Search Results

Search found 27946 results on 1118 pages for 'output buffer empty'.

Page 281/1118 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • OpenGL + cgFX Alpha Blending failure

    - by dopplex
    I have a shader that needs to additively blend to its output render target. While it had been fully implemented and working, I recently refactored and have done something that is causing the alpha blending to not work anymore. I'm pretty sure that the problem is somewhere in my calls to either OpenGL or cgfx - but I'm currently at a loss for where exactly the problem is, as everything looks like it is set up properly for alpha blending to occur. No OpenGL or cg framework errors are showing up, either. For some context, what I'm doing here is taking a buffer which contains screen position and luminance values for each pixel, copying it to a PBO, and using it as the vertex buffer for drawing GL_POINTS. Everything except for the alpha blending appears to be working as expected. I've confirmed both that the input vertex buffer has the correct values, and that my vertex and fragment shaders are outputting the points to the correct locations and with the correct luminance values. The way that I've arrived at the conclusion that the Alpha blending was broken is by making my vertex shader output every point to the same screen location and then setting the pixel shader to always output a value of float4(0.5) for that pixel. Invariably, the end color (dumped afterwards) ends up being float4(0.5). The confusing part is that as far as I can tell, everything is properly set for alpha blending to occur. The cgfx pass has the two following state assignments (among others - I'll put a full listing at the end): BlendEnable = true; BlendFunc = int2(One, One); This ought to be enough, since I am calling cgSetPassState() - and indeed, when I use glGets to check the values of GL_BLEND_SRC, GL_BLEND_DEST, GL_BLEND, and GL_BLEND_EQUATION they all look appropriate (GL_ONE, GL_ONE, GL_TRUE, and GL_FUNC_ADD). This check was done immediately after the draw call. I've been looking around to see if there's anything other than blending being enabled and the blending function being correctly set that would cause alpha blending not to occur, but without any luck. I considered that I could be doing something wrong with GL, but GL is telling me that blending is enabled. I doubt it's cgFX related (as otherwise the GL state wouldn't even be thinking it was enabled) but it still fails if I explicitly use GL calls to set the blend mode and enable it. Here's the trimmed down code for starting the cgfx pass and the draw call: CGtechnique renderTechnique = Filter->curTechnique; TEXUNITCHECK; CGpass pass = cgGetFirstPass(renderTechnique); TEXUNITCHECK; while (pass) { cgSetPassState(pass); cgUpdatePassParameters(pass); //drawFSPointQuadBuff((void*)PointQuad); drawFSPointQuadBuff((void*)LumPointBuffer); TEXUNITCHECK; cgResetPassState(pass); pass = cgGetNextPass(pass); }; and the function with the draw call: void drawFSPointQuadBuff(void* args) { PointBuffer* pointBuffer = (PointBuffer*)args; FBOERRCHECK; glClear(GL_COLOR_BUFFER_BIT); GLERRCHECK; glPointSize(1.0); GLERRCHECK; glEnableClientState(GL_VERTEX_ARRAY); GLERRCHECK; glEnable(GL_POINT_SMOOTH); if (pointBuffer-BufferObject) { glBindBufferARB(GL_ARRAY_BUFFER_ARB, (unsigned int)pointBuffer-BufData); glVertexPointer(pointBuffer-numComp, GL_FLOAT, 0, 0); } else { glVertexPointer(pointBuffer-numComp, GL_FLOAT, 0, pointBuffer-BufData); }; GLERRCHECK; glDrawArrays(GL_POINTS, 0, pointBuffer-numElem); GLboolean testBool; glGetBooleanv(GL_BLEND, &testBool); int iblendColor, iblendDest, iblendEquation, iblendSrc; glGetIntegerv(GL_BLEND_SRC, &iblendSrc); glGetIntegerv(GL_BLEND_DST, &iblendDest); glGetIntegerv(GL_BLEND_EQUATION, &iblendEquation); if (iblendEquation == GL_FUNC_ADD) { cerr << "Correct func" << endl; }; GLERRCHECK; if (pointBuffer-BufferObject) { glBindBufferARB(GL_ARRAY_BUFFER_ARB,0); } GLERRCHECK; glDisableClientState(GL_VERTEX_ARRAY); GLERRCHECK; }; Finally, here is the full state setting of the shader: AlphaTestEnable = false; DepthTestEnable = false; DepthMask = false; ColorMask = true; CullFaceEnable = false; BlendEnable = true; BlendFunc = int2(One, One); FragmentProgram = compile glslf std_PS(); VertexProgram = compile glslv bilatGridVS2();

    Read the article

  • python gui events out of order

    - by dave
    from Tkinter import * from tkMessageBox import * class Gui: def __init__(self, root): self.container = Frame(root) self.container.grid() self.inputText = Text(self.container, width=50, height=8) self.outputText = Text(self.container, width=50, height=8, bg='#E0E0E0', state=DISABLED) self.inputText.grid(row=0, column=0) self.outputText.grid(row=0, column=1) self.inputText.bind("<Key>", self.translate) def translate(self, event): input = self.inputText.get(0.0, END) output = self.outputText.get(0.0, END) self.outputText.config(state=NORMAL) self.outputText.delete(0.0, END) self.outputText.insert(INSERT, input) self.outputText.config(state=DISABLED) showinfo(message="Input: %s characters\nOutput: %s characters" % (len(input), len(input))) root = Tk() #toplevel object app = Gui(root) #call to the class where gui is defined root.mainloop() #enter event loop Working on a gui in tkinter I'm a little confused as to the sequence the event handlers are run. If you run the above code you'll hopefully see... 1) Editing the text widget triggers the event handler but it seems to fire it off without registering the actual change, 2) Even when the text widget is cleared (ie, keep pressing BackSpace) it still seems to have a one character length string, 3) The output widget only receives its update when the NEXT event trigger is fired despite the fact the data came on the previous event. Is this just how bindings work in tkinter or am i missing something here? The behaviour i would like when updating the input widget is: 1) Show the change, 2) Enter event handler, 3) Update output widget, 4) Show message box.

    Read the article

  • How to stream pdf document from servlet?

    - by Kumar
    Hi,I am creating pdf document using jasper report and i need to stream that pdf document from servlet.Can anyone help me where i did mistake.This is the code snippet which i am using in my application. ServletOutputStream servletOutputStream = response.getOutputStream(); String fileName="test.pdf"; response.setContentType("application/pdf"); response.setHeader("Content-Disposition","attachment; filename=\"" + fileName + "\""); response.setHeader("Cache-Control", "no-cache"); try { Map parameters = new HashMap(); parameters.put("SUBREPORT_DIR", JasperReportFilepath); parameters.put("TestId", testID); JasperPrint jprint=JasperFillManager.fillReport(filePath, parameters, conn); byte[] output=JasperExportManager.exportReportToPdf(jprint); System.out.println("Size====>"+output.length); servletOutputStream.write(output); servletOutputStream.flush(); servletOutputStream.close(); System.out.println("===============>Streaming perfectly"); } catch(Exception e) { System.out.println("===============>+JasperException"+e.getMessage()); } and i could not get any error message also.Everything is working fine but document is not streaming. Please help me to sort out the problem.

    Read the article

  • Giving 'TemplateError' can't convert String into Integer

    - by Gagan
    Hi, I recently transfered my app from Rails2 to Rails3. The code in 'app/views/distribution/index.html.erb' is like :- <div style="padding-bottom:10px; padding-left:0px;float:left;display:<%= (!session[:album][@artist.id.to_s].empty? && !session[:album][@artist.id.to_s].nil?)?'block' : 'none' %>" id = "make_payment_enabled"> <%= link_to 'Make Payments',{:action => 'pay', :album=>@album.id}, :class => "button" %> </div> It's giving me TemplateError on line :- <div style="padding-bottom:10px; padding-left:0px;float:left;display:<%= (!session[:album][@artist.id.to_s].empty? && !session[:album][@artist.id.to_s].nil?)?'block' : 'none' %>" id = "make_payment_enabled"> How to resolve the problem ?

    Read the article

  • creating matrix with probabilities

    - by John Chan
    Hi all, I want to generate a matrix of NxN to test some code that I have where each row contains floats as the elements and has to add up to 1 (i.e. a row with a set of probabilities). Where it gets tricky is that I want to make sure that randomly some of the elements should be 0 (in fact most of the elements should be 0 except for some random ones to be the probabilities). I need the probabilities to be 1/m where m is the number of elements that are not 0 within a single row. I tried to think of ways to output this, but essentially I would need this stored in a C++ array. So even if I output to a file I would still have the issue of not having it in array as I need it. At the end of it all I need that array because I want to generate a Market Matrix file. I found an implementation in C++ to take an array and convert it to the market matrix file, so this is what I am basing my findings on. My input for the rest of the code takes in this market matrix file so I need that to be the primary form of output. The language does not matter, I just want to generate the file at the end (I found a way mmwrite and mmread in python as well) Please help, I am stuck and not really sure how to implement this.

    Read the article

  • Does a USB hub affect performance?

    - by user1018733
    I have two devices I want maximum throughput and latency with. (Midi drums and midi keyboard for example) Would connecting both to the same USB port via a hub effectively limit the maximum data transfer rate to 1/2 to each of them? I am assuming yes, but I didn't know if USB hubs had a handshaking and priority giving protocol available (e.g. let the device with the longer built up buffer of data communicate first) Thanks

    Read the article

  • has_many association, nested models and callbacks

    - by fl00r
    Hi! I've got model A and model Attach. I'm editing my A form with nested attributes for :attaches. And when I am deleting all attaches from A via accepts_nested_attributes_for how can I get after_update/after_save callbacks for all of my nested models? Problem is that when I am executing callbacks in model A they are executed right AFTER model A is updated and BEFORE model Attach is updated, so I can't, for example, know if there is NO ANY attaches after I delete them all :). Look for example: my callback after_save :update_status won't work properly after I delete all of my attaches. model A after_save :update_status has_many :attaches accepts_nested_attributes_for :attaches, :reject_if => proc { |attributes| attributes['file'].blank? }, :allow_destroy => true def update_status print "\n\nOUPS! bag is empty!\n\n" if self.attaches.empty? end end model Attach belongs_to A end I am using rails 3 beta

    Read the article

  • JQgrid - escape ':' in searchoptions (value part)

    - by bsreekanth
    Hello, How to set the values for filter is explained here link text. I have two requirements. 1. the default value needs to be empty. I expect, if defaultValue is not set, the filter is empty, but that is not happening in my case. The first value is 2. How to escape ':' in my value. The character ':' and ';' are used to seperate the index and values. But, in my value string it contains a ':' (eg: searchoptions:{value:"1:'Level: 1'"} , where Level: 1 is my first value). How to escape : in the value part. I tried \ , / etc. thanks.

    Read the article

  • Start dependent application with eunit

    - by ruslander
    I start lager as a dependent application when I run a unit test but for some reason the code under test does not see it. -module(main_tests). -include_lib("eunit/include/eunit.hrl"). main_test_() -> {foreach, fun distr_setup/0, fun distr_cleanup/1, [ fun must_retain/1 ]}. must_retain(_) -> {"Should do ping pong when is fully initialized", fun() -> ?assertEqual(pong, abuse_counter:ping()) end}. %%------------------------------------------------------------------ distr_setup() -> abuse_counter:start_link(), ok. distr_cleanup(_) -> abuse_counter:stop(), ok. Here is the output of the log which is complaining that lager is not defined {undef,[{lager,info,["up and running"],[]} though in the run output is definitely there. Here is how I run it: erl -pa ebin/ ../../deps/*/ebin -s lager -eval 'eunit:test(main_tests,[verbose]), init:stop().' Fails with the output Eshell V5.10.2 (abort with ^G) 1> 17:13:31.506 [info] Application lager started on node nonode@nohost ======================== EUnit ======================== module 'main_tests' undefined 17:13:31.528 [error] CRASH REPORT Process <0.57.0> with 1 neighbours exited with reason: call to undefined function lager:info("up and running") in gen_server:init_it/6 line 328 *unexpected termination of test process* ::**{undef,[{lager,info,["up and running"],[]}**, {abuse_counter,init,1,[{file,"src/abuse_counter.erl"},{line,37}]}, {gen_server,init_it,6,[{file,"gen_server.erl"},{line,304}]}, {proc_lib,init_p_do_apply,3,[{file,"proc_lib.erl"},{line,239}]}]} ======================================================= Failed: 0. Skipped: 0. Passed: 0. One or more tests were cancelled. Already spent 3-4h hours on google and stack overflow but nothing seems to work. One option is to hide this call behind a ?INFO(Mgs) macro but do not like the idea. Any help will be highly appreciated.

    Read the article

  • iPhone SpeakHere example produces different number of samples

    - by pion
    I am looking at the SpeakHere example and added the following: // Overriding the output audio route UInt32 audioRouteOverride = kAudioSessionOverrideAudioRoute_Speaker; AudioSessionSetProperty(kAudioSessionProperty_OverrideAudioRoute, sizeof (audioRouteOverride), &audioRouteOverride); assert(status == noErr); // Changing the default output route. The new output route remains in effect unless you change the audio session category. This option is available starting in iPhone OS 3.1. UInt32 doChangeDefaultRoute = 1; status = AudioSessionSetProperty(kAudioSessionProperty_OverrideCategoryDefaultToSpeaker, sizeof(doChangeDefaultRoute), &doChangeDefaultRoute); assert(status == noErr); // Enable Bluetooth. See audioRouteOverride & doChangeDefaultRoute above // http://developer.apple.com/iphone/library/documentation/Audio/Conceptual/AudioSessionProgrammingGuide/Cookbook/Cookbook.html#//apple_ref/doc/uid/TP40007875-CH6-SW2 UInt32 allowBluetoothInput = 1; status = AudioSessionSetProperty(kAudioSessionProperty_OverrideCategoryEnableBluetoothInput, sizeof(allowBluetoothInput), &allowBluetoothInput); assert(status == noErr); Also, void AQRecorder::handleInputBufferCallback(void *aqData, ... ... if (inNumPackets > 0) { NSLog(@"Number of samples = %d", inBuffer->mAudioDataByteSize/2); // print out the number of sample status = AudioFileWritePackets(aqr->mAudioFile, FALSE, inBuffer->mAudioDataByteSize, inPacketDesc, aqr->mCurrentPacket, &inNumPackets, inBuffer->mAudioData); assert(status == noErr); aqr->mCurrentPacket += inNumPackets; } ... Notice the "NSLog(@"Number of samples = %d", inBuffer-mAudioDataByteSize/2); // print out the number of sample" statement above. I am using iPhone SDK 3.1.3. I got the following results The number of samples is around 44,100 on Simulator The number of samples is around 22,000 on iPhone The number of samples is around 4,000 on iPhone using Jawbone Bluetooth I am new on this. Why did itproduce different number of samples? Thanks in advance for your help.

    Read the article

  • Search resetting selection in tableview

    - by Jay
    I've got an NSTableView bound to an NSArrayController via content and selection indexes. All great so far - content displayed, etc. Now an NSSearchField is bound to the array controller via filterPredicate and the property of the array content instances that's to be searched. Searching/filtering the table view works great; table view showing only matching entries. However, searching resets the selection on the NSTableView if the existing selection isn't in the search results. Worse, not only during the search but after ending the search there's no selection on the table view. The NSArrayController is set up to Avoid Empty Selection. Any hints on how to properly configure bindings in this scenario to really prevent an empty selection much appreciated!

    Read the article

  • Https in java ends up with strange results

    - by Senne
    I'm trying to illustrate to students how https is used in java. But i have the feeling my example is not really the best out there... The code works well on my windows 7: I start the server, go to https://localhost:8080/somefile.txt and i get asked to trust the certificate, and all goes well. When I try over http (before or after accepting the certificate) I just get a blank page, which is ok for me. BUT when I try the exact same thing on my windows XP: Same thing, all goes well. But then (after accepting the certificate first), I'm also able to get all the the files through http! (if I first try http before https followed by accepting the certificate, I get no answer..) I tried refreshing, hard refreshing a million times but this should not be working, right? Is there something wrong in my code? I'm not sure if I use the right approach to implement https here... package Security; import java.io.*; import java.net.*; import java.util.*; import java.util.concurrent.Executors; import java.security.*; import javax.net.ssl.*; import com.sun.net.httpserver.*; public class HTTPSServer { public static void main(String[] args) throws IOException { InetSocketAddress addr = new InetSocketAddress(8080); HttpsServer server = HttpsServer.create(addr, 0); try { System.out.println("\nInitializing context ...\n"); KeyStore ks = KeyStore.getInstance("JKS"); char[] password = "vwpolo".toCharArray(); ks.load(new FileInputStream("myKeys"), password); KeyManagerFactory kmf = KeyManagerFactory.getInstance("SunX509"); kmf.init(ks, password); SSLContext sslContext = SSLContext.getInstance("TLS"); sslContext.init(kmf.getKeyManagers(), null, null); // a HTTPS server must have a configurator for the SSL connections. server.setHttpsConfigurator (new HttpsConfigurator(sslContext) { // override configure to change default configuration. public void configure (HttpsParameters params) { try { // get SSL context for this configurator SSLContext c = getSSLContext(); // get the default settings for this SSL context SSLParameters sslparams = c.getDefaultSSLParameters(); // set parameters for the HTTPS connection. params.setNeedClientAuth(true); params.setSSLParameters(sslparams); System.out.println("SSL context created ...\n"); } catch(Exception e2) { System.out.println("Invalid parameter ...\n"); e2.printStackTrace(); } } }); } catch(Exception e1) { e1.printStackTrace(); } server.createContext("/", new MyHandler1()); server.setExecutor(Executors.newCachedThreadPool()); server.start(); System.out.println("Server is listening on port 8080 ...\n"); } } class MyHandler implements HttpHandler { public void handle(HttpExchange exchange) throws IOException { String requestMethod = exchange.getRequestMethod(); if (requestMethod.equalsIgnoreCase("GET")) { Headers responseHeaders = exchange.getResponseHeaders(); responseHeaders.set("Content-Type", "text/plain"); exchange.sendResponseHeaders(200, 0); OutputStream responseBody = exchange.getResponseBody(); String response = "HTTP headers included in your request:\n\n"; responseBody.write(response.getBytes()); Headers requestHeaders = exchange.getRequestHeaders(); Set<String> keySet = requestHeaders.keySet(); Iterator<String> iter = keySet.iterator(); while (iter.hasNext()) { String key = iter.next(); List values = requestHeaders.get(key); response = key + " = " + values.toString() + "\n"; responseBody.write(response.getBytes()); System.out.print(response); } response = "\nHTTP request body: "; responseBody.write(response.getBytes()); InputStream requestBody = exchange.getRequestBody(); byte[] buffer = new byte[256]; if(requestBody.read(buffer) > 0) { responseBody.write(buffer); } else { responseBody.write("empty.".getBytes()); } URI requestURI = exchange.getRequestURI(); String file = requestURI.getPath().substring(1); response = "\n\nFile requested = " + file + "\n\n"; responseBody.write(response.getBytes()); responseBody.flush(); System.out.print(response); Scanner source = new Scanner(new File(file)); String text; while (source.hasNext()) { text = source.nextLine() + "\n"; responseBody.write(text.getBytes()); } source.close(); responseBody.close(); exchange.close(); } } }

    Read the article

  • Find all paths from root to leaves of tree in Scheme

    - by grifaton
    Given a tree, I want to find the paths from the root to each leaf. So, for this tree: D / B / \ A E \ C-F-G has the following paths from root (A) to leaves (D, E, G): (A B D), (A B E), (A C F G) If I represent the tree above as (A (B D E) (C (F G))) then the function g does the trick: (define (g tree) (cond ((empty? tree) '()) ((pair? tree) (map (lambda (path) (if (pair? path) (cons (car tree) path) (cons (car tree) (list path)))) (map2 g (cdr tree)))) (else (list tree)))) (define (map2 fn lst) (if (empty? lst) '() (append (fn (car lst)) (map2 fn (cdr lst))))) But this looks all wrong. I've not had to do this kind of thinking for a while, but I feel there should be a neater way of doing it. Any ideas for a better solution (in any language) would be appreciated.

    Read the article

  • Runing bcdedit from python in Windows 2008 SP2

    - by Lee-Man
    I do not know windows well, so that may explain my dilemma ... I am trying to run bcdedit in Windows 2008R2 from Python 2.6. My Python routine to run a command looks like this: def run_program(cmd_str): """Run the specified command, returning its output as an array of lines""" dprint("run_program(%s): entering" % cmd_str) cmd_args = cmd_str.split() subproc = subprocess.Popen(cmd_args, stdout=subprocess.PIPE, stderr=subprocess.PIPE, shell=True) (outf, errf) = (subproc.stdout, subproc.stderr) olines = outf.readlines() elines = errf.readlines() if Options.debug: if elines: dprint('Error output:') for line in elines: dprint(line.rstrip()) if olines: dprint('Normal output:') for line in olines: dprint(line.rstrip()) errf.close() outf.close() res = subproc.wait() dprint('wait result=', res) return (res, olines) I call this function thusly: (res, o) = run_program('bcdedit /set {current} MSI forcedisable') This command works when I type it from a cmd window, and it works when I put it in a batch file and run it from a command window (as Administrator, of course). But when I run it from Python (as Administrator), Python claims it can't find the command, returning: bcdedit is not recognized as an internal or external command, operable program or batch file Also, if I trying running my batch file from Python (which works from the command line), it also fails. I've also tried it with the full path to bcdedit, with the same results. What is it about calling bcdedit from Python that makes it not found? Note that I can call other EXE files from Python, so I have some level of confidence that my Python code is sane ... but who knows. Any help would be most appreciated.

    Read the article

  • Help With LINQ: Mixed Joins and Specifying Default Values

    - by Corey O.
    I am trying to figure out how to do a mixed-join in LINQ with specific access to 2 LINQ objects. Here is an example of how the actual TSQL query might look: SELECT * FROM [User] AS [a] INNER JOIN [GroupUser] AS [b] ON [a].[UserID] = [b].[UserID] INNER JOIN [Group] AS [c] ON [b].[GroupID] = [c].[GroupID] LEFT JOIN [GroupEntries] AS [d] ON [a].[GroupID] = [d].[GroupID] WHERE [a].[UserID] = @UserID At the end, basically what I would like is an enumerable object full of GroupEntry objects. What am interested is the last two tables/objects in this query. I will be displaying Groups as a group header, and all of the Entries underneath their group heading. If there are no entries for a group, I still want to see that group as a header without any entries. Here's what I have so far: So from that I'd like to make a function: public void DisplayEntriesByUser(int user_id) { MyDataContext db = new MyDataContext(); IEnumberable<GroupEntries> entries = ( from user in db.Users where user.UserID == user_id join group_user in db.GroupUsers on user.UserID = group_user.UserID into a from join1 in a join group in db.Groups on join1.GroupID equals group.GroupID into b from join2 in b join entry in db.Entries.DefaultIfEmpty() on join2.GroupID equals entry.GroupID select entry ); Group last_group_id = 0; foreach(GroupEntry entry in entries) { if (last_group_id == 0 || entry.GroupID != last_group_id) { last_group_id = entry.GroupID; System.Console.WriteLine("---{0}---", entry.Group.GroupName.ToString().ToUpper()); } if (entry.EntryID) { System.Console.WriteLine(" {0}: {1}", entry.Title, entry.Text); } } } The example above does not work quite as expected. There are 2 problems that I have not been able to solve: I still seem to be getting an INNER JOIN instead of a LEFT JOIN on the last join. I am not getting any empty results, so groups without entries do not appear. I need to figure out a way so that I can fill in the default values for blank sets of entries. That is, if there is a group without an entry, I would like to have a mostly blank entry returned, except that I'd want the EntryID to be null or 0, the GroupID to be that of of the empty group that it represents, and I'd need a handle on the entry.Group object (i.e. it's parent, empty Group object). Any help on this would be greatly appreciated. Note: Table names and real-world representation were derived purely for this example, but their relations simplify what I'm trying to do.

    Read the article

  • MySQL won't start, reinstall fails on Ubuntu 12.04

    - by Evils
    My problem started yesterday night when I tried to change the my.cnf config on my ubuntu 12.04 x64 System. I simply tried to changed the bind-address parameter from 127.0.0.1 to 0.0.0.0. A simple restart after a reboot gave this error: stop: Unknown instance: start: Job failed to start I tried to start mysql then by using 'mysqld' which outputs this: 130701 11:05:59 [Note] Plugin 'FEDERATED' is disabled. mysqld: Table 'mysql.plugin' doesn't exist 130701 11:05:59 [ERROR] Can't open the mysql.plugin table. Please run mysql_upgrade to create it. 130701 11:05:59 InnoDB: The InnoDB memory heap is disabled 130701 11:05:59 InnoDB: Mutexes and rw_locks use GCC atomic builtins 130701 11:05:59 InnoDB: Compressed tables use zlib 1.2.3.4 130701 11:05:59 InnoDB: Initializing buffer pool, size = 128.0M 130701 11:05:59 InnoDB: Completed initialization of buffer pool 130701 11:05:59 InnoDB: highest supported file format is Barracuda. 130701 11:05:59 InnoDB: Waiting for the background threads to start 130701 11:06:00 InnoDB: 5.5.31 started; log sequence number 1595675 130701 11:06:00 [Note] Server hostname (bind-address): '127.0.0.1'; port: 3306 130701 11:06:00 [Note] - '127.0.0.1' resolves to '127.0.0.1'; 130701 11:06:00 [Note] Server socket created on IP: '127.0.0.1'. 130701 11:06:00 [ERROR] Can't start server : Bind on unix socket: Permission denied 130701 11:06:00 [ERROR] Do you already have another mysqld server running on socket: /var/run/mysqld/mysqld.sock ? 130701 11:06:00 [ERROR] Aborting 130701 11:06:00 InnoDB: Starting shutdown... 130701 11:06:00 InnoDB: Shutdown completed; log sequence number 1595675 130701 11:06:00 [Note] mysqld: Shutdown complete Meanwhile I already tried to reinstall and purge the complete mysql package which results in another error which says that dpkg cant change the admins password. While this error appeared another error came with it. When trying to install something new with apt, it always says 'fopen: permission denied' right after it tries to update my man-db. This is my dmesg output: [ 6879.687998] type=1400 audit(1372669683.397:36): apparmor="STATUS" operation="profile_replace" name="/usr/sbin/mysqld" pid=9336 comm="apparmor_parser" [ 6881.323215] init: mysql main process (9340) terminated with status 1 [ 6881.323316] init: mysql respawning too fast, stopped Any help will be appreciated as this is a productive server which renders useless without mysql.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • adding Buttons to Columns in Datagride view

    - by kasunmit
    HiHi, I wrote C# application for import unread e-mails from outlook 2007, I could import sender name, sender mail address,subject and body to data grid view as following foreach (Microsoft.Office.Interop.Outlook._MailItem mailItem in fldEmails.Items) { if (mailItem.UnRead) { UnreadEmails mail = new UnreadEmails(); // mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : mailItem.Attachments.Session.OpenSharedItem; foreach (Microsoft.Office.Interop.Outlook.Attachment Atmt in mailItem.Attachments) { mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : Atmt.DisplayName; } emails.Add(mail); } } UnreadEmails is a separte class. but couldn't find a way to import attachments (word pdf ppt excel) because i need it for my filter pls help me about it but i could import inly name of the attachment but i need to import attachment content (word, pdf , ppt .. atc. ) to this data grid pls tell how i can do it ... with the code

    Read the article

  • How to decrypt a string encrypted with HMACSHA1?

    - by Bob
    I'm an encryption novice trying to pass some values back and forth between systems. I can encrypt the value, but can't seem to figure out how to decrypt on the other end. I've created a simple Windows Forms application using VB.NET. Trying to input a value and a key, encrypt and then decrypt to get the original value. Here's my code so far. Any help greatly appreciated. Thanks. Imports System Imports System.IO Imports System.Security.Cryptography Imports System.Text Public Class Form1 Private Sub btnEncode_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnEncode.Click Dim hmacsha1 As New HMACSHA1(Encoding.ASCII.GetBytes(txtKey.Text)) Dim hashValue As Byte() = hmacsha1.ComputeHash(Encoding.ASCII.GetBytes(txtValue.Text)) txtResult.Text = BytesToHexString(hashValue) hmacsha1.Clear() End Sub Private Sub btnDecode_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnDecode.Click '??? End Sub Private Function BytesToHexString(ByVal bytes As Byte()) As String Dim output As String = String.Empty Dim i As Integer = 0 Do While i < bytes.Length output += bytes(i).ToString("X2") i += 1 Loop Return output End Function End Class

    Read the article

  • Quickly navigating Emacs buffers on a dual display setup

    - by mwilliams
    If I have an Emacs frame on each of my displays, how can I easily navigate buffers between the two displays? I typically use shift + arrows to jump to the direction of the buffer I'm looking for, but with two frames, it won't jump. Is there a trick to this? Or do I need to give the other Emacs frame focus first (which is a step I would like to avoid).

    Read the article

  • Range annotation between nothing and 100?

    - by aticatac
    Hi I have a [Range] annotation that looks like this: [Range(0, 100)] public int AvailabilityGoal { get; set; } It works as it should, I can only enter values between 0 and 100 but I also want the input box to be optional, the user shouldn't get an validation error if the input box is empty. If the user leaves it empty it should make AvailabilityGoal = 0 but I don't want to force the user to enter a zero. I tried this but it (obviously) didn't work: [Range(typeof(int?), null, "100")] Is it possible to solve this with Data Annotations or in some other way? Thanks in advance. Bobby

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • How do I full-screen my CMD?

    - by Codemonkey
    I work a LOT in the windows command line. Unlike other windows, it doesn't maximize - it just goes a big as it can depending on the buffer size. Is there any way I can get the CMD to act like the PuTTY console, flowing with the resize? NOTE: The answer doesn't have to be a tweak to the CMD. If there's a PuTTY-like program out there that will work between me and the command line I'm happy with that - I just want a proper window to work in

    Read the article

  • Jquery .wrap and first-child

    - by Johann
    Hi, I'm in a situation in which I need to use .wrap and :first-child. This is what I am doing: <script>$("a").wrap("<div class='category-wrapper'></div>");</script> <script>$("div.category-wrapper:first-child").addClass("first");</script> This should render a div.category-wrapper outside a link and then add a "first" class to every first div.category-wrapper. The output is: <div class="category-wrapper"><a href="#">Test</a></div> Which is good! However, I am not able to get the "first-child" to work (it doesn't adds the "first" class). If I use it somewhere else it works so I am sure it's something related to the dynamic rendering of the previous element. Any help is appreciated! Thanks! Sample output would be: <div class="category-wrapper"><a href="#">Test #1</a></div> <div class="category-wrapper"><a href="#">Test #2</a></div> <div class="category-wrapper"><a href="#">Test #3</a></div> <div class="category-wrapper"><a href="#">Test #4</a></div> Desired output: <div class="category-wrapper first"><a href="#">Test #1</a></div> <div class="category-wrapper"><a href="#">Test #2</a></div> <div class="category-wrapper"><a href="#">Test #3</a></div> <div class="category-wrapper"><a href="#">Test #4</a></div> However, I am not able to make it work.

    Read the article

  • UTF-8 MySQL and Charset, pls help me understand this once and for all!

    - by FFish
    Can someone explain me when I set everything to UTF-8 I keep getting those damn ??? MySQL Server version: 5.1.44 MySQL charset: UTF-8 Unicode (utf8) I create a new database name: utf8test collation: utf8_general_ci MySQL connection collation: utf8_general_ci My SQL looks like this: SET SQL_MODE="NO_AUTO_VALUE_ON_ZERO"; CREATE TABLE IF NOT EXISTS `test_table` ( `test_id` int(11) NOT NULL, `test_text` text NOT NULL, PRIMARY KEY (`test_id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; INSERT INTO `test_table` (`test_id`, `test_text`) VALUES (1, 'hééélo'), (2, 'wööörld'); My PHP / HTML: <?php $db_conn = mysql_connect("localhost", "root", "") or die("Can't connect to db"); mysql_select_db("utf8test", $db_conn) or die("Can't select db"); // $result = mysql_query("set names 'utf8'"); // this works... why?? $query = "SELECT * FROM test_table"; $result = mysql_query($query); $output = ""; while($row = mysql_fetch_assoc($result)) { $output .= "id: " . $row['test_id'] . " - text: " . $row['test_text'] . "<br />"; } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html lang="it" xmlns="http://www.w3.org/1999/xhtml" xml:lang="it"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>UTF-8 test</title> </head> <body> <?php echo $output; ?> </body> </html>

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >