Search Results

Search found 69503 results on 2781 pages for 'file listing'.

Page 290/2781 | < Previous Page | 286 287 288 289 290 291 292 293 294 295 296 297  | Next Page >

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • Retrieving Encrypted Rich Text file and showing it in a RichTextBox C#

    - by Ranhiru
    OK, my need here is to save whatever typed in the rich text box to a file, encrypted, and also retrieve the text from the file again and show it back on the rich textbox. Here is my save code. private void cmdSave_Click(object sender, EventArgs e) { FileStream fs = new FileStream(filePath, FileMode.Create, FileAccess.Write); AesCryptoServiceProvider aes = new AesCryptoServiceProvider(); aes.GenerateIV(); aes.GenerateKey(); aes.Mode = CipherMode.CBC; TextWriter twKey = new StreamWriter("key"); twKey.Write(ASCIIEncoding.ASCII.GetString(aes.Key)); twKey.Close(); TextWriter twIV = new StreamWriter("IV"); twIV.Write(ASCIIEncoding.ASCII.GetString(aes.IV)); twIV.Close(); ICryptoTransform aesEncrypt = aes.CreateEncryptor(); CryptoStream cryptoStream = new CryptoStream(fs, aesEncrypt, CryptoStreamMode.Write); richTextBox1.SaveFile(cryptoStream, RichTextBoxStreamType.RichText); } I know the security consequences of saving the key and iv in a file but this just for testing :) Well, the saving part works fine which means no exceptions... The file is created in filePath and the key and IV files are created fine too... OK now for retrieving part where I am stuck :S private void cmdOpen_Click(object sender, EventArgs e) { OpenFileDialog openFile = new OpenFileDialog(); openFile.ShowDialog(); FileStream openRTF = new FileStream(openFile.FileName, FileMode.Open, FileAccess.Read); AesCryptoServiceProvider aes = new AesCryptoServiceProvider(); TextReader trKey = new StreamReader("key"); byte[] AesKey = ASCIIEncoding.ASCII.GetBytes(trKey.ReadLine()); TextReader trIV = new StreamReader("IV"); byte[] AesIV = ASCIIEncoding.ASCII.GetBytes(trIV.ReadLine()); aes.Key = AesKey; aes.IV = AesIV; ICryptoTransform aesDecrypt = aes.CreateDecryptor(); CryptoStream cryptoStream = new CryptoStream(openRTF, aesDecrypt, CryptoStreamMode.Read); StreamReader fx = new StreamReader(cryptoStream); richTextBox1.Rtf = fx.ReadToEnd(); //richTextBox1.LoadFile(fx.BaseStream, RichTextBoxStreamType.RichText); } But the richTextBox1.Rtf = fx.ReadToEnd(); throws an cryptographic exception "Padding is invalid and cannot be removed." while richTextBox1.LoadFile(fx.BaseStream, RichTextBoxStreamType.RichText); throws an NotSupportedException "Stream does not support seeking." Any suggestions on what i can do to load the data from the encrypted file and show it in the rich text box?

    Read the article

  • Android app crashes when I change the default xml layout file to another

    - by mib1413456
    I am currently just starting to learn android development and have created a basic "Hello world" app that uses "activity_main.xml" for the default layout. I tried to create a new layout xml file called "new_layout.xml" with a text view, a text field and a button and did the following changes in the MainActivity.java file: setContentView(R.layout.new_layout); I did nothing else expect for adding a new_layout.xml in the res/layout folder, I have tried restarting and cleaning the project but nothing. Below is my activity_main.xml file, new_layout.xml file and MainActivity.java activity_main.xml: <FrameLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:id="@+id/container" android:layout_width="match_parent" android:layout_height="match_parent" tools:context="org.example.androidsdk.demo.MainActivity" tools:ignore="MergeRootFrame" /> new_layout.xml: <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="match_parent" android:layout_height="match_parent" android:orientation="horizontal" > <TextView android:id="@+id/textView1" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="TextView" /> <EditText android:id="@+id/editText1" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_weight="1" android:ems="10" > <requestFocus /> </EditText> <Button android:id="@+id/button1" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="Button" /> MainActivity.java file package org.example.androidsdk.demo; import android.app.Activity; import android.app.ActionBar; import android.app.Fragment; import android.os.Bundle; import android.view.LayoutInflater; import android.view.Menu; import android.view.MenuItem; import android.view.View; import android.view.ViewGroup; import android.os.Build; public class MainActivity extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.new_layout); if (savedInstanceState == null) { getFragmentManager().beginTransaction() .add(R.id.container, new PlaceholderFragment()) .commit(); } } @Override public boolean onCreateOptionsMenu(Menu menu) { // Inflate the menu; this adds items to the action bar if it is present. getMenuInflater().inflate(R.menu.main, menu); return true; } @Override public boolean onOptionsItemSelected(MenuItem item) { // Handle action bar item clicks here. The action bar will // automatically handle clicks on the Home/Up button, so long // as you specify a parent activity in AndroidManifest.xml. int id = item.getItemId(); if (id == R.id.action_settings) { return true; } return super.onOptionsItemSelected(item); } /** * A placeholder fragment containing a simple view. */ public static class PlaceholderFragment extends Fragment { public PlaceholderFragment() { } @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { View rootView = inflater.inflate(R.layout.fragment_main, container, false); return rootView; } } }

    Read the article

  • Save File to Sharepoint Server using JAX-WS

    - by Evan Porter
    I'm trying to save a file to a Sharepoint server using JAX-WS. The web service call is reporting a success, but the file doesn't show up. I used this command (from a WinXP) to generate the Java code to make the JAX-WS call: wsimport -keep -extension -Xnocompile http://hostname/sites/teamname/_vti_bin/Copy.asmx?WSDL I get a handle on the web service which I called port using the following: CopySoap port = null; if (userName != null && password != null) { Copy service = new Copy(); port = service.getCopySoap(); ((BindingProvider) port).getRequestContext().put(BindingProvider.USERNAME_PROPERTY, userName); ((BindingProvider) port).getRequestContext().put(BindingProvider.PASSWORD_PROPERTY, password); } else { throw new Exception("Holy Frijolé! Null userName and/or password!"); } I called the web service using the following: port.copyIntoItems(sourceUrl, destUrlCollection, fields , "Contents of the file".getBytes(), copyIntoItemsResult, copyResultCollection) The sourceUrl and the only url in destUrlCollection equals "hostname/sites/teamname/Tech Docs/Sub Folder". The FieldInformationCollection object named fields contains only one FieldInformation. The FieldInformation object has "HelloWorld.txt" as the value for displayName, internalName and value. The type property is set to FieldType.FILE. The id property is set to (java.util.UUID.randomUUID()).toString(). The call to copyIntoItems returns successfuly; copyIntoItemsResult contains a value of 0 and the only CopyResult object set in copyResultCollection has an error code of "SUCCESS" with a null error message. When I look into the "Tech Docs" library on Sharepoint, in the "Sub Folder" there's no file there. Why wouldn't it tell me what I did wrong? Did I just miss a step? Update (Feb 26th, 2011) I've changed my FieldInformation object's displayName and internalName properties to be "Title" as suggested. Still no joy, but a step in the right direction. After playing around with the urls for a bit, I got these results: With both the sourceUrl and the only destination URL equivalent, with no protocol, I get the SUCCESS response but no actual document appears in the document library. With both of the URLs equivalent but with an "http://" protocol specified, I get an UNKNOWN error with "Object reference not set to an instance of an object." as the message. With the source URL an empty string or null, I get an UNKNOWN error with " Value does not fall within the expected range." as the error message.

    Read the article

  • A couple questions using fwrite/fread with data structures

    - by Nazgulled
    Hi, I'm using fwrite() and fread() for the first time to write some data structures to disk and I have a couple of questions about best practices and proper ways of doing things. What I'm writing to disk (so I can later read it back) is all user profiles inserted in a Graph structure. Each graph vertex is of the following type: typedef struct sUserProfile { char name[NAME_SZ]; char address[ADDRESS_SZ]; int socialNumber; char password[PASSWORD_SZ]; HashTable *mailbox; short msgCount; } UserProfile; And this is how I'm currently writing all the profiles to disk: void ioWriteNetworkState(SocialNetwork *social) { Vertex *currPtr = social->usersNetwork->vertices; UserProfile *user; FILE *fp = fopen("save/profiles.dat", "w"); if(!fp) { perror("fopen"); exit(EXIT_FAILURE); } fwrite(&(social->usersCount), sizeof(int), 1, fp); while(currPtr) { user = (UserProfile*)currPtr->value; fwrite(&(user->socialNumber), sizeof(int), 1, fp); fwrite(user->name, sizeof(char)*strlen(user->name), 1, fp); fwrite(user->address, sizeof(char)*strlen(user->address), 1, fp); fwrite(user->password, sizeof(char)*strlen(user->password), 1, fp); fwrite(&(user->msgCount), sizeof(short), 1, fp); break; currPtr = currPtr->next; } fclose(fp); } Notes: The first fwrite() you see will write the total user count in the graph so I know how much data I need to read back. The break is there for testing purposes. There's thousands of users and I'm still experimenting with the code. My questions: After reading this I decided to use fwrite() on each element instead of writing the whole structure. I also avoid writing the pointer to to the mailbox as I don't need to save that pointer. So, is this the way to go? Multiple fwrite()'s instead of a global one for the whole structure? Isn't that slower? How do I read back this content? I know I have to use fread() but I don't know the size of the strings, cause I used strlen() to write them. I could write the output of strlen() before writing the string, but is there any better way without extra writes?

    Read the article

  • Reporting Services as PDF through WebRequest in C# 3.5 "Not Supported File Type"

    - by Heath Allison
    I've inherited a legacy application that is supposed to grab an on the fly pdf from a reporting services server. Everything works fine up until the point where you try to open the pdf being returned and adobe acrobat tells you: Adobe Reader could not open 'thisStoopidReport'.pdf' because it is either not a supported file type or because the file has been damaged(for example, it was sent as an email attachment and wasn't correctly decoded). I've done some initial troubleshooting on this. If I replace the url in the WebRequest.Create() call with a valid pdf file on my local machine ie: @"C:temp/validpdf.pdf") then I get a valid PDF. The report itself seems to work fine. If I manually type the URL to the reporting services report that should generate the pdf file I am prompted for user authentication. But after supplying it I get a valid pdf file. I've replace the actual url,username,userpass and domain strings in the code below with bogus values for obvious reasons. WebRequest request = WebRequest.Create(@"http://x.x.x.x/reportServer?/reports/reportNam&rs:format=pdf&rs:command=render&rc:parameters=blahblahblah"); int totalSize = 0; request.Credentials = new NetworkCredential("validUser", "validPass", "validDomain"); request.Timeout = 360000; // 6 minutes in milliseconds. request.Method = WebRequestMethods.Http.Post; request.ContentLength = 0; WebResponse response = request.GetResponse(); Response.Clear(); BinaryReader reader = new BinaryReader(response.GetResponseStream()); Byte[] buffer = new byte[2048]; int count = reader.Read(buffer, 0, 2048); while (count > 0) { totalSize += count; Response.OutputStream.Write(buffer, 0, count); count = reader.Read(buffer, 0, 2048); } Response.ContentType = "application/pdf"; Response.Cache.SetCacheability(HttpCacheability.Private); Response.CacheControl = "private"; Response.Expires = 30; Response.AddHeader("Content-Disposition", "attachment; filename=thisStoopidReport.pdf"); Response.AddHeader("Content-Length", totalSize.ToString()); reader.Close(); Response.Flush(); Response.End();

    Read the article

  • AccessControlException: access denied - caller function failed to load properties file

    - by Michael Mao
    Hi all: I am having a jar archive environment which is gonna call my class in a folder like this: java -jar "emarket.jar" ../tournament 100 My compiled class is deployed into the ../tournament folder, this command runs well. After I changed my code to load a properties file, it gets the following exception message: Exception in thread "main" java.security.AccessControlException: access denied (java.io.FilePermission agent.properties read) at java.security.AccessControlContext.checkPermission(Unknown Source) at java.security.AccessController.checkPermission(Unknown Source) at java.lang.SecurityManager.checkPermission(Unknown Source) at java.lang.SecurityManager.checkRead(Unknown Source) at java.io.FileInputStream.<init>(Unknown Source) at java.io.FileInputStream.<init>(Unknown Source) at Agent10479475.getPropertiesFromConfigFile(Agent10479475.java:110) at Agent10479475.<init>(Agent10479475.java:100) at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(Unknown Source) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(Unknown Source) at java.lang.reflect.Constructor.newInstance(Unknown Source) at java.lang.Class.newInstance0(Unknown Source) at java.lang.Class.newInstance(Unknown Source) at emarket.client.EmarketSandbox.instantiateClientObjects(EmarketSandbox.java:92) at emarket.client.EmarketSandbox.<init>(EmarketSandbox.java:27) at emarket.client.EmarketSandbox.main(EmarketSandbox.java:166) I am wondering why this security checking will fail. I issue the getPropertitiesFromConfigFile() function inside my class's default constructor, like this: public class Agent10479475 extends AbstractClientAgent { //default constructor public Agent10479475() { //set all properties to their default values in constructor FT_THRESHOLD = 400; FT_THRESHOLD_MARGIN = 50; printOut("Now loading properties from a config file...", ""); getPropertiesFromConfigFile(); printOut("Finished loading",""); } private void getPropertiesFromConfigFile() { Properties props = new Properties(); try { props.load(new FileInputStream("agent.properties")); FT_THRESHOLD = Long.parseLong(props.getProperty("FT_THRESHOLD")); FT_THRESHOLD_MARGIN = Long.parseLong(props.getProperty("FT_THRESHOLD_MARGIN ")); } catch(java.io.FileNotFoundException fnfex) { printOut("CANNOT FIND PROPERTIES FILE :", fnfex); } catch(java.io.IOException ioex) { printOut("IOEXCEPTION OCCURED :", ioex); } } } My class is loading its own .properties file under the same folder. why would the Java environment complains about such a denial of access? Must I config the emarket.client.EmarketSandbox class, which is not written by me and stored inside the emarket.jar, to access my agent.properties file? Any hints or suggestions is much appreciated. Many thanks in advance.

    Read the article

  • Joomla - Force File Download / CSV Export

    - by lautaro.dragan
    I'm in need of help... this is my first time asking a question in SO, so please be kind :) I'm trying to force-download a file from php, so when the user hits a certain button, he gets a file download. The file is a csv (email, username) of all registered users. I decided to add this button to the admin users screen, as you can see in this screenshot. So I added the following code to the addToolbar function in administrator/components/com_users/views/users/view.html.php: JToolBarHelper::custom('users.export', 'export.png', 'export_f2.png', 'Exportar', false); This button is mapped to the following function in the com_users\controller\users.php controller: public function exportAllUsers() { ob_end_clean(); $app = JFactory::getApplication(); header("Content-type: text/csv"); header("Content-Disposition: attachment; filename=ideary_users.csv"); header("Pragma: no-cache"); header("Expires: 0"); echo "email,name\n"; $model = $this->getModel("Users"); $users = $model->getAllUsers(); foreach ($users as $user) { echo $user->email . ", " . ucwords(trim($user->name)) . "\r\n"; } $app->close(); } Now, this is actually working perfectly fine. The issue here is that after I download a file, if I hit any button in the admin that causes a POST, instead of it performing the action it should, it just downloads the file over again! For example: I hit the "Export" button "users.csv" downloads Then, I hit the "search" button "users.csv" downloads... what the hell? I'm guessing that when I hit the export button, a JS gets called and sets a form's action attribute to an URL... and expects a response or something, and then other button's are prevented from re-setting the form's action attribute. I can't think of any real solution for this, but I'd rather avoid hacks if possible. So, what would be the standard, elegant solution that joomla offers in this case?

    Read the article

  • PHP uploads file - enctype="multipart/form-data" issue

    - by user147685
    Hi all, I have this upload code. there are no problem running it individually, but when i try to add into my other codes, it did not get the $_files parameter. Im guessing it was becoz of enctype="multipart/form-data" in the form tag, based on this post: http://stackoverflow.com/questions/1695246/why-file-upload-didnt-work-without-enctype the enctype is needed. SO my problem is, how can i do upload files without concern to this? can we juz change the code structure so that it will be compatible with other codes? if($_POST['check']){ $faillampiran=$_POST['faillampiran']; $file=$_FILES['faillampiran']["name"]; $fileSize = $_FILES['faillampiran']['size']; $fileType = $_FILES['faillampiran']['type']; if ($_FILES["faillampiran"]["error"] > 0 ) { echo "Return Code: " . $_FILES["faillampiran"]["error"] . "<br />"; } else { move_uploaded_file($_FILES["faillampiran"]["tmp_name"],"upload/" . $_FILES["faillampiran"]["name"]); echo '<table align = "center">'; echo "<tr><td>"; echo "Your file has been successfully stored."; echo "</td></tr>"; echo '</table>'; } } ?> <form method="post" name="form1" id="form1" enctype="multipart/form-data"> <tr><td></td><td><input type="hidden" name="MAX_FILE_SIZE" value=""> </td> </tr> <tr><td> Please choose a file</td><td>:</td></tr> <tr> <input type="file" size="50" name="faillampiran" alt="faillampiran" id="faillampiran" 1value= "<?=$faillampiran;?>" /> <tr align = "center"><td colspan = "3"><input type="submit" value="Hantar" name="check"/></td></tr> </tr></form> thank you.

    Read the article

  • How can I limit the cache used by copying so there is still memory available for other cache?

    - by Peter
    Basic situation: I am copying some NTFS disks in openSuSE. Each one is 2TB. When I do this, the system runs slow. My guesses: I believe it is likely due to caching. Linux decides to discard useful cache (eg. kde4 bloat, virtual machine disks, LibreOffice binaries, Thunderbird binaries, etc.) and instead fill all available memory (24 GB total) with stuff from the copying disks, which will be read only once, then written and never used again. So then any time I use these apps (or kde4), the disk needs to be read again, and reading the bloat off the disk again makes things freeze/hiccup. Due to the cache being gone and the fact that these bloated applications need lots of cache, this makes the system horribly slow. Since it is USB,the disk and disk controller are not the bottleneck, so using ionice does not make it faster. I believe it is the cache rather than just the motherboard going too slow, because if I stop everything copying, it still runs choppy for a while until it recaches everything. And if I restart the copying, it takes a minute before it is choppy again. But also, I can limit it to around 40 MB/s, and it runs faster again (not because it has the right things cached, but because the motherboard busses have lots of extra bandwidth for the system disks). I can fully accept a performance loss from my motherboard's IO capability being completely consumed (which is 100% used, meaning 0% wasted power which makes me happy), but I can't accept that this caching mechanism performs so terribly in this specific use case. # free total used free shared buffers cached Mem: 24731556 24531876 199680 0 8834056 12998916 -/+ buffers/cache: 2698904 22032652 Swap: 4194300 24764 4169536 I also tried the same thing on Ubuntu, which causes a total system hang instead. ;) And to clarify, I am not asking how to leave memory free for the "system", but for "cache". I know that cache memory is automatically given back to the system when needed, but my problem is that it is not reserved for caching of specific things. Question: Is there some way to tell these copy operations to limit memory usage so some important things remain cached, and therefore any slowdowns are a result of normal disk usage and not rereading the same commonly used files? For example, is there a setting of max memory per process/user/file system allowed to be used as cache/buffers?

    Read the article

  • How to play small sound file continuously in Silverlight?

    - by ash
    Hello, I have two questions regarding Silverlight's SoundPlay action and properties. My scenario is like: I have two story board: The first story board has an image and a sound file; when the silverlight application gets loaded, the sound starts to play automatically, but if someone clicks the image, the sound file will stop and the second storyboard will start with a new sound file. 1) My first question is how to stop the first sound file of first story board when the second story board starts with the second sound file. 2) My second question is how to play a sound file continuously; for example, in Silverlight we can play a story board continuously with RepeatBehavior="Forever"; but I cannot find a way to play my 10 second sound file forever or continuously. Note: I have attached a small XAML file to show what I am talking about; I am also stating that if instead of an image file, if there were a button, then I can stop the first music file after I click the button and start my second story board with a new sound file, but I would like to use image file instead of a button. Is it possible? If it is, how to do it? Therefore, please answer my following two questions or give big hint or website tutorial links on 1) How to stop the first sound file of first story board when the second story board starts with the second sound file ( When the clickable element is an image instead of a button) 2) How to play a 10 second sound file continuously? ............Code Snippet...................... XAML ............ <Grid x:Name="LayoutRoot" Background="Red"> <Button HorizontalAlignment="Left" Margin="212,0,0,111" VerticalAlignment="Bottom" Width="75" Content="Button" Click="onClick"/> <MediaElement x:Name="sound2_mp3" Height="0" HorizontalAlignment="Left" Margin="105,230,0,0" VerticalAlignment="Top" Width="0" Source="/sound2.mp3" Stretch="Fill"/> <MediaElement x:Name="sound1_mp1" Height="0" HorizontalAlignment="Left" Margin="190,164,0,0" VerticalAlignment="Top" Width="0" Source="/sound1.mp3" Stretch="Fill" AutoPlay="False"/> </Grid> ..................................................................................................................................................................................................................... using System; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Ink; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; namespace testPrj { public partial class MainPage : UserControl { public MainPage() { // Required to initialize variables InitializeComponent(); } private void onClick(object sender, System.Windows.RoutedEventArgs e) { Storyboard1.Stop(); sound2_mp3.Stop(); sound1_mp1.Play(); } } } ...................................................................................................

    Read the article

  • Binary file reading problem

    - by ScReYm0
    Ok i have problem with my code for reading binary file... First i will show you my writing code: void book_saving(char *file_name, struct BOOK *current) { FILE *out; BOOK buf; out = fopen(file_name, "wb"); if(out != NULL) { printf_s("Writting to file..."); do { if(current != NULL) { strcpy(buf.catalog_number, current->catalog_number); strcpy(buf.author, current->author); buf.price = current->price; strcpy(buf.publisher, current->publisher); strcpy(buf.title, current->title); buf.price = current->year_published; fwrite(&buf, sizeof(BOOK), 1, out); } current = current->next; }while(current != NULL); printf_s("Done!\n"); fclose(out); } } and here is my "version" for reading it back: int book_open(struct BOOK *current, char *file_name) { FILE *in; BOOK buf; BOOK *vnext; int count; int i; in = fopen("west", "rb"); printf_s("Reading database from %s...", file_name); if(!in) { printf_s("\nERROR!"); return 1; } i = fread(&buf,sizeof(BOOK), 1, in); while(!feof(in)) { if(current != NULL) { current = malloc(sizeof(BOOK)); current->next = NULL; } strcpy(current->catalog_number, buf.catalog_number); strcpy(current->title, buf.title); strcpy(current->publisher, buf.publisher); current->price = buf.price; current->year_published = buf.year_published; fread(&buf, 1, sizeof(BOOK), in); while(current->next != NULL) current = current->next; fclose(in); } printf_s("Done!"); return 0; } I just need to save my linked list in binary file and to be able to read it back ... please help me. The program just don't read it or its crash every time different situation ...

    Read the article

  • How do I make the directories in a zip file relative to the target directory instead of my working directory

    - by Nathan
    I'm calling the zip command from a script where I cannot change directory. I need to make a zip file of the stuff in data/kit123/ from the directory which data resides in, but I want the contents of the zip to only be the contents of kit123, with paths relative to kit123. This is the directory structure myworkingdir data kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 ... kit124 ... My script runs in myworkingdir and cannot change directories. If I call zip -r kit123.zip data/kit123 then the structure in the zip file will be data kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 but I want it to be kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 Is there a zip option I can use to accomplish this? It seems odd that it should depend on my working directory I know it's not -j. that one destroys the structure within kit123

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • How to change icons of specific file types on Ubuntu 11.10?

    - by Curious Apprentice
    I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

    Read the article

  • Will the app file be sync from dmgr side after we remove it from installedApps path in Websphere?

    - by wing2ofsky
    do you know whether the app file will be sync from dmgr side and regenerated after we remove it from installedApps path? i've got one issue recently from customer. That is, they uploaded one image file into WASNode installedApps app path manually. Afterwards, they removed that file manually again from installedApps app path. But after restarting the Application server process, that file has been regenerated under same installedApps path. So i suspect that file maybe has been resync from dmgr node, like app file under applications folder. However, first of all, i don't see that image file within application ear file from DMGR applications folder. Moreover, i made a test myself, if i deleted file from installedApps app path, that file never be regenerated any more even though the node sync completed. So does anybody know why? Thanks in advance

    Read the article

  • Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

    - by JM4
    My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

    Read the article

  • Is there a way to recover a file that I have deleted but is still open somewhere?

    - by George Edison
    This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Save file in a different location in iPhone App

    - by zp26
    Hi, I have a problem. My proget create a xml file. In the iPhone this file was store in the NSDocumentDirectory. I wanna save this file in another directory like Desktop(where there are the apps) or another visible folder. Thanks. This is my code: -(void)saveInXML:(NSString*)name:(float)x:(float)y:(float)z{ //NSDocumentDirectory put the file in the app directory NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectoryPath = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectoryPath stringByAppendingPathComponent:@"filePosizioni.xml"]; NSFileHandle *myHandle; NSFileManager *fileManager = [NSFileManager defaultManager]; NSString *titoloXML = [NSString stringWithFormat:@"File Xml delle posizioni del iPhone"]; NSString *inizioTag = [NSString stringWithFormat:@"\n\n\n<posizione>"]; NSString *tagName = [NSString stringWithFormat:@"\n <name>%@</name>", name]; NSString *tagX = [NSString stringWithFormat:@"\n <x>%f</x>", x]; NSString *tagY = [NSString stringWithFormat:@"\n <y>%f</y>", y]; NSString *tagZ = [NSString stringWithFormat:@"\n <z>%f</z>", z]; NSString *fineTag= [NSString stringWithFormat:@"\n</posizione>"]; NSData* dataTitoloXML = [titoloXML dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataInizioTag = [inizioTag dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataName = [tagName dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataX = [tagX dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataY = [tagY dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataZ = [tagZ dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataFineTag = [fineTag dataUsingEncoding: NSASCIIStringEncoding]; if(![fileManager fileExistsAtPath:filePath]) [fileManager createFileAtPath:filePath contents:dataTitoloXML attributes:nil]; myHandle = [NSFileHandle fileHandleForUpdatingAtPath:filePath]; [myHandle seekToEndOfFile]; [myHandle writeData:dataInizioTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataName]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataX]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataY]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataZ]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataFineTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; NSLog(@"zp26 %@",filePath); }

    Read the article

  • could not save the file /usr/... permission denied (13.04)

    - by plaguedoctor
    I am running Ubuntu 13.04 and am trying to create an .sh file for conky in /usr/bin using gedit. When trying to save I get the error dialogue: Could not save the file /usr/bin/conky-start.sh You do not have the permissions necessary to save the file. Please check that you typed the location correctly and try again." From searching, I think I have to run a command in terminal to allow permission, but I couldn't find out what that is. Edit: I'm trying to create the file conky-start.sh, not change or run it. Thus far, I've opened gedit, copied and pasted some required info from the net, and I'm trying to save-as /usr/bin/conky-start.sh Perhaps I need to create the file first in terminal, then edit it? How would I do that?

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • Rails 3: How do I call a javascript function from a js.erb file

    - by user321775
    Now that I've upgraded to Rails 3, I'm trying to figure out the proper way to separate and reuse pieces of javascript. Here's the scenario I'm dealing with: I have a page with two areas: one with elements that should be draggable, the other with droppables. When the page loads I use jQuery to setup the draggables and droppables. Currently I have the script in the head portion of application.html.erb, which I'm sure is not the right solution but at least works. When I press a button on the page, an ajax call is made to my controller that replaces the draggables with a new set of elements that should also be draggable. I have a js.erb file that renders a partial in the correct location. After rendering I need to make the new elements draggable, so I'd like to reuse the code that currently lives in application.html.erb, but I haven't found the right way to do it. I can only make the new elements draggable by pasting the code directly into my js.erb file (yuck). What I'd like to have: - a javascript file that contains the functions prepdraggables() and prepdroppables() - a way to call either function from application.html.erb or from a js.erb file I've tried using :content_for to store and reuse the code, but can't seem to get it working correctly. What I currently have in the head section of application.html.erb <% content_for :drag_drop_prep do %> <script type="text/javascript" charset="utf-8"> $(document).ready(function () { // declare all DOM elements with class draggable to be draggable $( ".draggable" ).draggable( { revert : 'invalid' }); // declare all DOM elements with class legal to be droppable $(".legal").droppable({ hoverClass : 'legal_hover', drop : function(event, ui) { var c = new Object(); c['die'] = ui.draggable.attr("id"); c['cell'] = $(this).attr("id"); c['authenticity_token'] = encodeURIComponent(window._token); $.ajax({ type: "POST", url: "/placeDie", data: c, timeout: 5000 }); }}); }); </script> <% end %> undo.js.erb $("#board").html("<%= escape_javascript(render :partial => 'shared/board', :locals => { :playable => true, :restartable => !session[:challenge]}) %>") // This is where I want to prepare draggables. <%= javascript_include_tag "customdragdrop.js" %> // assuming this file had the draggables code from above in a prepdraggables() function prepdraggables();

    Read the article

< Previous Page | 286 287 288 289 290 291 292 293 294 295 296 297  | Next Page >