at load time, but also integrate with code that was not compiled -fPIC, so there is no global offset table. My current work around is to call a non-inline function (which will be done via a %pc relative address) to find the offset from the compiled location in a technique similar to how -fPIC code works: static intptr_t __attribute__((noinline)) find_offset( void ) { uintptr_t pc; asm __volatile__ ( "mov %0, %%pc" : "=&r"(pc) ); return pc - 8 - (uintptr_t) find_offset; } But this technique requires that all data references be fixed up manually, so the filename() function in the above example would become: const char * filename(void) { static const char _filename[] __attribute__((section(".text"))) = "logfile"; return _filename + find_offset(); }

    Read the article

  • Python Ephem calculation

    - by dassouki
    the output should process the first date as "day" and second as "night". I've been playing with this for a few hours now and can't figure out what I'm doing wrong. Any ideas? Output: $ python time_of_day.py * should be day: event date: 2010/4/6 16:00:59 prev rising: 2010/4/6 09:24:24 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/7 09:22:27 next set: 2010/4/6 23:34:27 day * should be night: event date: 2010/4/6 00:01:00 prev rising: 2010/4/5 09:26:22 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/6 09:24:24 next set: 2010/4/6 23:34:27 day time_of_day.py import datetime import ephem # install from http://pypi.python.org/pypi/pyephem/ #event_time is just a date time corresponding to an sql timestamp def type_of_light(latitude, longitude, event_time, utc_time, horizon): o = ephem.Observer() o.lat, o.long, o.date, o.horizon = latitude, longitude, event_time, horizon print "event date ", o.date print "prev rising: ", o.previous_rising(ephem.Sun()) print "prev setting: ", o.previous_setting(ephem.Sun()) print "next rise: ", o.next_rising(ephem.Sun()) print "next set: ", o.next_setting(ephem.Sun()) if o.previous_rising(ephem.Sun()) <= o.date <= o.next_setting(ephem.Sun()): return "day" elif o.previous_setting(ephem.Sun()) <= o.date <= o.next_rising(ephem.Sun()): return "night" else: return "error" print "should be day: ", type_of_light('45.959','-66.6405','2010/4/6 16:01','-4', '-6') print "should be night: ", type_of_light('45.959','-66.6405','2010/4/6 00:01','-4', '-6')

    Read the article

  • Convert Wordpress.com Hosted Blog to BlogEngine.NET

    - by Chris Marisic
    I'm looking at what is needed to move from wordpress.com to a BlogEngine.NET or similar blog. I've seen a tool for replacing export.php so that it will export your wordpress site in BlogML format so it can easily be imported into BlogEngine.NET, however I'd really not want to have to setup php/wordpress just so I can import a back up from wordpress.com and then use the export from my local wordpress to have a BlogML file. Are there any tools that will convert the wordpress file? Is there a different blog that will natively import the wordpress file? Edit: For the question about other blog providers, I am open to them as long as they are .NET based, preferably C#.

    Read the article

  • Warning: Memcache::connect(0memcache.connect0): Can't connect to localhost:11211, Connection refuse

    - by Stick it to THE MAN
    I am using Symfony 1.3.2 with Propel ORM on Ubuntu 9.10. I am incorporating memcache to the website. I have modified the setup() method in apps/frontend/ProjectConfiguration.class.php like this: class ProjectConfiguration { public function setup() { // original SF generated code here .. require_one sfConfig::get('sf_lib_dir').'/MyCache.class.php'; myCache::init(); } } my cache singleton is implemented something like this: class MyCache { private static memcache = null; private static inited = false; public static init() { if (self::$inited) return; self::$memcache = new Memcache(); if (self::$memcache->connect('localhost', 11211) { // Do some stuff .. self::$inited = true; } } } Warning: Memcache::connect(0memcache.connect0): Can't connect to localhost:11211, Connection refused(111) in /path_to_class/MyCache.class.php This happens for both CLI (e.g. running SF tasks) or for web access through the browser. Does anyone know how to resolve this (I suspect its something to do with Linux user privileges). As an aside, I am aware that SF prvoides an sfAPCache wrapper class for cacheing. I am intentionally not using it for two reasons: I cannot find any comprehensive (and up to date) docs on this class I want to learn the memcache API directly, since I will be accesing it from other languages.

    Read the article

  • undefined symbol: PyUnicodeUCS2_Decode whilst trying to install psycopg2

    - by Marco Fucci
    I'm getting an error whilst trying to install psycopg2 on ubuntu 9.10 64 bit. The error is: >>> import psycopg2 Traceback (most recent call last): File "<stdin>", line 1, in <module> File "psycopg2/__init__.py", line 69, in <module> from _psycopg import BINARY, NUMBER, STRING, DATETIME, ROWID ImportError: psycopg2/_psycopg.so: undefined symbol: PyUnicodeUCS2_Decode I've tried downloading the package from http://initd.org/pub/software/psycopg/ and installing it. I've tried by using easy_install too. No error during the installation. It's quite weird as my python (2.6.2) has been compiled with UCS4 and so the installation should just work without problems. Any help would be appreciated. Cheers

    Read the article

  • IronPython and Nodebox in C#

    - by proxylittle
    My plan: I'm trying to setup my C# project to communicate with Nodebox to call a certain function which populates a graph and draws it in a new window. Current situation: [fixed... see Update2] I have already included all python-modules needed, but im still getting a Library 'GL' not found it seems that the pyglet module needs a reference to GL/gl.h, but can't find it due to IronPython behaviour. Requirement: The project needs to stay as small as possible without installing new packages. Thats why i have copied all my modules into the project-folder and would like to keep it that or a similar way. My question: Is there a certain workaround for my problem or a fix for the library-folder missmatch. Have read some articles about Tao-Opengl and OpenTK but can't find a good solution. Update1: Updated my sourcecode with a small pyglet window-rendering example. Problem is in pyglet and referenced c-Objects. How do i include them in my c# project to be called? No idea so far... experimenting alittle now. Keeping you updated. SampleCode C#: ScriptRuntimeSetup setup = Python.CreateRuntimeSetup(null); ScriptRuntime runtime = new ScriptRuntime(setup); ScriptEngine engine = Python.GetEngine(runtime); ScriptSource source = engine.CreateScriptSourceFromFile("test.py"); ScriptScope scope = engine.CreateScope(); source.Execute(scope); SampleCode Python (test.py): from nodebox.graphics import * from nodebox.graphics.physics import Vector, Boid, Flock, Obstacle flock = Flock(50, x=-50, y=-50, width=700, height=400) flock.sight(80) def draw(canvas): canvas.clear() flock.update(separation=0.4, cohesion=0.6, alignment=0.1, teleport=True) for boid in flock: push() translate(boid.x, boid.y) scale(0.5 + boid.depth) rotate(boid.heading) arrow(0, 0, 15) pop() canvas.size = 600, 300 def main(canvas): canvas.run(draw) Update2: Line 139 [pyglet/lib.py] sys.platform is not win32... there was the error. Fixed it by just using the line: from pyglet.gl.lib_wgl import link_GL, link_GLU, link_WGL Now the following Error: 'module' object has no attribute '_getframe' Kind of a pain to fix it. Updating with results... Update3: Fixed by adding following line right after first line in C#-Code: setup.Options["Frames"] = true; Current Problem: No module named unicodedata, but in Python26/DLLs is only a *.pyd file`. So.. how do i implement it now?!

    Read the article

< Previous Page | 276 277 278 279 280 281 282 283 284 285 286 287  | Next Page >