Search Results

Search found 7722 results on 309 pages for 'pitfalls to avoid'.

Page 285/309 | < Previous Page | 281 282 283 284 285 286 287 288 289 290 291 292  | Next Page >

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • WPF: Improving Performance for Running on Older PCs

    - by Phil Sandler
    So, I'm building a WPF app and did a test deployment today, and found that it performed pretty poorly. I was surprised, as we are really not doing much in the way of visual effects or animations. I deployed on two machines: the fastest and the slowest that will need to run the application (the slowest PC has an Intel Celeron 1.80GHz with 2GB RAM). The application ran pretty well on the faster machine, but was choppy on the slower machine. And when I say "choppy", I mean the cursor jumped even just passing it over any open window of the app that had focus. I opened the Task Manager Performance window, and could see that the CPU usage jumped whenever the app had focus and the cursor was moving over it. If I gave focus to another (e.g. Excel), the CPU usage went back down after a second. This happened on both machines, but the choppiness was only noticeable on the slower machine. I had very limited time to tinker on the deployment machines, so didn't do a lot of detailed testing. The app runs fine on my development machine, but I also see the CPU spiking up to 10% there, just running the cursor over the window. I downloaded the WPF performance tool from MS and have been tinkering with it (on my dev machine). The docs say this about the "Frame Rate" metric in the Perforator tool: For applications without animation, this value should be near 0. The app is not doing any heavy animation, but the frame rate stays near 50 when the cursor is over any window. The screens I tested on have column headers in a grid that "highlight" and buttons that change color and appearance when scrolled over. Even moving the mouse on blank areas of the windows cause the same Frame rate and CPU usage (doesn't seem to be related to these minor animations). (Also, I am unable to figure out how to get anything but the two default tools--Perforator and Visual Profiler--installed into the WPF performance tool. That is probably a separate question). I also have Redgate's profiling tool, but I'm not sure if that can shed any light on rendering performance. So, I realize this is not an easy thing to troubleshoot without specifics or sample code (which I can't post). My questions are: What are some general things to look for (or avoid) in the code to improve performance? What steps can I take using the WPF performance tool to narrow down the problem? Is the PC spec listed above (Intel Celeron 1.80GHz with 2GB RAM) too slow to be running even vanilla WPF applications?

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • Template function as a template argument

    - by Kos
    I've just got confused how to implement something in a generic way in C++. It's a bit convoluted, so let me explain step by step. Consider such code: void a(int) { // do something } void b(int) { // something else } void function1() { a(123); a(456); } void function2() { b(123); b(456); } void test() { function1(); function2(); } It's easily noticable that function1 and function2 do the same, with the only different part being the internal function. Therefore, I want to make function generic to avoid code redundancy. I can do it using function pointers or templates. Let me choose the latter for now. My thinking is that it's better since the compiler will surely be able to inline the functions - am I correct? Can compilers still inline the calls if they are made via function pointers? This is a side-question. OK, back to the original point... A solution with templates: void a(int) { // do something } void b(int) { // something else } template<void (*param)(int) > void function() { param(123); param(456); } void test() { function<a>(); function<b>(); } All OK. But I'm running into a problem: Can I still do that if a and b are generics themselves? template<typename T> void a(T t) { // do something } template<typename T> void b(T t) { // something else } template< ...param... > // ??? void function() { param<SomeType>(someobj); param<AnotherType>(someotherobj); } void test() { function<a>(); function<b>(); } I know that a template parameter can be one of: a type, a template type, a value of a type. None of those seems to cover my situation. My main question is hence: How do I solve that, i.e. define function() in the last example? (Yes, function pointers seem to be a workaround in this exact case - provided they can also be inlined - but I'm looking for a general solution for this class of problems).

    Read the article

  • Abnormally disconnected TCP sockets and write timeout

    - by James
    Hello I will try to explain the problem in shortest possible words. I am using c++ builder 2010. I am using TIdTCPServer and sending voice packets to a list of connected clients. Everything works ok untill any client is disconnected abnormally, For example power failure etc. I can reproduce similar disconnect by cutting the ethernet connection of a connected client. So now we have a disconnected socket but as you know it is not yet detected at server side so server will continue to try to send data to that client too. But when server try to write data to that disconnected client ...... Write() or WriteLn() HANGS there in trying to write, It is like it is wating for somekind of Write timeout. This hangs the hole packet distribution process as a result creating a lag in data transmission to all other clients. After few seconds "Socket Connection Closed" Exception is raised and data flow continues. Here is the code try { EnterCriticalSection(&SlotListenersCriticalSection); for(int i=0;i<SlotListeners->Count;i++) { try { //Here the process will HANG for several seconds on a disconnected socket ((TIdContext*) SlotListeners->Objects[i])->Connection->IOHandler->WriteLn("Some DATA"); }catch(Exception &e) { SlotListeners->Delete(i); } } }__finally { LeaveCriticalSection(&SlotListenersCriticalSection); } Ok i already have a keep alive mechanism which disconnect the socket after n seconds of inactivity. But as you can imagine, still this mechnism cant sync exactly with this braodcasting loop because this braodcasting loop is running almost all the time. So is there any Write timeouts i can specify may be through iohandler or something ? I have seen many many threads about "Detecting disconnected tcp socket" but my problem is little different, i need to avoid that hangup for few seconds during the write attempt. So is there any solution ? Or should i consider using some different mechanism for such data broadcasting for example the broadcasting loop put the data packet in some kind of FIFO buffer and client threads continuously check for available data and pick and deliver it to themselves ? This way if one thread hangs it will not stop/delay the over all distribution thread. Any ideas please ? Thanks for your time and help. Regards Jams

    Read the article

  • Specializating a template function that takes a universal reference parameter

    - by David Stone
    How do I specialize a template function that takes a universal reference parameter? foo.hpp: template<typename T> void foo(T && t) // universal reference parameter foo.cpp template<> void foo<Class>(Class && class) { // do something complicated } Here, Class is no longer a deduced type and thus is Class exactly; it cannot possibly be Class &, so reference collapsing rules will not help me here. I could perhaps create another specialization that takes a Class & parameter (I'm not sure), but that implies duplicating all of the code contained within foo for every possible combination of rvalue / lvalue references for all parameters, which is what universal references are supposed to avoid. Is there some way to accomplish this? To be more specific about my problem in case there is a better way to solve it: I have a program that can connect to multiple game servers, and each server, for the most part, calls everything by the same name. However, they have slightly different versions for a few things. There are a few different categories that these things can be: a move, an item, etc. I have written a generic sort of "move string to move enum" set of functions for internal code to call, and my server interface code has similar functions. However, some servers have their own internal ID that they communicate with, some use strings, and some use both in different situations. Now what I want to do is make this a little more generic. I want to be able to call something like ServerNamespace::server_cast<Destination>(source). This would allow me to cast from a Move to a std::string or ServerMoveID. Internally, I may need to make a copy (or move from) because some servers require that I keep a history of messages sent. Universal references seem to be the obvious solution to this problem. The header file I'm thinking of right now would expose simply this: namespace ServerNamespace { template<typename Destination, typename Source> Destination server_cast(Source && source); } And the implementation file would define all legal conversions as template specializations.

    Read the article

  • functional dependencies vs type families

    - by mhwombat
    I'm developing a framework for running experiments with artificial life, and I'm trying to use type families instead of functional dependencies. Type families seems to be the preferred approach among Haskellers, but I've run into a situation where functional dependencies seem like a better fit. Am I missing a trick? Here's the design using type families. (This code compiles OK.) {-# LANGUAGE TypeFamilies, FlexibleContexts #-} import Control.Monad.State (StateT) class Agent a where agentId :: a -> String liveALittle :: Universe u => a -> StateT u IO a -- plus other functions class Universe u where type MyAgent u :: * withAgent :: (MyAgent u -> StateT u IO (MyAgent u)) -> String -> StateT u IO () -- plus other functions data SimpleUniverse = SimpleUniverse { mainDir :: FilePath -- plus other fields } defaultWithAgent :: (MyAgent u -> StateT u IO (MyAgent u)) -> String -> StateT u IO () defaultWithAgent = undefined -- stub -- plus default implementations for other functions -- -- In order to use my framework, the user will need to create a typeclass -- that implements the Agent class... -- data Bug = Bug String deriving (Show, Eq) instance Agent Bug where agentId (Bug s) = s liveALittle bug = return bug -- stub -- -- .. and they'll also need to make SimpleUniverse an instance of Universe -- for their agent type. -- instance Universe SimpleUniverse where type MyAgent SimpleUniverse = Bug withAgent = defaultWithAgent -- boilerplate -- plus similar boilerplate for other functions Is there a way to avoid forcing my users to write those last two lines of boilerplate? Compare with the version using fundeps, below, which seems to make things simpler for my users. (The use of UndecideableInstances may be a red flag.) (This code also compiles OK.) {-# LANGUAGE MultiParamTypeClasses, FunctionalDependencies, FlexibleInstances, UndecidableInstances #-} import Control.Monad.State (StateT) class Agent a where agentId :: a -> String liveALittle :: Universe u a => a -> StateT u IO a -- plus other functions class Universe u a | u -> a where withAgent :: Agent a => (a -> StateT u IO a) -> String -> StateT u IO () -- plus other functions data SimpleUniverse = SimpleUniverse { mainDir :: FilePath -- plus other fields } instance Universe SimpleUniverse a where withAgent = undefined -- stub -- plus implementations for other functions -- -- In order to use my framework, the user will need to create a typeclass -- that implements the Agent class... -- data Bug = Bug String deriving (Show, Eq) instance Agent Bug where agentId (Bug s) = s liveALittle bug = return bug -- stub -- -- And now my users only have to write stuff like... -- u :: SimpleUniverse u = SimpleUniverse "mydir"

    Read the article

  • jQuery AJAX POST gives undefined index

    - by Sebastian
    My eventinfo.php is giving the following output: <br /> <b>Notice</b>: Undefined index: club in <b>/homepages/19/d361310357/htdocs/guestvibe/wp-content/themes/yasmin/guestvibe/eventinfo.php</b> on line <b>11</b><br /> [] HTML (index.php): <select name="club" class="dropdown" id="club"> <?php getClubs(); ?> </select> jQuery (index.php): <script type="text/javascript"> $(document).ready(function() { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $('#club').serialize(), success: function(data) { $('#rightbox_inside').html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>'); }, dataType: "json" }); }); $('#club').change(function(event) { $.ajax({ type: "POST", url: "http://www.guestvibe.com/wp-content/themes/yasmin/guestvibe/eventinfo.php", data: $(this).serialize(), success: function(data) { $('#rightbox_inside').hide().html('<h2>' + $('#club').val() + '<span style="font-size: 14px"> (' + data[0].day + ')</h2><hr><p><b>Entry:</b> ' + data[0].entry + '</p><p><b>Queue jump:</b> ' + data[0].queuejump + '</p><br><p><i>Guestlist closes at ' + data[0].closing + '</i></p>').fadeIn('500'); }, dataType: "json" }); }); </script> I can run alerts from the jQuery, so it is active. I've copied this as is from an old version of the website, but I've changed the file structure (through to move to WordPress) so I suspect the variables might not even be reaching eventinfo.php in the first place... index.php is in wp-content/themes/cambridge and eventinfo.php is in wp-content/themes/yasmin/guestvibe but I've tried to avoid structuring issues by referencing the URL in full. Any ideas?

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Endianness conversion and g++ warnings

    - by SuperBloup
    I've got the following C++ code : template <int isBigEndian, typename val> struct EndiannessConv { inline static val fromLittleEndianToHost( val v ) { union { val outVal __attribute__ ((used)); uint8_t bytes[ sizeof( val ) ] __attribute__ ((used)); } ; outVal = v; std::reverse( &bytes[0], &bytes[ sizeof(val) ] ); return outVal; } inline static void convertArray( val v[], uint32_t size ) { // TODO : find a way to map the array for (uint32_t i = 0; i < size; i++) for (uint32_t i = 0; i < size; i++) v[i] = fromLittleEndianToHost( v[i] ); } }; Which work and has been tested (without the used attributes). When compiling I obtain the following errors from g++ (version 4.4.1) || g++ -Wall -Wextra -O3 -o t t.cc || t.cc: In static member function 'static val EndiannessConv<isBigEndian, val>::fromLittleEndianToHost(val)': t.cc|98| warning: 'used' attribute ignored t.cc|99| warning: 'used' attribute ignored || t.cc: In static member function 'static val EndiannessConv<isBigEndian, val>::fromLittleEndianToHost(val) [with int isBigEndian = 1, val = double]': t.cc|148| instantiated from here t.cc|100| warning: unused variable 'outVal' t.cc|100| warning: unused variable 'bytes' I've tried to use the following code : template <int size, typename valType> struct EndianInverser { /* should not compile */ }; template <typename valType> struct EndianInverser<4, valType> { static inline valType reverseEndianness( const valType &val ) { uint32_t castedVal = *reinterpret_cast<const uint32_t*>( &val ); castedVal = (castedVal & 0x000000FF << (3 * 8)) | (castedVal & 0x0000FF00 << (1 * 8)) | (castedVal & 0x00FF0000 >> (1 * 8)) | (castedVal & 0xFF000000 >> (3 * 8)); return *reinterpret_cast<valType*>( &castedVal ); } }; but it break when enabling optimizations due to the type punning. So, why does my used attribute got ignored? Is there a workaround to convert endianness (I rely on the enum to avoid type punning) in templates?

    Read the article

  • C# Serialization Surrogate - Cannot access a disposed object

    - by crushhawk
    I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Getting rid of "static" references in C#

    - by DevEight
    Hello. I've recently begun learning C# but have encountered an annoying problem. Every variable I want available to all functions in my program I have to put a "static" in front of and also every function. What I'd like to know is how to avoid this, if possible? Also, small side question: creating public variables inside functions? This is what my program looks like right now, and I want to basically keep it like that, without having to add "static" everywhere: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Net; using System.Threading; using System.Net.Sockets; namespace NetworkExercise { class Client { public IPAddress addr; public int port; public string name; public Thread thread; public TcpClient tcp; public NetworkStream stream; public Client(IPAddress addr, int port, string name, NetworkStream stream) { } } class Program { //NETWORK TcpListener tcpListener; Thread listenThread; ASCIIEncoding encoder = new ASCIIEncoding(); //DATA byte[] buffer = new byte[4096]; string servIp; int servPort; //CLIENT MANAGEMENT int clientNum; static void Main(string[] args) { beginConnect(); } public void beginConnect() { Console.Write("Server IP (leave blank if you're the host): "); servIp = Console.ReadLine(); Console.Write("Port: "); servPort = Console.Read(); tcpListener = new TcpListener(IPAddress.Any, servPort); listenThread = new Thread(new ThreadStart(listenForClients)); listenThread.Start(); } public void listenForClients() { tcpListener.Start(); Console.WriteLine("Listening for clients..."); while (true) { Client cl = new Client(null, servPort, null, null); cl.tcp = tcpListener.AcceptTcpClient(); ThreadStart pts = delegate { handleClientCom(cl); }; cl.thread = new Thread(pts); cl.thread.Start(); } } public void handleClientCom(Client cl) { cl.stream = cl.tcp.GetStream(); } } }

    Read the article

  • Helping linqtosql datacontext use implicit conversion between varchar column in the database and tab

    - by user213256
    I am creating an mssql database table, "Orders", that will contain a varchar(50) field, "Value" containing a string that represents a slightly complex data type, "OrderValue". I am using a linqtosql datacontext class, which automatically types the "Value" column as a string. I gave the "OrderValue" class implicit conversion operators to and from a string, so I can easily use implicit conversion with the linqtosql classes like this: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // use implicit converstion to turn the string representation of the order // value into the complex data type. OrderValue value = order.Value; // adjust one of the fields in the complex data type value.Shipping += 10; // use implicit conversion to store the string representation of the complex // data type back in the linqtosql order object order.Value = value; // save changes db.SubmitChanges(); However, I would really like to be able to tell the linqtosql class to type this field as "OrderValue" rather than as "string". Then I would be able to avoid complex code and re-write the above as: // get an order from the orders table MyDataContext db = new MyDataContext(); Order order = db.Orders(o => o.id == 1); // The Value field is already typed as the "OrderValue" type rather than as string. // When a string value was read from the database table, it was implicity converted // to "OrderValue" type. order.Value.Shipping += 10; // save changes db.SubmitChanges(); In order to achieve this desired goal, I looked at the datacontext designer and selected the "Value" field of the "Order" table. Then, in properties, I changed "Type" to "global::MyApplication.OrderValue". The "Server Data Type" property was left as "VarChar(50) NOT NULL" The project built without errors. However, when reading from the database table, I was presented with the following error message: Could not convert from type 'System.String' to type 'MyApplication.OrderValue'. at System.Data.Linq.DBConvert.ChangeType(Object value, Type type) at Read_Order(ObjectMaterializer1 ) at System.Data.Linq.SqlClient.ObjectReaderCompiler.ObjectReader2.MoveNext() at System.Linq.Buffer1..ctor(IEnumerable1 source) at System.Linq.Enumerable.ToArray[TSource](IEnumerable`1 source) at Example.OrdersProvider.GetOrders() at ... etc From the stack trace, I believe this error is happening while reading the data from the table. When presented with converting a string to my custom data type, even though the implicit conversion operators are present, the DBConvert class gets confused and throws an error. Is there anything I can do to help it not get confused and do the implicit conversion? Thanks in advance, and apologies if I have posted in the wrong forum. cheers / Ben

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Jquery - Loading a page with .load and selector doesn't execute script?

    - by PirateKitten
    I'm trying to load one page into another using the .load() method. This loaded page contains a script that I want to execute when it has finished loading. I've put together a barebones example to demonstrate: Index.html: <html> <head> <title>Jquery Test</title> <script type="text/javascript" src="script/jquery-1.3.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('#nav a').click(function() { $('#contentHolder').load('content.html #toLoad', '', function() {}); return false; }); }); </script> </head> <body> <div id="nav"> <a href="content.html">Click me!</a> </div> <hr /> <div id="contentHolder"> Content loaded will go here </div> </body> </html> Content.html: <div id="toLoad"> This content is from content.html <div id="contentDiv"> This should fade away. </div> <script type="text/javascript"> $('#contentDiv').fadeOut('slow', function() {} ); </script> </div> When the link is clicked, the content should load and the second paragraph should fade away. However it doesn't execute. If I stick a simple alert("") in the script of content.html it doesn't execute either. However, if I do away with the #toLoad selector in the .load() call, it works fine. I am not sure why this is, as the block is clearly in the scope of the #toLoad div. I don't want to avoid using the selector, as in reality the content.html will be a full HTML page, and I'll only want a select part out of it. Any ideas? If the script from content.html was in the .load() callback, it works fine, however I obviously don't want that logic contained within index.html. I could possibly have the callback use .getScript() to load "content.html.js" afterwards and have the logic in there, that seems to work? I'd prefer to keep the script in content.html, if possible, so that it executes fine when loaded normally too. In fact, I might do this anyway, but I would like to know why the above doesn't work.

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • Javascript self contained sandbox events and client side stack

    - by amnon
    I'm in the process of moving a JSF heavy web application to a REST and mainly JS module application . I've watched "scalable javascript application architecture" by Nicholas Zakas on yui theater (excellent video) and implemented much of the talk with good success but i have some questions : I found the lecture a little confusing in regards to the relationship between modules and sandboxes , on one had to my understanding modules should not be effected by something happening outside of their sandbox and this is why they publish events via the sandbox (and not via the core as they do access the core for hiding base libary) but each module in the application gets a new sandbox ? , shouldn't the sandbox limit events to the modoules using it ? or should events be published cross page ? e.g. : if i have two editable tables but i want to contain each one in a different sandbox and it's events effect only the modules inside that sandbox something like messabe box per table which is a different module/widget how can i do that with sandbox per module , ofcourse i can prefix the events with the moduleid but that creates coupling that i want to avoid ... and i don't want to package modules toghter as one module per combination as i already have 6-7 modules ? while i can hide the base library for small things like id selector etc.. i would still like to use the base library for module dependencies and resource loading and use something like yui loader or dojo.require so in fact i'm hiding the base library but the modules themself are defined and loaded by the base library ... seems a little strange to me libraries don't return simple js objects but usualy wrap them e.g. : u can do something like $$('.classname').each(.. which cleans the code alot , it makes no sense to wrap the base and then in the module create a dependency for the base library by executing .each but not using those features makes a lot of code written which can be left out ... and implemnting that functionality is very bug prone does anyonen have any experience with building a front side stack of this order ? how easy is it to change a base library and/or have modules from different libraries , using yui datatable but doing form validation with dojo ... ? some what of a combination of 2+4 if u choose to do something like i said and load dojo form validation widgets for inputs via yui loader would that mean dojocore is a module and the form module is dependant on it ? Thanks .

    Read the article

  • C++: Trouble with Pointers, loop variables, and structs

    - by Rosarch
    Consider the following example: #include <iostream> #include <sstream> #include <vector> #include <wchar.h> #include <stdlib.h> using namespace std; struct odp { int f; wchar_t* pstr; }; int main() { vector<odp> vec; ostringstream ss; wchar_t base[5]; wcscpy_s(base, L"1234"); for (int i = 0; i < 4; i++) { odp foo; foo.f = i; wchar_t loopStr[1]; foo.pstr = loopStr; // wchar_t* = wchar_t ? Why does this work? foo.pstr[0] = base[i]; vec.push_back(foo); } for (vector<odp>::iterator iter = vec.begin(); iter != vec.end(); iter++) { cout << "Vec contains: " << iter->f << ", " << *(iter->pstr) << endl; } } This produces: Vec contains: 0, 52 Vec contains: 1, 52 Vec contains: 2, 52 Vec contains: 3, 52 I would hope that each time, iter->f and iter->pstr would yield a different result. Unfortunately, iter->pstr is always the same. My suspicion is that each time through the loop, a new loopStr is created. Instead of copying it into the struct, I'm only copying a pointer. The location that the pointer writes to is getting overwritten. How can I avoid this? Is it possible to solve this problem without allocating memory on the heap?

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

  • How to perform gui operation in doInBackground method?

    - by jM2.me
    My application reads a user selected file which contains addresses and then displays on mapview when done geocoding. To avoid hanging app the importing and geocoding is done in AsyncTask. public class LoadOverlayAsync extends AsyncTask<Uri, Integer, StopsOverlay> { Context context; MapView mapView; Drawable drawable; public LoadOverlayAsync(Context con, MapView mv, Drawable dw) { context = con; mapView = mv; drawable = dw; } protected StopsOverlay doInBackground(Uri... uris) { StringBuilder text = new StringBuilder(); StopsOverlay stopsOverlay = new StopsOverlay(drawable, context); Geocoder geo = new Geocoder(context, Locale.US); try { File file = new File(new URI(uris[0].toString())); BufferedReader br = new BufferedReader(new FileReader(file)); String line; while ((line = br.readLine()) != null) { StopOverlay stopOverlay = null; String[] tempLine = line.split("~"); List<Address> results = geo.getFromLocationName(tempLine[4] + " " + tempLine[5] + " " + tempLine[7] + " " + tempLine[8], 10); if (results.size() > 0) { Toast progressToast = Toast.makeText(context, "More than one yo", 1000); progressToast.show(); } else if (results.size() == 1) { Address addr = results.get(0); GeoPoint mPoint = new GeoPoint((int)(addr.getLatitude() * 1E6), (int)(addr.getLongitude() * 1E6)); stopOverlay = new StopOverlay(mPoint, tempLine); } if (stopOverlay != null) { stopsOverlay.addOverlay(stopOverlay); } //List<Address> results = geo.getFromLocationName(locationName, maxResults) } } catch (URISyntaxException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (FileNotFoundException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (IOException e) { showErrorToast(e.toString()); //e.printStackTrace(); } return stopsOverlay; } protected void onProgressUpdate(Integer... progress) { Toast progressToast = Toast.makeText(context, "Loaded " + progress.toString(), 1000); progressToast.show(); } protected void onPostExecute(StopsOverlay so) { //mapView.getOverlays().add(so); Toast progressToast = Toast.makeText(context, "Done geocoding", 1000); progressToast.show(); } protected void showErrorToast(String msg) { Toast Newtoast = Toast.makeText(context, msg, 10000); Newtoast.show(); } } But if geocode fails, I want a dialog popup to let user edit the address. That would require calling on gui method while in doInBackground. What would be a good workaround this?

    Read the article

  • Avoiding explicit recursion in Haskell

    - by Travis Brown
    The following simple function applies a given monadic function iteratively until it hits a Nothing, at which point it returns the last non-Nothing value. It does what I need, and I understand how it works. lastJustM :: (Monad m) => (a -> m (Maybe a)) -> a -> m a lastJustM g x = g x >>= maybe (return x) (lastJustM g) As part of my self-education in Haskell I'm trying to avoid explicit recursion (or at least understand how to) whenever I can. It seems like there should be a simple non-explicitly recursive solution in this case, but I'm having trouble figuring it out. I don't want something like a monadic version of takeWhile, since it could be expensive to collect all the pre-Nothing values, and I don't care about them anyway. I checked Hoogle for the signature and nothing shows up. The m (Maybe a) bit makes me think a monad transformer might be useful here, but I don't really have the intuitions I'd need to come up with the details (yet). It's probably either embarrassingly easy to do this or embarrassingly easy to see why it can't or shouldn't be done, but this wouldn't be the first time I've used self-embarrassment as a pedagogical strategy. Background: Here's a simplified working example for context: suppose we're interested in random walks in the unit square, but we only care about points of exit. We have the following step function: randomStep :: (Floating a, Ord a, Random a) => a -> (a, a) -> State StdGen (Maybe (a, a)) randomStep s (x, y) = do (a, gen') <- randomR (0, 2 * pi) <$> get put gen' let (x', y') = (x + s * cos a, y + s * sin a) if x' < 0 || x' > 1 || y' < 0 || y' > 1 then return Nothing else return $ Just (x', y') Something like evalState (lastJustM (randomStep 0.01) (0.5, 0.5)) <$> newStdGen will give us a new data point.

    Read the article

  • Robust way to save/load objects with dependencies?

    - by mrteacup
    I'm writing an Android game in Java and I need a robust way to save and load application state quickly. The question seems to apply to most OO languages. To understand what I need to save: I'm using a Strategy pattern to control my game entities. The idea is I have a very general Entity class which e.g. stores the location of a bullet/player/enemy and I then attach a Behaviour class that tells the entity how to act: class Entiy { float x; float y; Behavior b; } abstract class Behavior { void update(Entity e); {} // Move about at a constant speed class MoveBehavior extends Behavior { float speed; void update ... } // Chase after another entity class ChaseBehavior extends Behavior { Entity target; void update ... } // Perform two behaviours in sequence class CombineBehavior extends Behavior { Behaviour a, b; void update ... } Essentially, Entity objects are easy to save but Behaviour objects can have a semi-complex graph of dependencies between other Entity objects and other Behaviour objects. I also have cases where a Behaviour object is shared between entities. I'm willing to change my design to make saving/loading state easier, but the above design works really well for structuring the game. Anyway, the options I've considered are: Use Java serialization. This is meant to be really slow in Android (I'll profile it sometime). I'm worried about robustness when changes are made between versions however. Use something like JSON or XML. I'm not sure how I would cope with storing the dependencies between objects however. Would I have to give each object a unique ID and then use these IDs on loading to link the right objects together? I thought I could e.g. change the ChaseBehaviour to store a ID to an entity, instead of a reference, that would be used to look up the Entity before performing the behaviour. I'd rather avoid having to write lots of loading/saving code myself as I find it really easy to make mistakes (e.g. forgetting to save something, reading things out in the wrong order). Can anyone give me any tips on good formats to save to or class designs that make saving state easier?

    Read the article

  • PHP, MySQL: Display only required parts of my website in sister website

    - by Devner
    Hi all, Now I have my website built on PHP & Mysql. Consider this like a forum. Now when a user posts a reply in my website 1 (ex. www.website1.com), I want to be able to show the starting thread and it's related replies in a sister website of mine. I want to do this in a way that it does not show the rest of the page & other page contents (like logo etc.). I don't think iframe would be a solution because an iframe would embed the whole page and the users visiting my sister website (totally different domain i.e. www.website2.com) would be able to see all the page contents, like logo etc. I want to avoid that. I want to make them see only limited information from website 1 and only the info. that I intend. I hope that makes sense. In a way, you could say that I am trying to replicate my 1 website, and show only a limited part of it. Users browsing 2nd website can post a reply in the 2nd website and it should automatically be posted & visible to the visitors of the website 1. Users of website 1 should not know that a user of website 2 has posted it. They would feel that some user from website 1 has posted it. Do I have to use 2 separate mysql DB or just 1? I think it would be problematic if I am trying to use different DB. I also feel I might have to face DB connectivity issues as I can connect to only 1 DB at a time. It's basically like users of website1.com should feel that they are replying to users of website1.com & users of website2.com should feel that they are replying to users of website2.com. (I need it this way to bridge the gap between them). At the same time I want to make the front end of the websites different so that they don't feel that they are replying to some other users outside the domain. These websites would be under my control and I will have access to the source code at any time. If I need to change the source code, these changes are welcome. Is this really possible? Thank you in advance.

    Read the article

< Previous Page | 281 282 283 284 285 286 287 288 289 290 291 292  | Next Page >