Search Results

Search found 27946 results on 1118 pages for 'output buffer empty'.

Page 281/1118 | < Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >

  • Giving 'TemplateError' can't convert String into Integer

    - by Gagan
    Hi, I recently transfered my app from Rails2 to Rails3. The code in 'app/views/distribution/index.html.erb' is like :- <div style="padding-bottom:10px; padding-left:0px;float:left;display:<%= (!session[:album][@artist.id.to_s].empty? && !session[:album][@artist.id.to_s].nil?)?'block' : 'none' %>" id = "make_payment_enabled"> <%= link_to 'Make Payments',{:action => 'pay', :album=>@album.id}, :class => "button" %> </div> It's giving me TemplateError on line :- <div style="padding-bottom:10px; padding-left:0px;float:left;display:<%= (!session[:album][@artist.id.to_s].empty? && !session[:album][@artist.id.to_s].nil?)?'block' : 'none' %>" id = "make_payment_enabled"> How to resolve the problem ?

    Read the article

  • Why is log4j not behaving as expected?

    - by Kieveli
    I have a co-worker who is trying to get log4j to behave as follows: Log to Stdout By default, disable most output Show only messages from java.sql.PrepareStatement at level debug and up He's getting caught up in the 'level' vs 'priority'. Here is his config file: <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE log4j:configuration SYSTEM "D:/Java/apache-log4j-1.2.15/src/main/resources/org/apache/log4j/xml/log4j.dtd" > <log4j:configuration> <!-- Appenders --> <appender name="stdout" class="org.apache.log4j.ConsoleAppender"> <layout class="org.apache.log4j.PatternLayout"> <param name="ConversionPattern" value="%5p %d{ISO8601} [%t][%x] %c - %m%n" /> </layout> </appender> <!-- Loggers for ibatus and JDBC database --> <logger name="java.sql.PreparedStatement"> <level value="debug"/> </logger> <!-- The Root Logger --> <root> <level value="error"/> <appender-ref ref="stdout"/> </root> </log4j:configuration> The output from this shows no messages in the log output. How does he need to change his log4j.xml config file to make it behave as he's expecting?

    Read the article

  • JQgrid - escape ':' in searchoptions (value part)

    - by bsreekanth
    Hello, How to set the values for filter is explained here link text. I have two requirements. 1. the default value needs to be empty. I expect, if defaultValue is not set, the filter is empty, but that is not happening in my case. The first value is 2. How to escape ':' in my value. The character ':' and ';' are used to seperate the index and values. But, in my value string it contains a ':' (eg: searchoptions:{value:"1:'Level: 1'"} , where Level: 1 is my first value). How to escape : in the value part. I tried \ , / etc. thanks.

    Read the article

  • wsgi django not working

    - by MaKo
    im installing django, the test for wsgi is ok, but when i point my default file to the django test, it doesnt work, this is the test that works fine: default: /etc/apache2/sites-available/default <VirtualHost *:80> ServerName www.example.com ServerAlias example.com ServerAdmin [email protected] DocumentRoot /var/www <Directory /var/www/documents> Order allow,deny Allow from all </Directory> WSGIScriptAlias / /home/ubuntu/djangoProj/micopiloto/application.wsgi <Directory /home/ubuntu/djangoProj/mysitio/wsgi_handler.py> Order allow,deny Allow from all </Directory> </VirtualHost> application.wsgi:: ~/djangoProj/micopiloto import os import sys sys.path.append('/srv/www/cucus/application') os.environ['PYTHON_EGG_CACHE'] = '/srv/www/cucus/.python-egg' def application(environ, start_response): status = '200 OK' output = 'Hello World!MK SS9 tkt kkk' response_headers = [('Content-type', 'text/plain'), ('Content-Length', str(len(output)))] start_response(status, response_headers) return [output] but if I change the default to point to application_sa.wsgi the django test, it doesnt work :( application_sa.wsgi import os, sys sys.path.append('/home/ubuntu/djangoProj/micopiloto') os.environ['DJANGO_SETTINGS_MODULE'] = 'micopiloto.settings' import django.core.handlers.wsgi application = django.core.handlers.wsgi.WSGIHandler() I restart the apache server every time i change the wsgi to test, so what im i missing? thanks a lot!

    Read the article

  • adding Buttons to Columns in Datagride view

    - by kasunmit
    HiHi, I wrote C# application for import unread e-mails from outlook 2007, I could import sender name, sender mail address,subject and body to data grid view as following foreach (Microsoft.Office.Interop.Outlook._MailItem mailItem in fldEmails.Items) { if (mailItem.UnRead) { UnreadEmails mail = new UnreadEmails(); // mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : mailItem.Attachments.Session.OpenSharedItem; foreach (Microsoft.Office.Interop.Outlook.Attachment Atmt in mailItem.Attachments) { mail.AttachmentContent = (mailItem.UnRead == false) ? string.Empty : Atmt.DisplayName; } emails.Add(mail); } } UnreadEmails is a separte class. but couldn't find a way to import attachments (word pdf ppt excel) because i need it for my filter pls help me about it but i could import inly name of the attachment but i need to import attachment content (word, pdf , ppt .. atc. ) to this data grid pls tell how i can do it ... with the code

    Read the article

  • What does it mean to double license?

    - by Adrian Panasiuk
    What does it mean to double license code? I can't just put both licenses in the source files. That would mean that I mandate users to follow the rules of both of them, but the licenses will probably be contradictory (otherwise there'd be no reason to double license). I guess this is something like in cryptographic chaining, cipher = crypt_2(crypt_1(clear)) (generally) means, that cipher is neither the output of crypt_2 on clear nor the output of crypt_1 on clear. It's the output of the composition. Likewise, in double-licensing, in reality my code has one license, it's just that this new license says please follow all of the rules of license1, or all of the rules of license2, and you are hereby granted the right to redistribute this application under this "double" license, license1 or license2, or any license under which license1 or license2 allow you to redistribute this software, in which case you shall replace the relevant licensing information in this application with that of the new license. (Does this mean that before someone may use the app under license1, he has to perform the operation of redistributing to self? How would he document the fact that he did that operation?) Am I correct. What LICENSE file and what text to put in the source files would I need if I wanted to double license on, for the sake of example, Apachev2 and GPLv3 ?

    Read the article

  • Write vim file as super-user ?

    - by zimbatm
    This is a usability problem that happens often to me : I open a read-only system file with vim, even editing it, because I'm not attentive enough, or because the vim on the system is badly configured. Once my changes are done, I'm stuck having to write them in a temporary file or loosing them, because :w! won't work. Is there a vim command (:W!!!) that allows you to write the current buffer as a super-user ? (Vim would ask for your sudo or su password naturally)

    Read the article

  • Alternative to using c:out to prevent XSS

    - by lynxforest
    I'm working on preventing cross site scripting (XSS) in a Java, Spring based, Web application. I have already implemented a servlet filter similar to this example http://greatwebguy.com/programming/java/simple-cross-site-scripting-xss-servlet-filter/ which sanitizes all the input into the application. As an extra security measure I would like to also sanitize all output of the application in all JSPs. I have done some research to see how this could be done and found two complementary options. One of them is the use of Spring's defaultHtmlEscape attribute. This was very easy to implement (a few lines in web.xml), and it works great when your output is going through one of spring's tags (ie: message, or form tags). The other option I have found is to not directly use EL expressions such as ${...} and instead use <c:out value="${...}" /> That second approach works perfectly, however due to the size of the application I am working on (200+ JSP files). It is a very cumbersome task to have to replace all inappropriate uses of EL expressions with the c:out tag. Also it would become a cumbersome task in the future to make sure all developers stick to this convention of using the c:out tag (not to mention, how much more unreadable the code would be). Is there alternative way to escape the output of EL expressions that would require fewer code modifications? Thank you in advance.

    Read the article

  • Different standard streams per POSIX thread

    - by Roman Nikitchenko
    Is there any possibility to achieve different redirections for standard output like printf(3) for different POSIX thread? What about standard input? I have lot of code based on standard input/output and I only can separate this code into different POSIX thread, not process. Linux operation system, C standard library. I know I can refactor code to replace printf() to fprintf() and further in this style. But in this case I need to provide some kind of context which old code doesn't have. So doesn't anybody have better idea (look into code below)? #include <pthread.h> #include <stdio.h> void* different_thread(void*) { // Something to redirect standard output which doesn't affect main thread. // ... // printf() shall go to different stream. printf("subthread test\n"); return NULL; } int main() { pthread_t id; pthread_create(&id, NULL, different_thread, NULL); // In main thread things should be printed normally... printf("main thread test\n"); pthread_join(id, NULL); return 0; }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Jquery .wrap and first-child

    - by Johann
    Hi, I'm in a situation in which I need to use .wrap and :first-child. This is what I am doing: <script>$("a").wrap("<div class='category-wrapper'></div>");</script> <script>$("div.category-wrapper:first-child").addClass("first");</script> This should render a div.category-wrapper outside a link and then add a "first" class to every first div.category-wrapper. The output is: <div class="category-wrapper"><a href="#">Test</a></div> Which is good! However, I am not able to get the "first-child" to work (it doesn't adds the "first" class). If I use it somewhere else it works so I am sure it's something related to the dynamic rendering of the previous element. Any help is appreciated! Thanks! Sample output would be: <div class="category-wrapper"><a href="#">Test #1</a></div> <div class="category-wrapper"><a href="#">Test #2</a></div> <div class="category-wrapper"><a href="#">Test #3</a></div> <div class="category-wrapper"><a href="#">Test #4</a></div> Desired output: <div class="category-wrapper first"><a href="#">Test #1</a></div> <div class="category-wrapper"><a href="#">Test #2</a></div> <div class="category-wrapper"><a href="#">Test #3</a></div> <div class="category-wrapper"><a href="#">Test #4</a></div> However, I am not able to make it work.

    Read the article

  • UTF-8 MySQL and Charset, pls help me understand this once and for all!

    - by FFish
    Can someone explain me when I set everything to UTF-8 I keep getting those damn ??? MySQL Server version: 5.1.44 MySQL charset: UTF-8 Unicode (utf8) I create a new database name: utf8test collation: utf8_general_ci MySQL connection collation: utf8_general_ci My SQL looks like this: SET SQL_MODE="NO_AUTO_VALUE_ON_ZERO"; CREATE TABLE IF NOT EXISTS `test_table` ( `test_id` int(11) NOT NULL, `test_text` text NOT NULL, PRIMARY KEY (`test_id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; INSERT INTO `test_table` (`test_id`, `test_text`) VALUES (1, 'hééélo'), (2, 'wööörld'); My PHP / HTML: <?php $db_conn = mysql_connect("localhost", "root", "") or die("Can't connect to db"); mysql_select_db("utf8test", $db_conn) or die("Can't select db"); // $result = mysql_query("set names 'utf8'"); // this works... why?? $query = "SELECT * FROM test_table"; $result = mysql_query($query); $output = ""; while($row = mysql_fetch_assoc($result)) { $output .= "id: " . $row['test_id'] . " - text: " . $row['test_text'] . "<br />"; } ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html lang="it" xmlns="http://www.w3.org/1999/xhtml" xml:lang="it"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>UTF-8 test</title> </head> <body> <?php echo $output; ?> </body> </html>

    Read the article

  • Https in java ends up with strange results

    - by Senne
    I'm trying to illustrate to students how https is used in java. But i have the feeling my example is not really the best out there... The code works well on my windows 7: I start the server, go to https://localhost:8080/somefile.txt and i get asked to trust the certificate, and all goes well. When I try over http (before or after accepting the certificate) I just get a blank page, which is ok for me. BUT when I try the exact same thing on my windows XP: Same thing, all goes well. But then (after accepting the certificate first), I'm also able to get all the the files through http! (if I first try http before https followed by accepting the certificate, I get no answer..) I tried refreshing, hard refreshing a million times but this should not be working, right? Is there something wrong in my code? I'm not sure if I use the right approach to implement https here... package Security; import java.io.*; import java.net.*; import java.util.*; import java.util.concurrent.Executors; import java.security.*; import javax.net.ssl.*; import com.sun.net.httpserver.*; public class HTTPSServer { public static void main(String[] args) throws IOException { InetSocketAddress addr = new InetSocketAddress(8080); HttpsServer server = HttpsServer.create(addr, 0); try { System.out.println("\nInitializing context ...\n"); KeyStore ks = KeyStore.getInstance("JKS"); char[] password = "vwpolo".toCharArray(); ks.load(new FileInputStream("myKeys"), password); KeyManagerFactory kmf = KeyManagerFactory.getInstance("SunX509"); kmf.init(ks, password); SSLContext sslContext = SSLContext.getInstance("TLS"); sslContext.init(kmf.getKeyManagers(), null, null); // a HTTPS server must have a configurator for the SSL connections. server.setHttpsConfigurator (new HttpsConfigurator(sslContext) { // override configure to change default configuration. public void configure (HttpsParameters params) { try { // get SSL context for this configurator SSLContext c = getSSLContext(); // get the default settings for this SSL context SSLParameters sslparams = c.getDefaultSSLParameters(); // set parameters for the HTTPS connection. params.setNeedClientAuth(true); params.setSSLParameters(sslparams); System.out.println("SSL context created ...\n"); } catch(Exception e2) { System.out.println("Invalid parameter ...\n"); e2.printStackTrace(); } } }); } catch(Exception e1) { e1.printStackTrace(); } server.createContext("/", new MyHandler1()); server.setExecutor(Executors.newCachedThreadPool()); server.start(); System.out.println("Server is listening on port 8080 ...\n"); } } class MyHandler implements HttpHandler { public void handle(HttpExchange exchange) throws IOException { String requestMethod = exchange.getRequestMethod(); if (requestMethod.equalsIgnoreCase("GET")) { Headers responseHeaders = exchange.getResponseHeaders(); responseHeaders.set("Content-Type", "text/plain"); exchange.sendResponseHeaders(200, 0); OutputStream responseBody = exchange.getResponseBody(); String response = "HTTP headers included in your request:\n\n"; responseBody.write(response.getBytes()); Headers requestHeaders = exchange.getRequestHeaders(); Set<String> keySet = requestHeaders.keySet(); Iterator<String> iter = keySet.iterator(); while (iter.hasNext()) { String key = iter.next(); List values = requestHeaders.get(key); response = key + " = " + values.toString() + "\n"; responseBody.write(response.getBytes()); System.out.print(response); } response = "\nHTTP request body: "; responseBody.write(response.getBytes()); InputStream requestBody = exchange.getRequestBody(); byte[] buffer = new byte[256]; if(requestBody.read(buffer) > 0) { responseBody.write(buffer); } else { responseBody.write("empty.".getBytes()); } URI requestURI = exchange.getRequestURI(); String file = requestURI.getPath().substring(1); response = "\n\nFile requested = " + file + "\n\n"; responseBody.write(response.getBytes()); responseBody.flush(); System.out.print(response); Scanner source = new Scanner(new File(file)); String text; while (source.hasNext()) { text = source.nextLine() + "\n"; responseBody.write(text.getBytes()); } source.close(); responseBody.close(); exchange.close(); } } }

    Read the article

  • How to disable or tune filesystem cache sharing for OpenVZ?

    - by gertvdijk
    For OpenVZ, an example of container-based virtualization, it seems that host and all guests are sharing the filesystem cache. This sounds paradoxical when talking about virtualization, but this is actually a feature of OpenVZ. It makes sense too. Because only one kernel is running, it's possible to benefit from sharing the same pages of filesystem cache in memory. And while it sounds beneficial, I think a set up here actually suffers in performance from it. Here's why I think why: my machines aren't actually sharing any files on disk so I can't benefit from this feature in OpenVZ. Several OpenVZ machines are running MySQL with MyISAM tables. MyISAM relies on the system's filesystem cache for caching of data files, unlike InnoDB's buffer pool. Also some virtual machines are known to do heavy and large I/O operations on the same filesystem in the host. For example, when running cat *.MYD > /dev/null on some large database in one machine, I saw the filesystem cache lowering in another, monitored by htop. This essentially flushes all the useful filesystem cache in guests (FIFO) and so it flushes the MySQL caches in the guests. Now users are complaining that MySQL is very slow. And it is. Some simple SELECT queries take several seconds on times disk I/O is heavily used by other machines. So, simply put: Is there a way to avoid filesystem cache being wiped out by other virtual machines in container-based virtualization? Some thoughts: Choosing algorithm for flushing filesystem cache in the kernel. (possible? how?) Reserving a certain amount of pages for a single VM. (seems no option for filesystem cache type of pages that reading man vzctl) Will running MySQL on another filesystem get me anywhere? If not, I think my alternatives are: Use KVM for MySQL-MyISAM running VMs. KVM actually assigns memory to the VM and does not allow swapping out caches unless using a balloon driver. Move to InnoDB and tune the buffer pools, dirty pages, etc. This is now considered to be 'nice to have' on the long-term as not everyone responsible for administration of the system understands InnoDB. more suggestions welcome. System software: Proxmox (now 1.9, could be upgraded to 2.x). One big LV assigned for the VMs.

    Read the article

  • how to add special class for labels and errors on zend form elements?

    - by user1400
    hello how we could add a special class for labels and errors for a zend-form-element for example html output code before add classes <dt id="username-label"><label for="username" class="required">user name:</label></dt> <dd id="username-element"> <input type="text" name="username" id="username" value="" class="input" /> <ul class="errors"><li>Value is required and can't be empty</li></ul></dd> and code after we add classes <dt id="username-label"><label for="username" **class="req-username"**>user name:</label></dt> <dd id="username-element"> <input type="text" name="username" id="username" value="" class="input" /> <ul **class="err-username"**><li>Value is required and can't be empty</li></ul></dd> thanks

    Read the article

  • what is the programmatic parlance for this phenomenon?

    - by deostroll
    Here is javascript code (jquery) for adding a row of images: var tr = $('<tr>'); var td = '<td><img src="myimg.jpg"/></td>'; tr.append(td).append(td).append(td); $('#mytable tbody tr:eq(0)').before(tr); tr.empty(); //I really don't need this line... Technically tr.empty() shouldn't have worked. It actually does the opposite of what I want. What is the techinical term for this behaviour - You've added tr to the DOM, but any jquery function calls to that object still works, where as you'd normally not expect it to work i.e. make changes to the DOM?

    Read the article

  • Help With LINQ: Mixed Joins and Specifying Default Values

    - by Corey O.
    I am trying to figure out how to do a mixed-join in LINQ with specific access to 2 LINQ objects. Here is an example of how the actual TSQL query might look: SELECT * FROM [User] AS [a] INNER JOIN [GroupUser] AS [b] ON [a].[UserID] = [b].[UserID] INNER JOIN [Group] AS [c] ON [b].[GroupID] = [c].[GroupID] LEFT JOIN [GroupEntries] AS [d] ON [a].[GroupID] = [d].[GroupID] WHERE [a].[UserID] = @UserID At the end, basically what I would like is an enumerable object full of GroupEntry objects. What am interested is the last two tables/objects in this query. I will be displaying Groups as a group header, and all of the Entries underneath their group heading. If there are no entries for a group, I still want to see that group as a header without any entries. Here's what I have so far: So from that I'd like to make a function: public void DisplayEntriesByUser(int user_id) { MyDataContext db = new MyDataContext(); IEnumberable<GroupEntries> entries = ( from user in db.Users where user.UserID == user_id join group_user in db.GroupUsers on user.UserID = group_user.UserID into a from join1 in a join group in db.Groups on join1.GroupID equals group.GroupID into b from join2 in b join entry in db.Entries.DefaultIfEmpty() on join2.GroupID equals entry.GroupID select entry ); Group last_group_id = 0; foreach(GroupEntry entry in entries) { if (last_group_id == 0 || entry.GroupID != last_group_id) { last_group_id = entry.GroupID; System.Console.WriteLine("---{0}---", entry.Group.GroupName.ToString().ToUpper()); } if (entry.EntryID) { System.Console.WriteLine(" {0}: {1}", entry.Title, entry.Text); } } } The example above does not work quite as expected. There are 2 problems that I have not been able to solve: I still seem to be getting an INNER JOIN instead of a LEFT JOIN on the last join. I am not getting any empty results, so groups without entries do not appear. I need to figure out a way so that I can fill in the default values for blank sets of entries. That is, if there is a group without an entry, I would like to have a mostly blank entry returned, except that I'd want the EntryID to be null or 0, the GroupID to be that of of the empty group that it represents, and I'd need a handle on the entry.Group object (i.e. it's parent, empty Group object). Any help on this would be greatly appreciated. Note: Table names and real-world representation were derived purely for this example, but their relations simplify what I'm trying to do.

    Read the article

  • Find a base case for a recursive void method

    - by Evan S
    I am doing homework. I would like to build a base case for a recursion where ordering given numbers (list2) in ascending order. Purpose of writing this codes is that when all numbers are in ascending order then should stop calling a method called ascending(list2, list1); and all values in list2 should be shipped to list1. For instance, list2 = 6,5,4,3,2,1 then list2 becomes empty and list1 should be 1,2,3,4,5,6. I am trying to compare result with previous one and if matches then stop. But I can't find the base case to stop it. In addition, Both ascending() and fixedPoint() are void method. Anybody has idea? lol Took me 3 days... When I run my code then 6,5,4,3,2,1 5,6,4,3,2,1 4,5,6,3,2,1 3,4,5,6,2,1 2,3,4,5,6,1 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 infinite............. public class Flipper { public static void main(String[] args) { Flipper aFlipper = new Flipper(); List<Integer> content = Arrays.asList(6,5,4,3,2,1); ArrayList<Integer> l1 = new ArrayList<Integer>(content); ArrayList<Integer> l2 = new ArrayList<Integer>(); // empty list aFlipper.fixedPoint(l2,l1); System.out.println("fix l1 is "+l1); System.out.println("fix l2 is "+l2); } public void fixedPoint(ArrayList<Integer> list1, ArrayList<Integer> list2) { // data is in list2 ArrayList<Integer> temp1 = new ArrayList<Integer>(); // empty list if (temp1.equals(list2)) { System.out.println("found!!!"); } else { ascending(list2, list1); // data, null temp1 = list1; // store processed value System.out.println("st list1 is "+list1); System.out.println("st list2 is "+list2); } fixedPoint(list2, list1); // null, processed data }

    Read the article

  • Java Compiler Creation Help..Please

    - by Brian
    I need some help with my code here...What we are trying to do is make a compiler that will read a file containing Machine Code and converting it to 100 lines of 4 bits example: this code is the machine code being converting to opcode and operands. I need some help please.. thanks 799 798 198 499 1008 1108 899 909 898 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Everything compiles but when I go and run my Test.java I get the following OutPut: Exception in thread "main" java.util.NoSuchElementException: No line found at java.util.Scanner.nextLine(Scanner.java:1516) at Compiler.FirstPass(Compiler.java:22) at Compiler.compile(Compiler.java:11) at Test.main(Test.java:5) Here is my class Compiler: import java.io.*; import java.io.DataOutputStream; import java.util.NoSuchElementException; import java.util.Scanner; class Compiler{ private int lc = 0; private int dc = 99; public void compile(String filename) { SymbolList symbolTable = FirstPass(filename); SecondPass(symbolTable, filename); } public SymbolList FirstPass(String filename) { File file = new File(filename); SymbolList temp = new SymbolList(); int dc = 99; int lc = 0; try{ Scanner scan = new Scanner(file); String line = scan.nextLine(); String[] linearray = line.split(" "); while(line!=null){ if(!linearray[0].equals("REM")){ if(!this.isInstruction(linearray[0])){ linearray[0]=removeColon(linearray[0]); if(this.isInstruction(linearray[1])){ temp.add(new Symbol(linearray[0], lc, null)); lc++; } else { temp.add(new Symbol(linearray[0], dc, Integer.valueOf((linearr\ ay[2])))); dc--; } } else { if(!linearray[0].equals("REM")) lc++; } } try{ line = scan.nextLine(); } catch(NoSuchElementException e){ line=null; break; } linearray = line.split(" "); } } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } return temp; } public String makeFilename(String filename) { return filename + ".ex"; } public String removeColon(String str) { if(str.charAt(str.length()-1) == ':'){ return str.substring(0, str.length()-1); } else { return str; } } public void SecondPass(SymbolList symbolTable, String filename){ try { int dc = 99; //Open file for reading File file = new File(filename); Scanner scan = new Scanner(file); //Make filename of new executable file String newfile = makeFilename(filename); //Open Output Stream for writing new file. FileOutputStream os = new FileOutputStream(filename); DataOutputStream dos = new DataOutputStream(os); //Read First line. Split line by Spaces into linearray. String line = scan.nextLine(); String[] linearray = line.split(" "); while(scan.hasNextLine()){ if(!linearray[0].equals("REM")){ int inst=0, opcode, loc; if(isInstruction(linearray[0])){ opcode = getOpcode(linearray[0]); loc = symbolTable.searchName(linearray[1]).getMemloc(); inst = (opcode*100)+loc; } else if(!isInstruction(linearray[0])){ if(isInstruction(linearray[1])){ opcode = getOpcode(linearray[1]); if(linearray[1].equals("STOP")) inst=0000; else { loc = symbolTable.searchName(linearray[2]).getMemloc(); inst = (opcode*100)+loc; } } if(linearray[1].equals("DC")) dc--; } System.out.println(inst); dos.writeInt(inst); linearray = line.split(" "); } if(scan.hasNextLine()) { line = scan.nextLine(); } } scan.close(); for(int i = lc; i <= dc; i++) { dos.writeInt(0); } for(int i = dc+1; i<100; i++){ dos.writeInt(symbolTable.searchLocation(i).getValue()); if(i!=99) dos.writeInt(0); } dos.close(); os.close(); } catch (Exception e) { // TODO Auto-generated catch block e.printStackTrace(); } } public int getOpcode(String inst){ int toreturn = -1; if(isInstruction(inst)){ if(inst.equals("STOP")) toreturn=0; if(inst.equals("LD")) toreturn=1; if(inst.equals("STO")) toreturn=2; if(inst.equals("ADD")) toreturn=3; if(inst.equals("SUB")) toreturn=4; if(inst.equals("MPY")) toreturn=5; if(inst.equals("DIV")) toreturn=6; if(inst.equals("IN")) toreturn=7; if(inst.equals("OUT")) toreturn=8; if(inst.equals("B")) toreturn=9; if(inst.equals("BGTR")) toreturn=10; if(inst.equals("BZ")) toreturn=11; return toreturn; } else { return -1; } } public boolean isInstruction(String totest){ boolean toreturn = false; String[] labels = {"IN", "LD", "SUB", "BGTR", "BZ", "OUT", "B", "STO", "STOP", "AD\ D", "MTY", "DIV"}; for(int i = 0; i < 12; i++){ if(totest.equals(labels[i])) toreturn = true; } return toreturn; } } And here is my class Computer: import java.io.*; import java.util.NoSuchElementException; import java.util.Scanner; class Computer{ private Cpu cpu; private Input in; private OutPut out; private Memory mem; public Computer() throws IOException { Memory mem = new Memory(100); Input in = new Input(); OutPut out = new OutPut(); Cpu cpu = new Cpu(); System.out.println(in.getInt()); } public void run() throws IOException { cpu.reset(); cpu.setMDR(mem.read(cpu.getMAR())); cpu.fetch2(); while (!cpu.stop()) { cpu.decode(); if (cpu.OutFlag()) OutPut.display(mem.read(cpu.getMAR())); if (cpu.InFlag()) mem.write(cpu.getMDR(),in.getInt()); if (cpu.StoreFlag()) { mem.write(cpu.getMAR(),in.getInt()); cpu.getMDR(); } else { cpu.setMDR(mem.read(cpu.getMAR())); cpu.execute(); cpu.fetch(); cpu.setMDR(mem.read(cpu.getMAR())); cpu.fetch2(); } } } public void load() { mem.loadMemory(); } } Here is my Memory class: import java.io.*; import java.util.NoSuchElementException; import java.util.Scanner; class Memory{ private MemEl[] memArray; private int size; private int[] mem; public Memory(int s) {size = s; memArray = new MemEl[s]; for(int i = 0; i < s; i++) memArray[i] = new MemEl(); } public void write (int loc,int val) {if (loc >=0 && loc < size) memArray[loc].write(val); else System.out.println("Index Not in Domain"); } public int read (int loc) {return memArray[loc].read(); } public void dump() { for(int i = 0; i < size; i++) if(i%1 == 0) System.out.println(memArray[i].read()); else System.out.print(memArray[i].read()); } public void writeTo(int location, int value) { mem[location] = value; } public int readFrom(int location) { return mem[location]; } public int size() { return mem.length; } public void loadMemory() { this.write(0, 799); this.write(1, 798); this.write(2, 198); this.write(3, 499); this.write(4, 1008); this.write(5, 1108); this.write(6, 899); this.write(7, 909); this.write(8, 898); this.write(9, 0000); } public void loadFromFile(String filename){ try { FileReader fr = new FileReader(filename); BufferedReader br = new BufferedReader(fr); String read=null; int towrite=0; int l=0; do{ try{ read=br.readLine(); towrite = Integer.parseInt(read); }catch(Exception e){ } this.write(l, towrite); l++; }while(l<100); }catch (Exception e) { // TODO Auto-generated catch block e.printStackTrace(); } } } Here is my Test class: public class Test{ public static void main(String[] args) throws java.io.IOException { Compiler compiler = new Compiler(); compiler.compile("program.txt"); } }

    Read the article

  • How to decrypt a string encrypted with HMACSHA1?

    - by Bob
    I'm an encryption novice trying to pass some values back and forth between systems. I can encrypt the value, but can't seem to figure out how to decrypt on the other end. I've created a simple Windows Forms application using VB.NET. Trying to input a value and a key, encrypt and then decrypt to get the original value. Here's my code so far. Any help greatly appreciated. Thanks. Imports System Imports System.IO Imports System.Security.Cryptography Imports System.Text Public Class Form1 Private Sub btnEncode_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnEncode.Click Dim hmacsha1 As New HMACSHA1(Encoding.ASCII.GetBytes(txtKey.Text)) Dim hashValue As Byte() = hmacsha1.ComputeHash(Encoding.ASCII.GetBytes(txtValue.Text)) txtResult.Text = BytesToHexString(hashValue) hmacsha1.Clear() End Sub Private Sub btnDecode_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnDecode.Click '??? End Sub Private Function BytesToHexString(ByVal bytes As Byte()) As String Dim output As String = String.Empty Dim i As Integer = 0 Do While i < bytes.Length output += bytes(i).ToString("X2") i += 1 Loop Return output End Function End Class

    Read the article

  • Start dependent application with eunit

    - by ruslander
    I start lager as a dependent application when I run a unit test but for some reason the code under test does not see it. -module(main_tests). -include_lib("eunit/include/eunit.hrl"). main_test_() -> {foreach, fun distr_setup/0, fun distr_cleanup/1, [ fun must_retain/1 ]}. must_retain(_) -> {"Should do ping pong when is fully initialized", fun() -> ?assertEqual(pong, abuse_counter:ping()) end}. %%------------------------------------------------------------------ distr_setup() -> abuse_counter:start_link(), ok. distr_cleanup(_) -> abuse_counter:stop(), ok. Here is the output of the log which is complaining that lager is not defined {undef,[{lager,info,["up and running"],[]} though in the run output is definitely there. Here is how I run it: erl -pa ebin/ ../../deps/*/ebin -s lager -eval 'eunit:test(main_tests,[verbose]), init:stop().' Fails with the output Eshell V5.10.2 (abort with ^G) 1> 17:13:31.506 [info] Application lager started on node nonode@nohost ======================== EUnit ======================== module 'main_tests' undefined 17:13:31.528 [error] CRASH REPORT Process <0.57.0> with 1 neighbours exited with reason: call to undefined function lager:info("up and running") in gen_server:init_it/6 line 328 *unexpected termination of test process* ::**{undef,[{lager,info,["up and running"],[]}**, {abuse_counter,init,1,[{file,"src/abuse_counter.erl"},{line,37}]}, {gen_server,init_it,6,[{file,"gen_server.erl"},{line,304}]}, {proc_lib,init_p_do_apply,3,[{file,"proc_lib.erl"},{line,239}]}]} ======================================================= Failed: 0. Skipped: 0. Passed: 0. One or more tests were cancelled. Already spent 3-4h hours on google and stack overflow but nothing seems to work. One option is to hide this call behind a ?INFO(Mgs) macro but do not like the idea. Any help will be highly appreciated.

    Read the article

  • Subversion commit failed on Mac OS X with error "no such table: rep_cache"

    - by arun
    I created a subversion repository, imported an empty structure, checked out the repo, added a file to the working copy and tried commiting the working copy with the following commands: svnadmin create mysvn svn import -m "initial empty structure" test/ file:///tmp/mysvn svn co file:///tmp/mysvn mywc svn ci -m "test" The commit failed with the following error: Transmitting file data .svn: Commit failed (details follow): svn: While preparing '/tmp/mywc' for commit svn: no such table: rep_cache I am running Mac OS X 10.6.3 and subversion 1.6.5. Did I miss any steps or Mac specific commands? Thanks for your help.

    Read the article

  • Somewhat lost with jquery + php + json

    - by Luis Armando
    I am starting to use the jquery $.ajax() but I can't get back what I want to...I send this: $(function(){ $.ajax({ url: "graph_data.php", type: "POST", data: "casi=56&nada=48&nuevo=98&perfecto=100&vales=50&apenas=70&yeah=60", dataType: "json", error: function (xhr, desc, exceptionobj) { document.writeln("El error de XMLHTTPRequest dice: " + xhr.responseText); }, success: function (json) { if (json.error) { alert(json.error); return; } var output = ""; for (p in json) { output += p + " : " + json[p] + "\n"; } document.writeln("Results: \n\n" + output); } }); }); and my php is: <?php $data = $_POST['data']; function array2json($data){ $json = $data; return json_encode($json); } ?> and when I execute this I come out with: Results: just like that I used to have in the php a echo array2json statement but it just gave back gibberish...I really don't know what am I doing wrong and I've googled for about 3 hours just getting basically the same stuff. Also I don't know how to pass parameters to the "data:" in the $.ajax function in another way like getting info from the web page, can anyone please help me? Edit I did what you suggested and it prints the data now thank you very much =) however, I was wondering, how can I send the data to the "data:" part in jQuery so it takes it from let's say user input, also I was checking the php documentation and it says I'm allowed to write something like: json_encode($a,JSON_HEX_TAG|JSON_HEX_APOS|JSON_HEX_QUOT|JSON_HEX_AMP) however, if I do that I get an error saying that json_encode accepts 1 parameter and I'm giving 2...any idea why? I'm using php 5.2

    Read the article

  • JQuery selector in variable

    - by nagut
    I wanted to ask about using selector from a variable first I have: function check() { $('.info input, .info select').each(function(n, element){ if ($(element).val()=='') alert('empty'); }); } and called it in $('input')change(check); and they worked fine. But now I want to pass some value to the function to make it dynamic, like $('input')change(check('.info')); and changed the function to function check(sel) { $(sel +' input, '+ sel + ' select').each(function(n, element){ if ($(element).val()=='') alert('empty'); }); } but it doesn't work. Any help please.. Thanks, nagut

    Read the article

  • Array: Recursive problem cracked me up

    - by VaioIsBorn
    An array of integers A[i] (i 1) is defined in the following way: an element A[k] ( k 1) is the smallest number greater than A[k-1] such that the sum of its digits is equal to the sum of the digits of the number 4* A[k-1] . You need to write a program that calculates the N th number in this array based on the given first element A[1] . INPUT: In one line of standard input there are two numbers seperated with a single space: A[1] (1 <= A[1] <= 100) and N (1 <= N <= 10000). OUTPUT: The standard output should only contain a single integer A[N] , the Nth number of the defined sequence. Input: 7 4 Output: 79 Explanation: Elements of the array are as follows: 7, 19, 49, 79... and the 4th element is solution. I tried solving this by coding a separate function that for a given number A[k] calculates the sum of it's digits and finds the smallest number greater than A[k-1] as it says in the problem, but with no success. The first testing failed because of a memory limit, the second testing failed because of a time limit, and now i don't have any possible idea how to solve this. One friend suggested recursion, but i don't know how to set that. Anyone who can help me in any way please write, also suggest some ideas about using recursion/DP for solving this problem. Thanks.

    Read the article

< Previous Page | 277 278 279 280 281 282 283 284 285 286 287 288  | Next Page >