Search Results

Search found 27946 results on 1118 pages for 'output buffer empty'.

Page 281/1118 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • UTF-8 MySQL and Charset, pls help me understand this once and for all!

    - by FFish
    Can someone explain me when I set everything to UTF-8 I keep getting those damn ??? MySQL Server version: 5.1.44 MySQL charset: UTF-8 Unicode (utf8) I create a new database name: utf8test collation: utf8_general_ci MySQL connection collation: utf8_general_ci My SQL looks like this: SET SQL_MODE="NO_AUTO_VALUE_ON_ZERO"; CREATE TABLE IF NOT EXISTS `test_table` ( `test_id` int(11) NOT NULL, `test_text` text NOT NULL, PRIMARY KEY (`test_id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; INSERT INTO `test_table` (`test_id`, `test_text`) VALUES (1, 'hééélo'), (2, 'wööörld'); My PHP / HTML: <?php $db_conn = mysql_connect("localhost", "root", "") or die("Can't connect to db"); mysql_select_db("utf8test", $db_conn) or die("Can't select db"); // $result = mysql_query("set names 'utf8'"); // this works... why?? $query = "SELECT * FROM test_table"; $result = mysql_query($query); $output = ""; while($row = mysql_fetch_assoc($result)) { $output .= "id: " . $row['test_id'] . " - text: " . $row['test_text'] . "<br />"; } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html lang="it" xmlns="http://www.w3.org/1999/xhtml" xml:lang="it"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>UTF-8 test</title> </head> <body> <?php echo $output; ?> </body> </html>

    Read the article

  • Jquery .wrap and first-child

    - by Johann
    Hi, I'm in a situation in which I need to use .wrap and :first-child. This is what I am doing: <script>$("a").wrap("<div class='category-wrapper'></div>");</script> <script>$("div.category-wrapper:first-child").addClass("first");</script> This should render a div.category-wrapper outside a link and then add a "first" class to every first div.category-wrapper. The output is: <div class="category-wrapper"><a href="#">Test</a></div> Which is good! However, I am not able to get the "first-child" to work (it doesn't adds the "first" class). If I use it somewhere else it works so I am sure it's something related to the dynamic rendering of the previous element. Any help is appreciated! Thanks! Sample output would be: <div class="category-wrapper"><a href="#">Test #1</a></div> <div class="category-wrapper"><a href="#">Test #2</a></div> <div class="category-wrapper"><a href="#">Test #3</a></div> <div class="category-wrapper"><a href="#">Test #4</a></div> Desired output: <div class="category-wrapper first"><a href="#">Test #1</a></div> <div class="category-wrapper"><a href="#">Test #2</a></div> <div class="category-wrapper"><a href="#">Test #3</a></div> <div class="category-wrapper"><a href="#">Test #4</a></div> However, I am not able to make it work.

    Read the article

  • Somewhat lost with jquery + php + json

    - by Luis Armando
    I am starting to use the jquery $.ajax() but I can't get back what I want to...I send this: $(function(){ $.ajax({ url: "graph_data.php", type: "POST", data: "casi=56&nada=48&nuevo=98&perfecto=100&vales=50&apenas=70&yeah=60", dataType: "json", error: function (xhr, desc, exceptionobj) { document.writeln("El error de XMLHTTPRequest dice: " + xhr.responseText); }, success: function (json) { if (json.error) { alert(json.error); return; } var output = ""; for (p in json) { output += p + " : " + json[p] + "\n"; } document.writeln("Results: \n\n" + output); } }); }); and my php is: <?php $data = $_POST['data']; function array2json($data){ $json = $data; return json_encode($json); } ?> and when I execute this I come out with: Results: just like that I used to have in the php a echo array2json statement but it just gave back gibberish...I really don't know what am I doing wrong and I've googled for about 3 hours just getting basically the same stuff. Also I don't know how to pass parameters to the "data:" in the $.ajax function in another way like getting info from the web page, can anyone please help me? Edit I did what you suggested and it prints the data now thank you very much =) however, I was wondering, how can I send the data to the "data:" part in jQuery so it takes it from let's say user input, also I was checking the php documentation and it says I'm allowed to write something like: json_encode($a,JSON_HEX_TAG|JSON_HEX_APOS|JSON_HEX_QUOT|JSON_HEX_AMP) however, if I do that I get an error saying that json_encode accepts 1 parameter and I'm giving 2...any idea why? I'm using php 5.2

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • Java Compiler Creation Help..Please

    - by Brian
    I need some help with my code here...What we are trying to do is make a compiler that will read a file containing Machine Code and converting it to 100 lines of 4 bits example: this code is the machine code being converting to opcode and operands. I need some help please.. thanks 799 798 198 499 1008 1108 899 909 898 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Everything compiles but when I go and run my Test.java I get the following OutPut: Exception in thread "main" java.util.NoSuchElementException: No line found at java.util.Scanner.nextLine(Scanner.java:1516) at Compiler.FirstPass(Compiler.java:22) at Compiler.compile(Compiler.java:11) at Test.main(Test.java:5) Here is my class Compiler: import java.io.*; import java.io.DataOutputStream; import java.util.NoSuchElementException; import java.util.Scanner; class Compiler{ private int lc = 0; private int dc = 99; public void compile(String filename) { SymbolList symbolTable = FirstPass(filename); SecondPass(symbolTable, filename); } public SymbolList FirstPass(String filename) { File file = new File(filename); SymbolList temp = new SymbolList(); int dc = 99; int lc = 0; try{ Scanner scan = new Scanner(file); String line = scan.nextLine(); String[] linearray = line.split(" "); while(line!=null){ if(!linearray[0].equals("REM")){ if(!this.isInstruction(linearray[0])){ linearray[0]=removeColon(linearray[0]); if(this.isInstruction(linearray[1])){ temp.add(new Symbol(linearray[0], lc, null)); lc++; } else { temp.add(new Symbol(linearray[0], dc, Integer.valueOf((linearr\ ay[2])))); dc--; } } else { if(!linearray[0].equals("REM")) lc++; } } try{ line = scan.nextLine(); } catch(NoSuchElementException e){ line=null; break; } linearray = line.split(" "); } } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } return temp; } public String makeFilename(String filename) { return filename + ".ex"; } public String removeColon(String str) { if(str.charAt(str.length()-1) == ':'){ return str.substring(0, str.length()-1); } else { return str; } } public void SecondPass(SymbolList symbolTable, String filename){ try { int dc = 99; //Open file for reading File file = new File(filename); Scanner scan = new Scanner(file); //Make filename of new executable file String newfile = makeFilename(filename); //Open Output Stream for writing new file. FileOutputStream os = new FileOutputStream(filename); DataOutputStream dos = new DataOutputStream(os); //Read First line. Split line by Spaces into linearray. String line = scan.nextLine(); String[] linearray = line.split(" "); while(scan.hasNextLine()){ if(!linearray[0].equals("REM")){ int inst=0, opcode, loc; if(isInstruction(linearray[0])){ opcode = getOpcode(linearray[0]); loc = symbolTable.searchName(linearray[1]).getMemloc(); inst = (opcode*100)+loc; } else if(!isInstruction(linearray[0])){ if(isInstruction(linearray[1])){ opcode = getOpcode(linearray[1]); if(linearray[1].equals("STOP")) inst=0000; else { loc = symbolTable.searchName(linearray[2]).getMemloc(); inst = (opcode*100)+loc; } } if(linearray[1].equals("DC")) dc--; } System.out.println(inst); dos.writeInt(inst); linearray = line.split(" "); } if(scan.hasNextLine()) { line = scan.nextLine(); } } scan.close(); for(int i = lc; i <= dc; i++) { dos.writeInt(0); } for(int i = dc+1; i<100; i++){ dos.writeInt(symbolTable.searchLocation(i).getValue()); if(i!=99) dos.writeInt(0); } dos.close(); os.close(); } catch (Exception e) { // TODO Auto-generated catch block e.printStackTrace(); } } public int getOpcode(String inst){ int toreturn = -1; if(isInstruction(inst)){ if(inst.equals("STOP")) toreturn=0; if(inst.equals("LD")) toreturn=1; if(inst.equals("STO")) toreturn=2; if(inst.equals("ADD")) toreturn=3; if(inst.equals("SUB")) toreturn=4; if(inst.equals("MPY")) toreturn=5; if(inst.equals("DIV")) toreturn=6; if(inst.equals("IN")) toreturn=7; if(inst.equals("OUT")) toreturn=8; if(inst.equals("B")) toreturn=9; if(inst.equals("BGTR")) toreturn=10; if(inst.equals("BZ")) toreturn=11; return toreturn; } else { return -1; } } public boolean isInstruction(String totest){ boolean toreturn = false; String[] labels = {"IN", "LD", "SUB", "BGTR", "BZ", "OUT", "B", "STO", "STOP", "AD\ D", "MTY", "DIV"}; for(int i = 0; i < 12; i++){ if(totest.equals(labels[i])) toreturn = true; } return toreturn; } } And here is my class Computer: import java.io.*; import java.util.NoSuchElementException; import java.util.Scanner; class Computer{ private Cpu cpu; private Input in; private OutPut out; private Memory mem; public Computer() throws IOException { Memory mem = new Memory(100); Input in = new Input(); OutPut out = new OutPut(); Cpu cpu = new Cpu(); System.out.println(in.getInt()); } public void run() throws IOException { cpu.reset(); cpu.setMDR(mem.read(cpu.getMAR())); cpu.fetch2(); while (!cpu.stop()) { cpu.decode(); if (cpu.OutFlag()) OutPut.display(mem.read(cpu.getMAR())); if (cpu.InFlag()) mem.write(cpu.getMDR(),in.getInt()); if (cpu.StoreFlag()) { mem.write(cpu.getMAR(),in.getInt()); cpu.getMDR(); } else { cpu.setMDR(mem.read(cpu.getMAR())); cpu.execute(); cpu.fetch(); cpu.setMDR(mem.read(cpu.getMAR())); cpu.fetch2(); } } } public void load() { mem.loadMemory(); } } Here is my Memory class: import java.io.*; import java.util.NoSuchElementException; import java.util.Scanner; class Memory{ private MemEl[] memArray; private int size; private int[] mem; public Memory(int s) {size = s; memArray = new MemEl[s]; for(int i = 0; i < s; i++) memArray[i] = new MemEl(); } public void write (int loc,int val) {if (loc >=0 && loc < size) memArray[loc].write(val); else System.out.println("Index Not in Domain"); } public int read (int loc) {return memArray[loc].read(); } public void dump() { for(int i = 0; i < size; i++) if(i%1 == 0) System.out.println(memArray[i].read()); else System.out.print(memArray[i].read()); } public void writeTo(int location, int value) { mem[location] = value; } public int readFrom(int location) { return mem[location]; } public int size() { return mem.length; } public void loadMemory() { this.write(0, 799); this.write(1, 798); this.write(2, 198); this.write(3, 499); this.write(4, 1008); this.write(5, 1108); this.write(6, 899); this.write(7, 909); this.write(8, 898); this.write(9, 0000); } public void loadFromFile(String filename){ try { FileReader fr = new FileReader(filename); BufferedReader br = new BufferedReader(fr); String read=null; int towrite=0; int l=0; do{ try{ read=br.readLine(); towrite = Integer.parseInt(read); }catch(Exception e){ } this.write(l, towrite); l++; }while(l<100); }catch (Exception e) { // TODO Auto-generated catch block e.printStackTrace(); } } } Here is my Test class: public class Test{ public static void main(String[] args) throws java.io.IOException { Compiler compiler = new Compiler(); compiler.compile("program.txt"); } }

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • iPhone SpeakHere example produces different number of samples

    - by pion
    I am looking at the SpeakHere example and added the following: // Overriding the output audio route UInt32 audioRouteOverride = kAudioSessionOverrideAudioRoute_Speaker; AudioSessionSetProperty(kAudioSessionProperty_OverrideAudioRoute, sizeof (audioRouteOverride), &audioRouteOverride); assert(status == noErr); // Changing the default output route. The new output route remains in effect unless you change the audio session category. This option is available starting in iPhone OS 3.1. UInt32 doChangeDefaultRoute = 1; status = AudioSessionSetProperty(kAudioSessionProperty_OverrideCategoryDefaultToSpeaker, sizeof(doChangeDefaultRoute), &doChangeDefaultRoute); assert(status == noErr); // Enable Bluetooth. See audioRouteOverride & doChangeDefaultRoute above // http://developer.apple.com/iphone/library/documentation/Audio/Conceptual/AudioSessionProgrammingGuide/Cookbook/Cookbook.html#//apple_ref/doc/uid/TP40007875-CH6-SW2 UInt32 allowBluetoothInput = 1; status = AudioSessionSetProperty(kAudioSessionProperty_OverrideCategoryEnableBluetoothInput, sizeof(allowBluetoothInput), &allowBluetoothInput); assert(status == noErr); Also, void AQRecorder::handleInputBufferCallback(void *aqData, ... ... if (inNumPackets > 0) { NSLog(@"Number of samples = %d", inBuffer->mAudioDataByteSize/2); // print out the number of sample status = AudioFileWritePackets(aqr->mAudioFile, FALSE, inBuffer->mAudioDataByteSize, inPacketDesc, aqr->mCurrentPacket, &inNumPackets, inBuffer->mAudioData); assert(status == noErr); aqr->mCurrentPacket += inNumPackets; } ... Notice the "NSLog(@"Number of samples = %d", inBuffer-mAudioDataByteSize/2); // print out the number of sample" statement above. I am using iPhone SDK 3.1.3. I got the following results The number of samples is around 44,100 on Simulator The number of samples is around 22,000 on iPhone The number of samples is around 4,000 on iPhone using Jawbone Bluetooth I am new on this. Why did itproduce different number of samples? Thanks in advance for your help.

    Read the article

  • Subversion commit failed on Mac OS X with error "no such table: rep_cache"

    - by arun
    I created a subversion repository, imported an empty structure, checked out the repo, added a file to the working copy and tried commiting the working copy with the following commands: svnadmin create mysvn svn import -m "initial empty structure" test/ file:///tmp/mysvn svn co file:///tmp/mysvn mywc svn ci -m "test" The commit failed with the following error: Transmitting file data .svn: Commit failed (details follow): svn: While preparing '/tmp/mywc' for commit svn: no such table: rep_cache I am running Mac OS X 10.6.3 and subversion 1.6.5. Did I miss any steps or Mac specific commands? Thanks for your help.

    Read the article

  • how to add special class for labels and errors on zend form elements?

    - by user1400
    hello how we could add a special class for labels and errors for a zend-form-element for example html output code before add classes <dt id="username-label"><label for="username" class="required">user name:</label></dt> <dd id="username-element"> <input type="text" name="username" id="username" value="" class="input" /> <ul class="errors"><li>Value is required and can't be empty</li></ul></dd> and code after we add classes <dt id="username-label"><label for="username" **class="req-username"**>user name:</label></dt> <dd id="username-element"> <input type="text" name="username" id="username" value="" class="input" /> <ul **class="err-username"**><li>Value is required and can't be empty</li></ul></dd> thanks

    Read the article

  • Start dependent application with eunit

    - by ruslander
    I start lager as a dependent application when I run a unit test but for some reason the code under test does not see it. -module(main_tests). -include_lib("eunit/include/eunit.hrl"). main_test_() -> {foreach, fun distr_setup/0, fun distr_cleanup/1, [ fun must_retain/1 ]}. must_retain(_) -> {"Should do ping pong when is fully initialized", fun() -> ?assertEqual(pong, abuse_counter:ping()) end}. %%------------------------------------------------------------------ distr_setup() -> abuse_counter:start_link(), ok. distr_cleanup(_) -> abuse_counter:stop(), ok. Here is the output of the log which is complaining that lager is not defined {undef,[{lager,info,["up and running"],[]} though in the run output is definitely there. Here is how I run it: erl -pa ebin/ ../../deps/*/ebin -s lager -eval 'eunit:test(main_tests,[verbose]), init:stop().' Fails with the output Eshell V5.10.2 (abort with ^G) 1> 17:13:31.506 [info] Application lager started on node nonode@nohost ======================== EUnit ======================== module 'main_tests' undefined 17:13:31.528 [error] CRASH REPORT Process <0.57.0> with 1 neighbours exited with reason: call to undefined function lager:info("up and running") in gen_server:init_it/6 line 328 *unexpected termination of test process* ::**{undef,[{lager,info,["up and running"],[]}**, {abuse_counter,init,1,[{file,"src/abuse_counter.erl"},{line,37}]}, {gen_server,init_it,6,[{file,"gen_server.erl"},{line,304}]}, {proc_lib,init_p_do_apply,3,[{file,"proc_lib.erl"},{line,239}]}]} ======================================================= Failed: 0. Skipped: 0. Passed: 0. One or more tests were cancelled. Already spent 3-4h hours on google and stack overflow but nothing seems to work. One option is to hide this call behind a ?INFO(Mgs) macro but do not like the idea. Any help will be highly appreciated.

    Read the article

  • wsgi django not working

    - by MaKo
    im installing django, the test for wsgi is ok, but when i point my default file to the django test, it doesnt work, this is the test that works fine: default: /etc/apache2/sites-available/default <VirtualHost *:80> ServerName www.example.com ServerAlias example.com ServerAdmin [email protected] DocumentRoot /var/www <Directory /var/www/documents> Order allow,deny Allow from all </Directory> WSGIScriptAlias / /home/ubuntu/djangoProj/micopiloto/application.wsgi <Directory /home/ubuntu/djangoProj/mysitio/wsgi_handler.py> Order allow,deny Allow from all </Directory> </VirtualHost> application.wsgi:: ~/djangoProj/micopiloto import os import sys sys.path.append('/srv/www/cucus/application') os.environ['PYTHON_EGG_CACHE'] = '/srv/www/cucus/.python-egg' def application(environ, start_response): status = '200 OK' output = 'Hello World!MK SS9 tkt kkk' response_headers = [('Content-type', 'text/plain'), ('Content-Length', str(len(output)))] start_response(status, response_headers) return [output] but if I change the default to point to application_sa.wsgi the django test, it doesnt work :( application_sa.wsgi import os, sys sys.path.append('/home/ubuntu/djangoProj/micopiloto') os.environ['DJANGO_SETTINGS_MODULE'] = 'micopiloto.settings' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() I restart the apache server every time i change the wsgi to test, so what im i missing? thanks a lot!

    Read the article

  • Array: Recursive problem cracked me up

    - by VaioIsBorn
    An array of integers A[i] (i 1) is defined in the following way: an element A[k] ( k 1) is the smallest number greater than A[k-1] such that the sum of its digits is equal to the sum of the digits of the number 4* A[k-1] . You need to write a program that calculates the N th number in this array based on the given first element A[1] . INPUT: In one line of standard input there are two numbers seperated with a single space: A[1] (1 <= A[1] <= 100) and N (1 <= N <= 10000). OUTPUT: The standard output should only contain a single integer A[N] , the Nth number of the defined sequence. Input: 7 4 Output: 79 Explanation: Elements of the array are as follows: 7, 19, 49, 79... and the 4th element is solution. I tried solving this by coding a separate function that for a given number A[k] calculates the sum of it's digits and finds the smallest number greater than A[k-1] as it says in the problem, but with no success. The first testing failed because of a memory limit, the second testing failed because of a time limit, and now i don't have any possible idea how to solve this. One friend suggested recursion, but i don't know how to set that. Anyone who can help me in any way please write, also suggest some ideas about using recursion/DP for solving this problem. Thanks.

    Read the article

  • what is the programmatic parlance for this phenomenon?

    - by deostroll
    Here is javascript code (jquery) for adding a row of images: var tr = $('<tr>'); var td = '<td><img src="myimg.jpg"/></td>'; tr.append(td).append(td).append(td); $('#mytable tbody tr:eq(0)').before(tr); tr.empty(); //I really don't need this line... Technically tr.empty() shouldn't have worked. It actually does the opposite of what I want. What is the techinical term for this behaviour - You've added tr to the DOM, but any jquery function calls to that object still works, where as you'd normally not expect it to work i.e. make changes to the DOM?

    Read the article

  • youtube - video upload failure - unable to convert file - encoding the video wrong?

    - by Anthony
    I am using .NET to create a video uploading application. Although it's communicating with YouTube and uploading the file, the processing of that file fails. YouTube gives me the error message, "Upload failed (unable to convert video file)." This supposedly means that "your video is in a format that our converters don't recognize..." I have made attempts with two different videos, both of which upload and process fine when I do it manually. So I suspect that my code is a.) not encoding the video properly and/or b.) not sending my API request properly. Below is how I am constructing my API PUT request and encoding the video: Any suggestions on what the error could be would be appreciated. Thanks P.S. I'm not using the client library because my application will use the resumable upload feature. Thus, I am manually constructing my API requests. Documentation: http://code.google.com/intl/ja/apis/youtube/2.0/developers_guide_protocol_resumable_uploads.html#Uploading_the_Video_File Code: // new PUT request for sending video WebRequest putRequest = WebRequest.Create(uploadURL); // set properties putRequest.Method = "PUT"; putRequest.ContentType = getMIME(file); //the MIME type of the uploaded video file //encode video byte[] videoInBytes = encodeVideo(file); public static byte[] encodeVideo(string video) { try { byte[] fileInBytes = File.ReadAllBytes(video); Console.WriteLine("\nSize of byte array containing " + video + ": " + fileInBytes.Length); return fileInBytes; } catch (Exception e) { Console.WriteLine("\nException: " + e.Message + "\nReturning an empty byte array"); byte [] empty = new byte[0]; return empty; } }//encodeVideo //encode custom headers in a byte array byte[] PUTbytes = encode(putRequest.Headers.ToString()); public static byte[] encode(string headers) { ASCIIEncoding encoding = new ASCIIEncoding(); byte[] bytes = encoding.GetBytes(headers); return bytes; }//encode //entire request contains headers + binary video data putRequest.ContentLength = PUTbytes.Length + videoInBytes.Length; //send request - correct? sendRequest(putRequest, PUTbytes); sendRequest(putRequest, videoInBytes); public static void sendRequest(WebRequest request, byte[] encoding) { Stream stream = request.GetRequestStream(); // The GetRequestStream method returns a stream to use to send data for the HttpWebRequest. try { stream.Write(encoding, 0, encoding.Length); } catch (Exception e) { Console.WriteLine("\nException writing stream: " + e.Message); } }//sendRequest

    Read the article

  • adding Buttons to Columns in Datagride view

    - by kasunmit
    HiHi, I wrote C# application for import unread e-mails from outlook 2007, I could import sender name, sender mail address,subject and body to data grid view as following foreach (Microsoft.Office.Interop.Outlook._MailItem mailItem in fldEmails.Items) { if (mailItem.UnRead) { UnreadEmails mail = new UnreadEmails(); // mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : mailItem.Attachments.Session.OpenSharedItem; foreach (Microsoft.Office.Interop.Outlook.Attachment Atmt in mailItem.Attachments) { mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : Atmt.DisplayName; } emails.Add(mail); } } UnreadEmails is a separte class. but couldn't find a way to import attachments (word pdf ppt excel) because i need it for my filter pls help me about it but i could import inly name of the attachment but i need to import attachment content (word, pdf , ppt .. atc. ) to this data grid pls tell how i can do it ... with the code

    Read the article

  • How to add a specific class to an input which has generated a form error?

    - by Kamil Mroczek
    I want to add a specific class to an input if an error is genereted by the input. For example, if input is empty and has required validator it shouls look like this: <dd id="login-element"> <input type="text" name="login" id="login" value="" class="input-text error" /> <ul class="errors"> <li>Value is required and can't be empty</li> </ul> </dd> class="input-text error" Please tell me how to do that.

    Read the article

  • tricky interview question for C++

    - by Alexander
    Given the code below. How would you create/implement SR.h so that it produces the correct output WITHOUT any asterix in your solution? I got bummed by this question #include <cstdio> #include "SR.h" int main() { int j = 5; int a[] = {10, 15}; { SR x(j), y(a[0]), z(a[1]); j = a[0]; a[0] = a[1]; a[1] = j; printf("j = %d, a = {%d, %d}\n", j, a[0], a[1]); } printf("j = %d, a = {%d, %d}\n", j, a[0], a[1]); } //output j = 10, a = {15, 10} j = 5, a = {10, 15} #include <cstdio> #include "SR.h" int main() { int sum = 0; for (int i = 1; i < 100; i++) { SR ii(i); while (i--) sum += i; } printf("sum = %d\n", sum); } //The output is "sum = 161700".

    Read the article

  • JQuery selector in variable

    - by nagut
    I wanted to ask about using selector from a variable first I have: function check() { $('.info input, .info select').each(function(n, element){ if ($(element).val()=='') alert('empty'); }); } and called it in $('input')change(check); and they worked fine. But now I want to pass some value to the function to make it dynamic, like $('input')change(check('.info')); and changed the function to function check(sel) { $(sel +' input, '+ sel + ' select').each(function(n, element){ if ($(element).val()=='') alert('empty'); }); } but it doesn't work. Any help please.. Thanks, nagut

    Read the article

  • How to disable or tune filesystem cache sharing for OpenVZ?

    - by gertvdijk
    For OpenVZ, an example of container-based virtualization, it seems that host and all guests are sharing the filesystem cache. This sounds paradoxical when talking about virtualization, but this is actually a feature of OpenVZ. It makes sense too. Because only one kernel is running, it's possible to benefit from sharing the same pages of filesystem cache in memory. And while it sounds beneficial, I think a set up here actually suffers in performance from it. Here's why I think why: my machines aren't actually sharing any files on disk so I can't benefit from this feature in OpenVZ. Several OpenVZ machines are running MySQL with MyISAM tables. MyISAM relies on the system's filesystem cache for caching of data files, unlike InnoDB's buffer pool. Also some virtual machines are known to do heavy and large I/O operations on the same filesystem in the host. For example, when running cat *.MYD > /dev/null on some large database in one machine, I saw the filesystem cache lowering in another, monitored by htop. This essentially flushes all the useful filesystem cache in guests (FIFO) and so it flushes the MySQL caches in the guests. Now users are complaining that MySQL is very slow. And it is. Some simple SELECT queries take several seconds on times disk I/O is heavily used by other machines. So, simply put: Is there a way to avoid filesystem cache being wiped out by other virtual machines in container-based virtualization? Some thoughts: Choosing algorithm for flushing filesystem cache in the kernel. (possible? how?) Reserving a certain amount of pages for a single VM. (seems no option for filesystem cache type of pages that reading man vzctl) Will running MySQL on another filesystem get me anywhere? If not, I think my alternatives are: Use KVM for MySQL-MyISAM running VMs. KVM actually assigns memory to the VM and does not allow swapping out caches unless using a balloon driver. Move to InnoDB and tune the buffer pools, dirty pages, etc. This is now considered to be 'nice to have' on the long-term as not everyone responsible for administration of the system understands InnoDB. more suggestions welcome. System software: Proxmox (now 1.9, could be upgraded to 2.x). One big LV assigned for the VMs.

    Read the article

  • Giving 'TemplateError' can't convert String into Integer

    - by Gagan
    Hi, I recently transfered my app from Rails2 to Rails3. The code in 'app/views/distribution/index.html.erb' is like :- <div style="padding-bottom:10px; padding-left:0px;float:left;display:<%= (!session[:album][@artist.id.to_s].empty? && !session[:album][@artist.id.to_s].nil?)?'block' : 'none' %>" id = "make_payment_enabled"> <%= link_to 'Make Payments',{:action => 'pay', :album=>@album.id}, :class => "button" %> </div> It's giving me TemplateError on line :- <div style="padding-bottom:10px; padding-left:0px;float:left;display:<%= (!session[:album][@artist.id.to_s].empty? && !session[:album][@artist.id.to_s].nil?)?'block' : 'none' %>" id = "make_payment_enabled"> How to resolve the problem ?

    Read the article

  • Alternative to using c:out to prevent XSS

    - by lynxforest
    I'm working on preventing cross site scripting (XSS) in a Java, Spring based, Web application. I have already implemented a servlet filter similar to this example http://greatwebguy.com/programming/java/simple-cross-site-scripting-xss-servlet-filter/ which sanitizes all the input into the application. As an extra security measure I would like to also sanitize all output of the application in all JSPs. I have done some research to see how this could be done and found two complementary options. One of them is the use of Spring's defaultHtmlEscape attribute. This was very easy to implement (a few lines in web.xml), and it works great when your output is going through one of spring's tags (ie: message, or form tags). The other option I have found is to not directly use EL expressions such as ${...} and instead use <c:out value="${...}" /> That second approach works perfectly, however due to the size of the application I am working on (200+ JSP files). It is a very cumbersome task to have to replace all inappropriate uses of EL expressions with the c:out tag. Also it would become a cumbersome task in the future to make sure all developers stick to this convention of using the c:out tag (not to mention, how much more unreadable the code would be). Is there alternative way to escape the output of EL expressions that would require fewer code modifications? Thank you in advance.

    Read the article

  • Quickly navigating Emacs buffers on a dual display setup

    - by mwilliams
    If I have an Emacs frame on each of my displays, how can I easily navigate buffers between the two displays? I typically use shift + arrows to jump to the direction of the buffer I'm looking for, but with two frames, it won't jump. Is there a trick to this? Or do I need to give the other Emacs frame focus first (which is a step I would like to avoid).

    Read the article

  • Qt Creator CONFIG (debug, release) switches does NOT work

    - by killdaclick
    Problem: CONFIG(debug,debug|release) and CONFIG(release,deubg|release) are always evaluated wherever debug or release is choosen in Qt Creator 2.8.1 for Linux. My configuration in Qt Creator application (stock - default for new project): Projects->Build Settings->Debug Build Steps: qmake build configuration: Debug Effective qmake call: qmake2 proj.pro -r -spec linux-gnueabi-oe-g++ CONFIG+=debug Projects->Build Settings->Release Build Steps: qmake build configuration: Release Effective qmake call: qmake2 proj.pro -r -spec linux-gnueabi-oe-g++ My configuration in proj.pro: message(Variable CONFIG:) message($$CONFIG) CONFIG(debug,debug|release) { message(Debug build) } CONFIG(release,debug|release) { message(Release build) } Output on console for Debug: Project MESSAGE: Variable CONFIG: Project MESSAGE: lex yacc warn_on debug uic resources warn_on release incremental link_prl no_mocdepend release stl qt_no_framework debug console Project MESSAGE: Debug build Project MESSAGE: Release build Output on console for Release: Project MESSAGE: Variable CONFIG: Project MESSAGE: lex yacc warn_on uic resources warn_on release incremental link_prl no_mocdepend release stl qt_no_framework console Project MESSAGE: Debug build Project MESSAGE: Release build Under Windows 7 I didnt experienced any problem with such .pro configuration and it worked fine. I was desperate and modified .pro file: CONFIG = test message(Variable CONFIG:) message($$CONFIG) CONFIG(debug,debug|release) { message(Debug build) } CONFIG(release,debug|release) { message(Release build) } and I was suprised with the output: Project MESSAGE: Variable CONFIG: Project MESSAGE: test Project MESSAGE: Debug build Project MESSAGE: Release build so even if I completly clean CONFIG variable it still see debug and release configuration. What Im doing wrong?

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >