Search Results

Search found 8344 results on 334 pages for 'fast vector highlighter'.

Page 283/334 | < Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >

• Best full text search for mysql?

  - by ConroyP

  We're currently running MySQL on a LAMP stack and have been looking at implementing a more thorough, full-text search on our site. We've looked at MySQL's own freetext search, but it doesn't seem to cope well with large databases, which makes it far too slow for our needs. Our main requirements are: speed returning results simple updating of index In addition to the above, our "nice to have"s are: ideally not something that requires adding a module to MySQL plays nicely with PHP (majority of our dev work done using PHP) There seems to be quite a few healthy open-source projects to add fast, reliable full-text search to MySQL, so I'm basically looking for recommendations/suggestions on what you've found to be the most useful product out there, easiest to set up, etc. So far, the list of ones we've been starting to play around with are: Sphinx, C++ based, used by craigslist, thepiratebay Lucene, Java-based Apache project, powers zeoh.com and zoomf.com Solr, Java-based offshoot of Lucene, used to power searches on Digg, CNet & AOL Channels Are there any better ones out there that we haven't come across yet? Can you recommend / suggest against any of the options we've gathered so far? Thanks for your help! Update @Cletus suggested Google's Custom Search Engine. We recently trialled this on a couple of projects, and it's an almost-perfect fit for our needs. The problem is that entries on our site are updated quite regularly, and unfortunately the speed at which entries go in/get updated in Google's index was just too slow and erratic for us to rely on, even with the addition of sitemaps and requested crawl rate changes.

  Read the article

• Two strange efficiency problems in Mathematica

  - by Jess Riedel

  FIRST PROBLEM I have timed how long it takes to compute the following statements (where V[x] is a time-intensive function call): Alice = Table[V[i],{i,1,300},{1000}]; Bob = Table[Table[V[i],{i,1,300}],{1000}]^tr; Chris_pre = Table[V[i],{i,1,300}]; Chris = Table[Chris_pre,{1000}]^tr; Alice, Bob, and Chris are identical matricies computed 3 slightly different ways. I find that Chris is computed 1000 times faster than Alice and Bob. It is not surprising that Alice is computed 1000 times slower because, naively, the function V must be called 1000 more times than when Chris is computed. But it is very surprising that Bob is so slow, since he is computed identically to Chris except that Chris stores the intermediate step Chris_pre. Why does Bob evaluate so slowly? SECOND PROBLEM Suppose I want to compile a function in Mathematica of the form f(x)=x+y where "y" is a constant fixed at compile time (but which I prefer not to directly replace in the code with its numerical because I want to be able to easily change it). If y's actual value is y=7.3, and I define f1=Compile[{x},x+y] f2=Compile[{x},x+7.3] then f1 runs 50% slower than f2. How do I make Mathematica replace "y" with "7.3" when f1 is compiled, so that f1 runs as fast as f2? Many thanks!

  Read the article

• Versioning friendly, extendible binary file format

  - by Bas Bossink

  In the project I'm currently working on there is a need to save a sizable data structure to disk (edit: think dozens of MB's). Being an optimist, I thought that there must be a standard solution for such a problem; however, up to now I haven't found a solution that satisfies the following requirements: .NET 2.0 support, preferably with a FOSS implementation Version friendly (this should be interpreted as: reading an old version of the format should be relatively simple if the changes in the underlying data structure are simple, say adding/dropping fields) Ability to do some form of random access where part of the data can be extended after initial creation (think of this as extending intermediate results) Space and time efficient (XML has been excluded as option given this requirement) Options considered so far: Protocol Buffers: was turned down by verdict of the documentation about Large Data Sets - since this comment suggested adding another layer on top, this would call for additional complexity which I wish to have handled by the file format itself. HDF5,EXI: do not seem to have .net implementations SQLite/SQL Server Compact edition: the data structure at hand would result in a pretty complex table structure that seems too heavyweight for the intended use BSON: does not appear to support requirement 3. Fast Infoset: only seems to have paid .NET implementations. Any recommendations or pointers are greatly appreciated. Furthermore if you believe any of the information above is not true, please provide pointers/examples to prove me wrong.

  Read the article

• Why AQTime slows execution even when profiling is not on, and can anything be done for it?

  - by Antti Suni

  Hi! In AQTime for Delphi, it boasts to be very fast to get to the trouble spots by using areas and triggers etc. But it seems to me, that especially if you have very much code in the areas to profile, then the execution slows down dramatically even when the profiling is NOT on. For example, if I want to profile a specific routine late in the program flow, but don't know what is called there, I'd think to put this routine only as a trigger and the initial status for threads as Off, and then choose "Full check by Routines/Lines". However, when I do this, the program execution slows down heavily already before the trigger routine has ever been hit. For example if the "preparation flow" takes around 5 minutes without AQTime, then when I run it with profiling disabled, it already has been running for 30 minutes and still goes even when I know the trigger has not yet even been reached. I know I can try to workaround this by reducing the amount of routines/lines profiled, but it is not really a good solution for me, since I'd like to profile all of them once I get to the actual trigger routine. Also another, often better workaround is to start the application without AQTime and then use Attach to Process after the "preparation flow" has finished, but this works well only when the execution pauses in GUI in the proper place or otherwise provides a suitable time frame for doing the attaching. In all cases this is not the case. Any comments on why this is so and is there anything else to do than just try to reduce the code from the areas or attach later to the process?

  Read the article

• java distributed cache for low latency, high availability

  - by Shahbaz

  I've never used distributed caches/DHTs like memcached, jboss cache, ehcache, etc. I'm wondering which, if any, is appropriate for my use. First, I'm not doing web applications (as most of these project seem to be geared towards web apps). I write servers (Order Management Systems actually) for financial trading firms. The servers themselves are not too complicated. They need to receive information (market data, orders, executions, etc.) rout them to their destination while possibly transforming some of these messages. I am looking at these products to solve the following problems: * Safe repository of the state of the server. I'd rather build the logic of my application as a bunch of transformers (similar to Apache Camel) and store the state in a 'safe' place * This repository should be distributed: in case one of these data stores crashes, one or two more should be up and I should be able to switch to them seamlessly * This repository should be fast. Single digits milliseconds count here, in other words, systems which consume/process this data are automated systems, not humans clicking on links. This system needs to have high-throughput and low latency. By sending my data outside the process, I am necessarily slowing performance, but I am trying to balance absolute raw speed and absolute protection of data. * This repository should be safe. Similar to the point about several on-line backups, this system needs to write data to disk (potentially more than one disk). I'd really like to stop writing my own 'transaction servers.' Am I correct to be looking into projects such as jboss cache, ehcache, etc.? Thanks

  Read the article

• Difference in performance between Stax and DOM parsing

  - by Fazal

  I have been using DOM for a long time and as such DOM parsing performance wise has been pretty good. Even when dealing with XML of about 4-7 MB the parsing has been fast. The issue we face with DOM is the memory footprint which become huge as soon as we start dealing with large XMLs. Lately I tried moving to Stax (Streaming parsers for XML) which are supposed top be second generation parsers (reading about Stax it said its the fastest parser now). When I tried stax parser for large XML for about 4MB memory footprint definitely reduced drastically but time take to parse entire XML and create java object out of it increased almost by 5 times over DOM. I used sjsxp.jar implementation of Stax. I can deuce to some extent logically that performance may not be extremely good due to streaming nature of the parser but a reduction of 5 time (e.g. DOM takes about 8 seconds to build object for this XML, whereas Stax parsing took about 40 seconds on average) is definitely not going to be acceptable. Am I missing some point here completely as I am not able to come to terms with these performance numbers

  Read the article

• PHP Frameworks: Codeigniter vs. Yii vs. Custom?

  - by Industrial

  Hi everybody, I have used codeigniter for a some years now. Why I chosed to work with codeigniter back then? Pretty much for the extensive documentation that were available and the big user community. It made me as a totally newbie to the MVC pattern able to get a site up and running really fast. I think what is priorited from my side is that the framework doesn't affect performance too much, which Codeigniter seems to be pretty good at (when compared to other frameworks out there) and Yii, an even better option. Since the time has gone from when I started out with codeigniter, the project sizes have also increased and thereby the demand of the framework and it's footprint on the code. I have thought a few times about writing a whole new MVC framework to do only the thing's I want it to do, but it feels like reinventing the wheel and I cannot yet justify it. I am not sure whether or not it's a good solution to build a site that have the potential to become really big on either Yii or Codeigniter. I have tried to find as much as possible documentation about this comparision/issue online before posting here, but have found very few real-life arguments and stories from people that have shifted between the two PHP frameworks or have been in the same situation as me. So - what's your thoughts about Codeigniter vs. Yii vs. going custom? References: http://daniel.carrera.bz/2009/01/comparison-of-php-frameworks-part-i/ http://www.beyondcoding.com/2009/03/02/choosing-a-php-framework-round-2-yii-vs-kohana-vs-codeigniter/

  Read the article

• Perform case-insensitive lookup on an Array in MongoDB?

  - by Hal

  So, I've decided to get my feet wet with MongoDB and love it so far. It seems very fast and flexible which is great. But, I'm still going through the initial learning curve and as such, I'm spending hours digging for info on the most basic things. I've search throughout the MongoDB online documentation and have spent hours Googling through pages without any mention of this. I know Mongo is still quite new (v1.x) so it explains why there isn't much information yet. I've even trying looking for books on Mongo without much luck. So yes, I've tried to RTFM with no luck, so, now I turn to you. I have an Array of various Hashtags nested in each document (ie: #apples, #oranges, #Apples, #APPLES) and I would like to perform a case-insensitive find() to access all the documents containing apples in any case. It seems that find does support some regex with /i, but I can't seem to get this working either. Anyway, I hope this is a quick answer for someone. Here's my existing call in PHP which is case sensitive: $cursor = $collection->find(array( "hashtags" => array("#".$keyword)))->sort(array('$natural' => -1))->limit(10); Help?

  Read the article

• Read large file into sqlite table in objective-C on iPhone

  - by James Testa

  I have a 2 MB file, not too large, that I'd like to put into an sqlite database so that I can search it. There are about 30K entries that are in CSV format, with six fields per line. My understanding is that sqlite on the iPhone can handle a database of this size. I have taken a few approaches but they have all been slow 30 s. I've tried: 1) Using C code to read the file and parse the fields into arrays. 2) Using the following Objective-C code to parse the file and put it into directly into the sqlite database: NSString *file_text = [NSString stringWithContentsOfFile: filePath usedEncoding: NULL error: NULL]; NSArray *lineArray = [file_text componentsSeparatedByString:@"\n"]; for(int k = 0; k < [lineArray count]; k++){ NSArray *parts = [[lineArray objectAtIndex:k] componentsSeparatedByString: @","]; NSString *field0 = [parts objectAtIndex:0]; NSString *field2 = [parts objectAtIndex:2]; NSString *field3 = [parts objectAtIndex:3]; NSString *loadSQLi = [[NSString alloc] initWithFormat: @"INSERT INTO TABLE (TABLE, FIELD0, FIELD2, FIELD3) VALUES ('%@', '%@', '%@');",field0, field2, field3]; if (sqlite3_exec (db_table, [loadSQLi UTF8String], NULL, NULL, &errorMsg) != SQLITE_OK) { sqlite3_close(db_table); NSAssert1(0, @"Error loading table: %s", errorMsg); } Am I missing something? Does anyone know of a fast way to get the file into a database? Or is it possible to translate the file into a sqlite format that can be read directly into sqlite? Or should I turn the file into a plist and load it into a Dictionary? Unfortunately I need to search on two of the fields, and I think a Dictionary can only have one key? Jim

  Read the article

• Is SQLDataReader slower than using the command line utility sqlcmd?

  - by Andrew

  I was recently advocating to a colleague that we replace some C# code that uses the sqlcmd command line utility with a SqlDataReader. The old code uses: System.Diagnostics.ProcessStartInfo procStartInfo = new System.Diagnostics.ProcessStartInfo("cmd", "/c " + sqlCmd); wher sqlCmd is something like "sqlcmd -S " + serverName + " -y 0 -h-1 -Q " + "\"" + "USE [" + database + "]" + ";+ txtQuery.Text +"\"";\ The results are then parsed using regular expressions. I argued that using a SQLDataReader woud be more in line with industry practices, easier to debug and maintain and probably faster. However, the SQLDataReader approach is at least the same speed and quite possibly slower. I believe I'm doing everything correctly with SQLDataReader. The code is: using (SqlConnection connection = new SqlConnection()) { try { SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(connectionString); connection.ConnectionString = builder.ToString(); ; SqlCommand command = new SqlCommand(queryString, connection); connection.Open(); SqlDataReader reader = command.ExecuteReader(); // do stuff w/ reader reader.Close(); } catch (Exception ex) { outputMessage += (ex.Message); } } I've used System.Diagnostics.Stopwatch to time both approaches and the command line utility (called from C# code) does seem faster (20-40%?). The SqlDataReader has the neat feature that when the same code is called again, it's lightening fast, but for this application we don't anticipate that. I have already done some research on this problem. I note that the command line utility sqlcmd uses OLE DB technology to hit the database. Is that faster than ADO.NET? I'm really suprised, especially since the command line utility approach involves starting up a process. I really thought it would be slower. Any thoughts? Thanks, Dave

  Read the article

• Can anyone tell me about a jQuery modal dialog box library that doesn't suck

  - by Ritesh M Nayak

  jQuery based modal dialog boxes are great as long as you do as much as the example tells you to. I need a jQuery based modal dialog box library that has to have the following characteristics: It should be fast, something like the add and link dialog on StackOverflow. Most libraries take an eternity to load the dialog with its fancy effects and stuff. I want to call it using a script. Show a hidden div or a span element inline. MOst of the libraries talk filling an anchor with rel, class and href=#hiddenDiv sort of things. I need to be able to what I want without adding unnecessary attributes to my anchor. Something like this function showDialog(values) { processToChangeDom(values); changeDivTobeDisplayed(); modalDialog.show(); } It should reflect changes I make to the DOM in the hidden Div. I used facebox and found out that it makes a copy of the hidden div and changes to the DOM doesn't reflect on the modal window. I need to be able call the close modal div using javascript and also attach beforeOpen and afterClose handlers to the action. Does anyone have any suggestions? I have already tried facebox, simplemodal and a whole range of libraries, most of them don't support one or the other of these functions I described above.

  Read the article

• mySQL need to merge fields and get unique rows

  - by jiudev

  i have a database with +1 million rows and the stuktur looks like: CREATE TABLE IF NOT EXISTS `Performance` ( `id` int(11) NOT NULL AUTO_INCREMENT, `CIDs` varchar(100) DEFAULT NULL, `COLOR` varchar(100) DEFAULT NULL, `Name` varchar(255) DEFAULT NULL, `XT` bigint(16) DEFAULT NULL, `MP` varchar(100) DEFAULT NULL, PRIMARY KEY (`id`), KEY `CIDs` (`CIDs`), KEY `COLOR` (`COLOR`), KEY `Name` (`Name`), KEY `XT` (`XT`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8 AUTO_INCREMENT=0 ; insert into `Performance` (`id`, `CIDs`, `COLOR`, `Name`, `XT`, `MP`) VALUES (1, '1253374160', 'test test test test test', 'Load1', '89421331221', ''), (2, '1271672029', NULL, 'Load1', '19421331221', NULL), (3, '1188959688', NULL, 'Load2', '39421331221', NULL), (4, '1271672029', NULL, 'Load3', '49421341221', 'Description'), (5, '1271888888', NULL, 'Load4', '59421331221', 'Description'); The Output should look like: +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ | id | CIDs | COLOR | XT | MP | Name | PIDs | unqName | +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ | 1 | 1253374160 | test test test test test | 89421331221 | | Load1 | 1,2 | Load1 | | 3 | 1188959688 | NULL | 39421331221 | NULL | Load2 | 3 | Load2 | | 4 | 1271672029 | NULL | 49421341221 | Description | Load3 | 4,5 | Load3 | +----+------------+--------------------------+-------------+-------------+-------+-----------+---------+ any ideas, how i could do this as fast as possible? I have tried with some group by, but it takes some Minutes :/ Thanks Advance //edit: for the solution with the group by, i needed 4 subquerys :/ //edit2: as requested: select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(Name,id) as unqName from ( select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(MP,id) as unqMP from ( select id, CIDs, COLOR, XT, MP, Name, concat(PIDs,",",GROUP_CONCAT(DISTINCT id)) as PIDs, IFNULL(XT,id) as unqXT from ( select id, CIDs, COLOR, XT, MP, Name, GROUP_CONCAT(DISTINCT id) as PIDs, IFNULL(COLOR,id) as unqCOLOR from Performance group by unqCOLOR ) m group by unqXT ) x group by unqMP ) y group by unqName

  Read the article

• glitchy stuttery iphone game loop

  - by Adam

  This is a problem I've been trying to solve for a few days now, and I've looked at the various solutions on stackoverflow and nothing has really seemed to work for me. I'm making an iPhone game with OpenGLES graphics and accelerometer input, at this point it's very simple, but the rendering is already pretty bad... it stutters and seems to jump back or forward in time. It doesn't happen a lot, but it happens enough to be a problem. I mean, who wants to play a game where a bullet gets magically transported into the player, and then it's game over? No one. I've tried using NSTimer for the game loop, I've tried using a separate thread (with a frame rate and continuously) I've tried using different frame rates, from 30FPS to 60FPS (It seems to have a max frame rate around 45FPS, but no problems at 30FPS) I've tried using timeIntervalSince1970 and CFGetAbsoluteTime to measure loop time, with no noticeable diffence Anyone have any ideas on what is the best way to get this looking better? One of the posts I've read suggested running the simulation at a fixed frame rate and then just render as fast as possible, does that seem like a good idea?

  Read the article

• Big-O of PHP functions?

  - by Kendall Hopkins

  After using PHP for a while now, I've noticed that not all PHP built in functions as fast as expected. Consider the below two possible implementations of a function that finds if a number is prime using a cached array of primes. //very slow for large $prime_array $prime_array = array( 2, 3, 5, 7, 11, 13, .... 104729, ... ); $result_array = array(); foreach( $array_of_number => $number ) { $result_array[$number] = in_array( $number, $large_prime_array ); } //still decent performance for large $prime_array $prime_array => array( 2 => NULL, 3 => NULL, 5 => NULL, 7 => NULL, 11 => NULL, 13 => NULL, .... 104729 => NULL, ... ); foreach( $array_of_number => $number ) { $result_array[$number] = array_key_exists( $number, $large_prime_array ); } This is because in_array is implemented with a linear search O(n) which will linearly slow down as $prime_array grows. Where the array_key_exists function is implemented with a hash lookup O(1) which will not slow down unless the hash table gets extremely populated (in which case it's only O(logn)). So far I've had to discover the big-O's via trial and error, and occasionally looking at the source code. Now for the question... I was wondering if there was a list of the theoretical (or practical) big O times for all* the PHP built in functions. *or at least the interesting ones For example find it very hard to predict what the big O of functions listed because the possible implementation depends on unknown core data structures of PHP: array_merge, array_merge_recursive, array_reverse, array_intersect, array_combine, str_replace (with array inputs), etc.

  Read the article

• Haskell Linear Algebra Matrix Library for Arbitrary Element Types

  - by Johannes Weiß

  I'm looking for a Haskell linear algebra library that has the following features: Matrix multiplication Matrix addition Matrix transposition Rank calculation Matrix inversion is a plus and has the following properties: arbitrary element (scalar) types (in particular element types that are not Storable instances). My elements are an instance of Num, additionally the multiplicative inverse can be calculated. The elements mathematically form a finite field (??2256). That should be enough to implement the features mentioned above. arbitrary matrix sizes (I'll probably need something like 100x100, but the matrix sizes will depend on the user's input so it should not be limited by anything else but the memory or the computational power available) as fast as possible, but I'm aware that a library for arbitrary elements will probably not perform like a C/Fortran library that does the work (interfaced via FFI) because of the indirection of arbitrary (non Int, Double or similar) types. At least one pointer gets dereferenced when an element is touched (written in Haskell, this is not a real requirement for me, but since my elements are no Storable instances the library has to be written in Haskell) I already tried very hard and evaluated everything that looked promising (most of the libraries on Hackage directly state that they wont work for me). In particular I wrote test code using: hmatrix, assumes Storable elements Vec, but the documentation states: Low Dimension : Although the dimensionality is limited only by what GHC will handle, the library is meant for 2,3 and 4 dimensions. For general linear algebra, check out the excellent hmatrix library and blas bindings I looked into the code and the documentation of many more libraries but nothing seems to suit my needs :-(. Update Since there seems to be nothing, I started a project on GitHub which aims to develop such a library. The current state is very minimalistic, not optimized for speed at all and only the most basic functions have tests and therefore should work. But should you be interested in using or helping out developing it: Contact me (you'll find my mail address on my web site) or send pull requests.

  Read the article

• Optimal Serialization of Primitive Types

  - by Greg Dean

  We are beginning to roll out more and more WAN deployments of our product (.Net fat client w/ IIS hosted Remoting backend). Because of this we are trying to reduce the size of the data on the wire. We have overridden the default serialization by implementing ISerializable (similar to this), we are seeing anywhere from 12% to 50% gains. Most of our efforts focus on optimizing arrays of primitive types. I would like to know if anyone knows of any fancy way of serializing primitive types, beyond the obvious? For example today we serialize an array of ints as follows: [4-bytes (array length)][4-bytes][4-bytes] Can anyone do significantly better? The most obvious example of a significant improvement, for boolean arrays, is putting 8 bools in each byte, which we already do. Note: Saving 7 bits per bool may seem like a waste of time, but when you are dealing with large magnitudes of data (which we are), it adds up very fast. Note: We want to avoid general compression algorithms because of the latency associated with it. Remoting only supports buffered requests/responses(no chunked encoding). I realize there is a fine line between compression and optimal serialization, but our tests indicate we can afford very specific serialization optimizations at very little cost in latency. Whereas reprocessing the entire buffered response into new compressed buffer is too expensive.

  Read the article

• Read line and change the line that not consist of certain words and not end with dot

  - by igo

  I wanna read some text files in a folder line by line. for example of 1 txt : Fast and Effective Text Mining Using Linear-time Document Clustering Bjornar Larsen WORD2 Chinatsu Aone SRA International AK, Inc. 4300 Fair Lakes Cow-l Fairfax, VA 22033 {bjornar-larsen, WORD1 I wanna remove line that does not contain of words = word, word2, word3, and does not end with dot . so. from the example, the result will be : Bjornar Larsen WORD2 Chinatsu Aone SRA International, Inc. {bjornar-larsen, WORD1 I am confused, hw to remove the line? it that possible? or can we replace them with a space? here's the code : $url = glob($savePath.'*.txt'); foreach ($url as $file => $files) { $handle = fopen($files, "r") or die ('can not open file'); $ori_content= file_get_contents($files); foreach(preg_split("/((\r?\n)|(\r\n?))/", $ori_content) as $buffer){ $pos1 = stripos($buffer, $word1); $pos2 = stripos($buffer, $word2); $pos3 = stripos($buffer, $word3); $last = $str[strlen($buffer)-1];//read the las character if (true !== $pos1 OR true !== $pos2 OR true !==$pos3 && $last != '.'){ //how to remove } } } please help me, thank you so much :)

  Read the article

• Rails: Ajax: Changes Onload

  - by Jay Godse

  Hi. I have a web layout of a for that looks something like this <html> <head> </head> <body> <div id="posts"> <div id="post1" class="post" > <!--stuff 1--> </div> <div id="post2" class="post" > <!--stuff 1--> </div> <!-- 96 more posts --> <div id="post99" class="post" > <!--stuff 1--> </div> </div> </body> </html> I would like to be able to load and render the page with a blank , and then have a function called when the page is loaded which goes in and load up the posts and updates the page dynamically. In Rails, I tried using "link_to_remote" to update with all of the elements. I also tweaked the posts controller to render the collection of posts if it was an ajax request (request.xhr?). It worked fine and very fast. However the update of the blank div is triggered by clicking the link. I would like the same action to happen when the page is loaded so that I don't have to put in a link. Is there a Rails Ajax helper or RJS function or something in Rails that I could use to trigger the loading of the "posts" after the page has loaded and rendered (without the posts)? (If putsch comes to shove, I will just copy the generated JS code from the link_to_remote call and have it called from the onload handler on the body).

  Read the article

• An implementation of Sharir's or Aurenhammer's deterministic algorithm for calculating the intersect

  - by RGrey

  The problem of finding the intersection/union of 'N' discs/circles on a flat plane was first proposed by M. I. Shamos in his 1978 thesis: Shamos, M. I. “Computational Geometry” Ph.D. thesis, Yale Univ., New Haven, CT 1978. Since then, in 1985, Micha Sharir presented an O(n log2n) time and O(n) space deterministic algorithm for the disc intersection/union problem (based on modified Voronoi diagrams): Sharir, M. Intersection and closest-pair problems for a set of planar discs. SIAM .J Comput. 14 (1985), pp. 448-468. In 1988, Franz Aurenhammer presented a more efficient O(n log n) time and O(n) space algorithm for circle intersection/union using power diagrams (generalizations of Voronoi diagrams): Aurenhammer, F. Improved algorithms for discs and balls using power diagrams. Journal of Algorithms 9 (1985), pp. 151-161. Earlier in 1983, Paul G. Spirakis also presented an O(n^2) time deterministic algorithm, and an O(n) probabilistic algorithm: Spirakis, P.G. Very Fast Algorithms for the Area of the Union of Many Circles. Rep. 98, Dept. Comput. Sci., Courant Institute, New York University, 1983. I've been searching for any implementations of the algorithms above, focusing on computational geometry packages, and I haven't found anything yet. As neither appear trivial to put into practice, it would be really neat if someone could point me in the right direction!

  Read the article

• jquery image hover popup cant detect browser edge and change its direction

  - by Salman

  hi guys i am trying to implement jquery image hover popup but facing a problem when the popup is closer to browser edge it goes beyond its edge i want it to change its direction when it finds that space is not enough to show that popup, i have see this effect in many plugins where popups, tooltips and drop down menus change their direction if they are close to browser window edge can any one guide me in right direction here is the screen shot for reference http://img512.imageshack.us/img512/4990/browseredge.png here is the jquery hover code function imagePreview(){ /* CONFIG */ xOffset = 10; yOffset = 30; // these 2 variable determine popup's distance from the cursor // you might want to adjust to get the right result /* END CONFIG */ $("a.preview").hover(function(e){ this.t = this.title; this.title = ""; var c = (this.t != "") ? "<br>" + this.t : ""; var newName = this.name; //console.log(this.name); newName=newName.replace("/l/","/o/"); //console.log(newName); $("body").append("<p id='preview'><img src='"+ this.name +"' alt='Image preview' style='margin-bottom:5px;'>"+ c +"</p>"); $("#preview img").error(function () { $("#preview img").attr("src" ,newName).css({'width': '400px', 'height': 'auto'}); }); $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px") .fadeIn("fast"); }, function(){ this.title = this.t; $("#preview").remove(); }); $("a.preview").mousemove(function(e){ $("#preview") .css("top",(e.pageY - xOffset) + "px") .css("left",(e.pageX + yOffset) + "px"); }); }; any help will be appriciated Thanks Salman

  Read the article

• Cross-platform game development: ease of development vs security

  - by alcuadrado

  Hi, I'm a member and contributor of the Argentum Online (AO) community, the first MMORPG from Argentina, which is Free Software; which, although it's not 3D, it's really addictive and has some dozens of thousands of users. Really unluckily AO was developed in Visual Basic (yes, you can laugh) but the former community, so imagine, the code not only sucks, it has zero portability. I'm planning, with some friends to rewrite the client, and as a GNU/Linux frantic, want to do it cross-platform. Some other people is doing the same with the server in Java. So my biggest problem is that we would like to use a rapid development language (like Java, Ruby or Python) but the client would be pretty insecure. Ruby/Python version would have all it's code available, and the Java one would be easily decompilable (yes, we have some crackers in the community) We have consider the option to implement the security module in C/C++ as a dynamic library, but it can be replaced with a custom one, so it's not really secure. We are also considering the option of doing the core application in C++ and the GUI in Ruby/Python. But haven't analysed all it's implications yet. But we really don't want to code the entire game in C/C++ as it doesn't need that much performance (the game is played at 18fps on average) and we want to develop it as fast as possible. So what would you choose in my case? Thank you!

  Read the article

• Why do people hate SQL cursors so much?

  - by Steven A. Lowe

  I can understand wanting to avoid having to use a cursor due to the overhead and inconvenience, but it looks like there's some serious cursor-phobia-mania going on where people are going to great lengths to avoid having to use one for example, one question asked how to do something obviously trivial with a cursor and the accepted answer proposed using a common table expression (CTE) recursive query with a recursive custom function, even though this limits the number of rows that could be processed to 32 (due to recursive call limit in sql server). This strikes me as a terrible solution for system longevity, not to mention a tremendous effort just to avoid using a simple cursor. what is the reason for this level of insane hatred? has some 'noted authority' issued a fatwa against cursors? does some unspeakable evil lurk in the heart of cursors that corrupts the morals of the children or something? wiki question, more interested in the answer than the rep thanks in advance! Related Info: http://stackoverflow.com/questions/37029/sql-server-fast-forward-cursors EDIT: let me be more precise: I understand that cursors should not be used instead of normal relational operations, that is a no-brainer. What I don't understand is people going waaaaay out of their way to avoid cursors like they have cooties or something, even when a cursor is a simpler and/or more efficient solution. It's the irrational hatred that baffles me, not the obvious technical efficiencies.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Looking for a .Net ORM

  - by SLaks

  I'm looking for a .Net 3.5 ORM framework with a rather unusual set of requirements: I need to create and alter tables at runtime with schemas defined by my end-users. (Obviously, that wouldn't be strongly-typed; I'm looking for something like a DataTable there) I also want regular strongly-typed partial classes for rows in non-dynamic tables, with custom validation and other logic. (Like normal ORMs) I want to load the entire database (or some entire tables) once, and keep it in memory throughout the life of the (WinForms) GUI. (I have a shared SQL Server with a relatively slow connection) I also want regular LINQ support (like LINQ-to-SQL) for ASP.Net on the shared server (which has a fast connection to SQL Server) In addition to SQL Server, I also want to be able to use a single-file database that would support XCopy deployment (without installing SQL CE on the end-user's machine). (Probably Access or SQLite) Finally, it has to be free (unless it's OpenAccess) I'll probably have to write it myself, as I don't think there is an existing ORM that meets these requirements. However, I don't want to re-invent the wheel if there is one, hence this question. I'm using VS2010, but I don't know when my webhost (LFC) will upgrade to .Net 4.0

  Read the article

• Change NSTimer interval for repeating timer.

  - by user300713

  Hi, I am running a mainLoop in Cocoa using an NSTimer set up like this: mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/fps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; At Program startup I set the timeInterval to 0.0 so that the mainloop runs as fast as possible. Anyways, I would like to provide a function to set the framerate(and thus the time interval of the timer) to a specific value at runtime. Unfortunately as far as I know that means that I have to reinitialize the timer since Cocoa does not provide a function like "setTimerInterval" This is what I tried: - (void)setFrameRate:(float)aFps { NSLog(@"setFrameRate"); [mainLoopTimer invalidate]; mainLoopTimer = nil; mainLoopTimer = [NSTimer scheduledTimerWithTimeInterval:1.0/aFps target:self selector:@selector(mainloop) userInfo:nil repeats:YES]; [[NSRunLoop currentRunLoop] addTimer:mainLoopTimer forMode:NSEventTrackingRunLoopMode]; } but this throws the following error and stops the mainloop: 2010-06-09 11:14:15.868 myTarget[7313:a0f] setFrameRate 2010-06-09 11:14:15.868 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40cd80 of class __NSCFDate autoreleased with no pool in place - just leaking 2010-06-09 11:14:15.869 myTarget[7313:a0f] * __NSAutoreleaseNoPool(): Object 0x40e700 of class NSCFTimer autoreleased with no pool in place - just leaking 0.614628 I also tried to recreate the timer using the "retain" keyword, but that didn't change anything. Any ideas about how to dynamically change the interval of an NSTimer at runtime? Thanks!

  Read the article

< Previous Page | 279 280 281 282 283 284 285 286 287 288 289 290  | Next Page >