Search Results

Search found 22841 results on 914 pages for 'aspect orientated program'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 284/914 | < Previous Page | 280 281 282 283 284 285 286 287 288 289 290 291  | Next Page >

  • C/C++ detect network type

    - by Gavimoss
    I need to write a win32 c/c++ application which will be able to determine whether the PC it's running on is connected to one of 2 networks. The first network is the company LAN (which has no internet connection) and the second network is a standalone switch with a single PC connected to it (the PC that the program is running on). I'm pretty new to network programming but so far I have tried testing to see if a network drive which is held on our LAN can be mapped. This works fine if the PC is connected to the LAN, the drive mapping succeeds so so LAN detection is successful. However, if the PC is connected to the switch, this results in a VERY long timeout which is not a suitable as it will delay the program so much as to make it unusable. Does anyone have any alternative suggestions? I'm using c/c++ in VS 6.0

    Read the article

  • Is allocating a dynamic array without specifying size well formed code?

    - by Als
    The following simple program snippet gives compilation errorswith gcc-4.3.4. Program: int main() { char *ptr = new char[10]; char *ptr1 = new char[]; return 0; } Compilation errors: prog.cpp: In function ‘int main()’: prog.cpp:4: error: expected primary-expression before ‘]’ token prog.cpp:3: warning: unused variable ‘ptr’ prog.cpp:4: warning: unused variable ‘ptr1’ But the same compiles cleanly with MSVC without any diagnostic message. So my question is: Does the Standard allow an new [] to be called without specifying the size? Or this a bug in MSVC? Can someone provide a reference from the standard which will conclusively say that the above code example is ill-formed or well-formed? I have had a look at: 5.3.4 New [expr.new] & 18.4.1.2 Array forms [lib.new.delete.array] but couldnt find any conclusive evidence about the behavior.

    Read the article

  • Adding a row to a ListView that displays "Loading" while information is downloaded. Like in the Market.

    - by user577139
    I've tried, but have had no luck trying to find this answer elsewhere. I want to add a row to the bottom of my listview that displays "Loading..." and maybe a spinning progress indicator. My program already loads additional information into the listview once the user scrolls to the bottom. But I want the user to be able to see that the program is indeed loading something. Example: If you go to the android marketplace and scroll to the bottom of one of the lists, the last row will say "Loading...". Then once the data is loaded, that bar is replaced with the first item of the new data. Sorry, it's a little hard to describe. I am NOT trying to add a footer to the bottom of the list view. I want it to be an actual item in the listview.

    Read the article

  • Fastest way to move records from an Oracle database into SQL Server

    - by user347748
    Ok this is the scenario... I have a table in Oracle that acts like a queue... A VB.net program reads the queue and calls a stored proc in SQL Server that processes and then inserts the message into another SQL Server table and then deletes the record from the oracle table. We use a DataReader to read the records from Oracle and then call the stored proc for each of the records. The program seems to be a little slow. The stored procedure itself isn't slow. The SP by itself when called in a loop can process about 2000 records in 20 seconds. But when called from the .Net program, the execution time is about 5 records per second. I have seen that most of the time consumed is in calling the stored procedure and waiting for it to return. Is there a better way of doing this? Here is a snippet of the actual code Function StartDataXfer() As Boolean Dim status As Boolean = False Try SqlConn.Open() OraConn.Open() c.ErrorLog(Now.ToString & "--Going to Get the messages from oracle", 1) If GetMsgsFromOracle() Then c.ErrorLog(Now.ToString & "--Got messages from oracle", 1) If ProcessMessages() Then c.ErrorLog(Now.ToString & "--Finished Processing all messages in the queue", 0) status = True Else c.ErrorLog(Now.ToString & "--Failed to Process all messages in the queue", 0) status = False End If Else status = True End If StartDataXfer = status Catch ex As Exception Finally SqlConn.Close() OraConn.Close() End Try End Function Private Function GetMsgsFromOracle() As Boolean Try OraDataAdapter = New OleDb.OleDbDataAdapter OraDataTable = New System.Data.DataTable OraSelCmd = New OleDb.OleDbCommand GetMsgsFromOracle = False With OraSelCmd .CommandType = CommandType.Text .Connection = OraConn .CommandText = GetMsgSql End With OraDataAdapter.SelectCommand = OraSelCmd OraDataAdapter.Fill(OraDataTable) If OraDataTable.Rows.Count > 0 Then GetMsgsFromOracle = True End If Catch ex As Exception GetMsgsFromOracle = False End Try End Function Private Function ProcessMessages() As Boolean Try ProcessMessages = False PrepareSQLInsert() PrepOraDel() i = 0 Dim Method As Integer Dim OraDataRow As DataRow c.ErrorLog(Now.ToString & "--Going to call message sending procedure", 2) For Each OraDataRow In OraDataTable.Rows With OraDataRow Method = GetMethod(.Item(0)) SQLInsCmd.Parameters("RelLifeTime").Value = c.RelLifetime SQLInsCmd.Parameters("Param1").Value = Nothing SQLInsCmd.Parameters("ID").Value = GenerateTransactionID() ' Nothing SQLInsCmd.Parameters("UID").Value = Nothing SQLInsCmd.Parameters("Param").Value = Nothing SQLInsCmd.Parameters("Credit").Value = 0 SQLInsCmd.ExecuteNonQuery() 'check the return value If SQLInsCmd.Parameters("ReturnValue").Value = 1 And SQLInsCmd.Parameters("OutPutParam").Value = 0 Then 'success 'delete the input record from the source table once it is logged c.ErrorLog(Now.ToString & "--Moved record successfully", 2) OraDataAdapter.DeleteCommand.Parameters("P(0)").Value = OraDataRow.Item(6) OraDataAdapter.DeleteCommand.ExecuteNonQuery() c.ErrorLog(Now.ToString & "--Deleted record successfully", 2) OraDataAdapter.Update(OraDataTable) c.ErrorLog(Now.ToString & "--Committed record successfully", 2) i = i + 1 Else 'failure c.ErrorLog(Now.ToString & "--Failed to exec: " & c.DestIns & "Status: " & SQLInsCmd.Parameters("OutPutParam").Value & " and TrackId: " & SQLInsCmd.Parameters("TrackID").Value.ToString, 0) End If If File.Exists("stop.txt") Then c.ErrorLog(Now.ToString & "--Stop File Found", 1) 'ProcessMessages = True 'Exit Function Exit For End If End With Next OraDataAdapter.Update(OraDataTable) c.ErrorLog(Now.ToString & "--Updated Oracle Table", 1) c.ErrorLog(Now.ToString & "--Moved " & i & " records from Oracle to SQL Table", 1) ProcessMessages = True Catch ex As Exception ProcessMessages = False c.ErrorLog(Now.ToString & "--MoveMsgsToSQL: " & ex.Message, 0) Finally OraDataTable.Clear() OraDataTable.Dispose() OraDataAdapter.Dispose() OraDelCmd.Dispose() OraDelCmd = Nothing OraSelCmd = Nothing OraDataTable = Nothing OraDataAdapter = Nothing End Try End Function Public Function GenerateTransactionID() As Int64 Dim SeqNo As Int64 Dim qry As String Dim SqlTransCmd As New OleDb.OleDbCommand qry = " select seqno from StoreSeqNo" SqlTransCmd.CommandType = CommandType.Text SqlTransCmd.Connection = SqlConn SqlTransCmd.CommandText = qry SeqNo = SqlTransCmd.ExecuteScalar If SeqNo > 2147483647 Then qry = "update StoreSeqNo set seqno=1" SqlTransCmd.CommandText = qry SqlTransCmd.ExecuteNonQuery() GenerateTransactionID = 1 Else qry = "update StoreSeqNo set seqno=" & SeqNo + 1 SqlTransCmd.CommandText = qry SqlTransCmd.ExecuteNonQuery() GenerateTransactionID = SeqNo End If End Function Private Function PrepareSQLInsert() As Boolean 'function to prepare the insert statement for the insert into the SQL stmt using 'the sql procedure SMSProcessAndDispatch Try Dim dr As DataRow SQLInsCmd = New OleDb.OleDbCommand With SQLInsCmd .CommandType = CommandType.StoredProcedure .Connection = SqlConn .CommandText = SQLInsProc .Parameters.Add("ReturnValue", OleDb.OleDbType.Integer) .Parameters("ReturnValue").Direction = ParameterDirection.ReturnValue .Parameters.Add("OutPutParam", OleDb.OleDbType.Integer) .Parameters("OutPutParam").Direction = ParameterDirection.Output .Parameters.Add("TrackID", OleDb.OleDbType.VarChar, 70) .Parameters.Add("RelLifeTime", OleDb.OleDbType.TinyInt) .Parameters("RelLifeTime").Direction = ParameterDirection.Input .Parameters.Add("Param1", OleDb.OleDbType.VarChar, 160) .Parameters("Param1").Direction = ParameterDirection.Input .Parameters.Add("TransID", OleDb.OleDbType.VarChar, 70) .Parameters("TransID").Direction = ParameterDirection.Input .Parameters.Add("UID", OleDb.OleDbType.VarChar, 20) .Parameters("UID").Direction = ParameterDirection.Input .Parameters.Add("Param", OleDb.OleDbType.VarChar, 160) .Parameters("Param").Direction = ParameterDirection.Input .Parameters.Add("CheckCredit", OleDb.OleDbType.Integer) .Parameters("CheckCredit").Direction = ParameterDirection.Input .Prepare() End With Catch ex As Exception c.ErrorLog(Now.ToString & "--PrepareSQLInsert: " & ex.Message) End Try End Function Private Function PrepOraDel() As Boolean OraDelCmd = New OleDb.OleDbCommand Try PrepOraDel = False With OraDelCmd .CommandType = CommandType.Text .Connection = OraConn .CommandText = DelSrcSQL .Parameters.Add("P(0)", OleDb.OleDbType.VarChar, 160) 'RowID .Parameters("P(0)").Direction = ParameterDirection.Input .Prepare() End With OraDataAdapter.DeleteCommand = OraDelCmd PrepOraDel = True Catch ex As Exception PrepOraDel = False End Try End Function WHat i would like to know is, if there is anyway to speed up this program? Any ideas/suggestions would be highly appreciated... Regardss, Chetan

    Read the article

  • Scale an image with unscalable parts

    - by Uko
    Brief description of problem: imagine having some vector picture(s) and text annotations on the sides outside of the picture(s). Now the task is to scale the whole composition while preserving the aspect ratio in order to fit some view-port. The tricky part is that the text is not scalable only the picture(s). The distance between text and the image is still relative to the whole image, but the text size is always a constant. Example: let's assume that our total composition is two times larger than a view-port. Then we can just scale it by 1/2. But because the text parts are a fixed font size, they will become larger than we expect and won't fit in the view-port. One option I can think of is an iterative process where we repeatedly scale our composition until the delta between it and the view-port satisfies some precision. But this algorithm is quite costly as it involves working with the graphics and the image may be composed of a lot of components which will lead to a lot of matrix computations. What's more, this solution seems to be hard to debug, extend, etc. Are there any other approaches to solving this scaling problem?

    Read the article

  • how to develop php on apache server

    - by user238284
    I am trying to make php to work with Apache. . i surfed for the procedures and finally i was asked to do the below mentioned operation .. but i am unable to understand it can anyone please help me .I am using Windows XP. # Add the following 3 lines to your httpd.conf file. You can put them anywhere in the file but maybe it makes sense to put them after the other LoadModule section. LoadModule php5_module "d:/Program Files/php/php5apache2_2.dll" AddType application/x-httpd-php .php PHPIniDir "D:\Program Files\php" Is there any other link which helps to install PHP,Apache and MySql. Please help me. Thank you in advance

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • What's this UI pattern called?

    - by Bears will eat you
    I'm trying to figure out what this sort of thing is called, and eventually how I can create one in a web browser. It looks like this (screenshot of the first app that came to mind): The specific component/pattern I'm looking for is the two list boxes ("Included Gear" and "Excluded Gear") that represent inclusion/exclusion of items from a set. I'm not really looking for the WPF name (if there is one) but it might be helpful. I am looking for the name of this thingy, if there is one, and if you really want to make my day, you can point me toward a jQuery or YUI way of making one of these dealies in a browser. In case you were wondering, the screenshot is a World of Warcraft gear optimization program. Go figure why it was the first program that came to mind when I was trying to think of an example.

    Read the article

  • convert flv to mp3 with Java

    - by krial
    Hi, I'm pretty new in developing programs in Java. I'm currently writing a program that converts a flv video into mp3. I have already written such a program in Visual Studio.net C#, but the Problem is, that it isn't cross platform compatible... I used the ffmpeg binary to convert the video into mp3, but I can't find ffmpeg binaries for Mac and Linux. (if so, I could start the specific binaries from java, depending on the OS) So I tried to convert the video with Xuggle, but the final mp3 has 0 bytes. My current code is the following: IMediaReader reader = ToolFactory.makeReader("video.flv"); reader.addListener(ToolFactory.makeWriter("music.mp3", reader)); while (reader.readPacket() == null) do {} while(false); Thanks in advance. p.s sorry for my bad english

    Read the article

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • Getting local My Documents folder path

    - by smsrecv
    In my C++/WinAPI application I get the My Documents folder path using this code: wchar_t path[MAX_PATH]; SHGetFolderPathW(NULL,CSIDL_PERSONAL,NULL,SHGFP_TYPE_CURRENT,path); One of the users runs my program on a pc connected to his corporate network. He has the My Documents folder on a network. So my code returns something like \paq\user.name$\My Documents Though he says he has a local copy of My Documents. The problem is that when he 'swaps VPN', the online My Documents becomes unavailable and my program crashes with the system error code 64 "The specified network name is no longer available" ( it tries to write to the file opened in the online my docs folder). How can I always get the local My Documents folder path using C++/WinAPI?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • C#, working with files, "Unauthorized Access"?

    - by Rob
    Hi, I'm learning about opening and saving files with C# and it seems that vista won't let my program save to a file on the root of C:\ , unless I run it in administrator mode. Any ideas how to allow my program to play around with whatever files it wants? Thanks! string name; private void button2_Click(object sender, EventArgs e) ///// OPEN ///// { if (openFileDialog1.ShowDialog() == DialogResult.OK) { name = openFileDialog1.FileName; textBox1.Clear(); textBox1.Text = File.ReadAllText(name); textBox2.Text = name; } } private void button1_Click(object sender, EventArgs e) ///// SAVE ///// { File.WriteAllText(name, textBox1.Text); }

    Read the article

  • Making commercial Java software

    - by roddik
    Hi. I intend to make some software to be sold over internet. I've only created open-source before, so I have really no idea of how to protect it from being cracked and distributed as warez. Bearing in mind that I know like two programms that aren't either cracked or not really useful I decided that the only more or less reliable way may look like this: Connect to a server and provide licensing info and some sort of hardware summary info If everything is fine, the server returns some crucial missing parts of the program bound to that certain pc along with the usage limit of say 2 days That crucial stuff is not saved to hard drive, so it is downloaded every time the program starts, if the programm runs more than 2 days, data is downloaded again If the same info is used from different computers, suspend the customer account What do you think about this? It may seem a bit to restrictive, but I'd better make less sales at first then eventually see my precious killer app downloaded for free. Anyways, first I need some basic theory/tutorials/guides about how to ensure that user only uses a certain Java app if he has paid for it, so please suggest some. Thanks

    Read the article

  • [C++] Needed: A simple C++ container (stack, linked list) that is thread-safe for writing

    - by conradlee
    I am writing a multi-threaded program using OpenMP in C++. At one point my program forks into many threads, each of which need to add "jobs" to some container that keeps track of all added jobs. Each job can just be a pointer to some object. Basically, I just need the add pointers to some container from several threads at the same time. Is there a simple solution that performs well? After some googling, I found that STL containers are not thread-safe. Some stackoverflow threads address this question, but none form a consensus on a simple solution.

    Read the article

  • Call external library from PHP. What is faster: exec or extension?

    - by robusta
    Hi, I need to make calls from webpage to external library written in C++ and display the result. Platform is Linux, Apache, PHP. My current idea is to use PHP service which will call my library/program. I found that there are two possible ways to do this: 1) use PHP 'exec' function 2) write PHP extension I am curious what works more effective? Faster? Less load the server? I will probably need to do 4 calls per second, so I want to be as optimal as possible. P.S. If you are aware of some other (more effective) way of calling C++ library or program from webpage, please let me know. Thanks a lot, Robusta

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

    - by numeric
    Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

    Read the article

  • Highest value datatype can store in c#

    - by user472832
    I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

    Read the article

  • just x86 assembly question~~!!

    - by kevin
    this is my assembly program which is just a function to swap *x *y. so first argument from main is address of x which is in 8(%ebp) and second one is address of y is in 12(%ebp). the program does swap x and y. I need 7 lines for doing this. can you make it 6 lines and there is a condition you can use only %eax,%ecx, and %edx 3 registers. I think about it so much.. but.. I can't make it 6 lines...there must be a way.. isn't it? this might be not a big deal.. but if there is a way to get it in 6lines. I want to know.. if you know the way~ help me~ plz~ thank you and have a good and nice day~ movl 8(%ebp), %eax movl (%eax), %ecx movl 12(%ebp), %edx movl (%edx), %eax movl %ecx, (%edx) movl 8(%ebp), %ecx movl %eax, (%ecx)

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 280 281 282 283 284 285 286 287 288 289 290 291  | Next Page >