Search Results

Search found 8649 results on 346 pages for '15 puzzle'.

Page 296/346 | < Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >

  • How to fix the position of the button in applet

    - by user1609804
    I'm trying to make an applet that has a buttons in the right, where each button is corresponding to a certain pokemon. I already did it, but the buttons isn't fixed.they keep following the mouse. please help. This is my code: import javax.swing.*; import java.awt.image.BufferedImage; import java.io.*; import javax.imageio.ImageIO; import java.applet.*; import java.awt.event.*; import java.awt.*; public class choosePokemon extends Applet implements ActionListener { private int countPokemon; private int[] storePokemon; private int x,y; //this will be the x and y coordinate of the button BufferedImage Picture; public int getCountPokemon(){ //for other class that needs how many pokemon return countPokemon; } public int[] getStoredPokemon(){ //for other class that needs the pokemon return storePokemon; } public void init(){ x=0;y=0; try{ Picture = ImageIO.read(new File("pokeball.png")); } catch( IOException ex ){ } } public void paint( Graphics g ){ pokemon display = new pokemon(); // to access the pokemon attributes in class pokemon ButtonGroup group = new ButtonGroup(); //create a button group for( int a=0;a<16;a++ ){ // for loop in displaying the buttons of every pokemon(one pokemon, one button) display.choose( a ); //calls the method choose in which accepts an integer from 0-15 and saves the attributes of the pokemon corresponding to the integer JButton pokemonButton = new JButton( display.getName() ); // creates the button pokemonButton.setActionCommand( display.getName() ); // isasave sa actioncommand yung name ng kung ano mang pokemon pokemonButton.addActionListener(this); //isasama yung bagong gawang button sa listener para malaman kung na-click yung button pokemonButton.setBounds( x,y,50,23 ); group.add( pokemonButton ); //eto naman yung mag-aadd sa bagong gawang button sa isang group na puro buttons(button ng mga pokemon) y+=23; if( a==7 ){ x+=50; y=0; } add( pokemonButton ); //will add the button to the applet } g.drawImage( Picture, 120, 20, null ); } public void actionPerformed(ActionEvent e) { try{ //displays the picture of the selected pokemon Picture = ImageIO.read(new File( "pokemon/" + e.getActionCommand() + ".png" )); } catch( IOException ex ){ } } public boolean chosen( int PChoice ){ //this will check if the chosen pokemon is already the player's pokemon boolean flag = false; for( int x=0; x<countPokemon && !flag ;x++ ){ if( storePokemon[x]==PChoice ){ flag = true; } } return flag; }

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • Specifying a Single Request To Use Credentials with HttpClient

    - by jiduvah
    I am using OAuth2 on my android project. The idea is to use a singleton HttpClient used with a ThreadSafeClientConnManager. For a normal request to the server we construct an Authorization header and send that. The header is constructed from values received from the server. This works fine. However every 15 minutes we must get new values from the server to construct the header. To Received these values I must set the credentials like so. client.getCredentialsProvider().setCredentials( new AuthScope(AuthScope.ANY_HOST, AuthScope.ANY_PORT), new UsernamePasswordCredentials(creds.clientId, creds.clientSecret)); In order for this to work I must set up and new DefaultHttpClient. If I use the original singleton httpclient I receive some errors. My question is.. is it possible to set the credentials to be used only on this one request? I noticed that there is an AuthScope. The host and port would not be suitable for this but maybe the realm would? I can't find anything that tells me what a realm is or how to use it. 06-05 10:12:55.969: W/System.err(23843): org.apache.http.NoHttpResponseException: The target server failed to respond 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.DefaultResponseParser.parseHead(DefaultResponseParser.java:85) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.io.AbstractMessageParser.parse(AbstractMessageParser.java:174) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.AbstractHttpClientConnection.receiveResponseHeader(AbstractHttpClientConnection.java:179) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.DefaultClientConnection.receiveResponseHeader(DefaultClientConnection.java:235) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.AbstractClientConnAdapter.receiveResponseHeader(AbstractClientConnAdapter.java:259) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.protocol.HttpRequestExecutor.doReceiveResponse(HttpRequestExecutor.java:279) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.protocol.HttpRequestExecutor.execute(HttpRequestExecutor.java:121) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.DefaultRequestDirector.execute(DefaultRequestDirector.java:504) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:555) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:487) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:465) So After more testing I have found where the problem lies. I want to configure a pooled connection manager like so SchemeRegistry schemeRegistry = new SchemeRegistry(); schemeRegistry.register( new Scheme("http", PlainSocketFactory.getSocketFactory(), 80)); schemeRegistry.register( new Scheme("https", PlainSocketFactory.getSocketFactory(), 443)); ClientConnectionManager conManager = new ThreadSafeClientConnManager(new BasicHttpParams(), schemeRegistry); DefaultHttpClient httpClient = new DefaultHttpClient(); But when configure like this, I get the error above. If I use the normal default httpclient like so DefaultHttpClient httpClient = new DefaultHttpClient(); Then it works fine. Any ideas?

    Read the article

  • Multiple task in one page?(php - mysql - jquery)

    - by python
    My goal is to build an application in a page that can be use multiple task(crud) for example in this html code.there are multiple submit,multiple action in the same page after (user submit (CURD) it will load result table below.) In juery how Can I do this.? <script type="text/javascript" src="jquery.js"></script> <script> $(document).ready(function(){ $("#button1").click(function(){ $('form#crudform').attr({action: "script_1.php"}); $('form#crudform').submit(); }); $("#button2").click(function(){ $('form#crudform').attr({action: "script_2.php"}); $('form#crudform').submit(); }); $("#button3").click(function(){ $('form#crudform').attr({action: "script_3.php"}); $('form#crudform').submit(); }); }); </script> Form CRUD: <form id="crudform" method="post"> <p>Name: <input type="text" name="name"/></p> <p>Age: <input type="text" name="age"/></p> <input type="button" id="button1" value="Cancel" /> <input type="button" id="button2" value="Save" /> <input type="button" id="button3" value="Update" /> </form> Result: <form id="result" method="post"> <table border="1"> <tr> <tr><td></td><td>Name</td><td>Age</td> </tr> <tr><td><input type="checkbox" name="name1"></td><td>Name1</td><td>10</td><tr> <tr><td><input type="checkbox" name="name1"></td><td>Name2</td><td>15</td></tr> <tr><td><input type="checkbox" name="name3"></td><td>Name3</td><td>16</td></tr> </table> <input type="button" id="button4" value="change" /> <input type="button" id="button5" value="drop" /> </form> Anybody know the tutorials relating ..with my tasks.or tips,guide.....are welconme :)

    Read the article

  • Way to store a large dictionary with low memory footprint + fast lookups (on Android)

    - by BobbyJim
    I'm developing an android word game app that needs a large (~250,000 word dictionary) available. I need: reasonably fast look ups e.g. constant time preferable, need to do maybe 200 lookups a second on occasion to solve a word puzzle and maybe 20 lookups within 0.2 second more often to check words the user just spelled. EDIT: Lookups are typically asking "Is in the dictionary?". I'd like to support up to two wildcards in the word as well, but this is easy enough by just generating all possible letters the wildcards could have been and checking the generated words (i.e. 26 * 26 lookups for a word with two wildcards). as it's a mobile app, using as little memory as possible and requiring only a small initial download for the dictionary data is top priority. My first naive attempts used Java's HashMap class, which caused an out of memory exception. I've looked into using the SQL lite databases available on android, but this seems like overkill. What's a good way to do what I need?

    Read the article

  • Catching error caused by InitialContext.lookup

    - by Martin Schröder
    I'm developing a command line client (Java SE6) that now needs to talk to a Glassfish 2.1 server. The code for setting up this connection is try { final InitialContext context = new InitialContext(); final String ejbName = GeneratorCancelledRemote.class.getName(); generatorCancelled = (GeneratorCancelledRemote) context.lookup(ejbName); } catch (Throwable t) { System.err.println("--> Could not call server:"); t.printStackTrace(System.err); runWithOutEJB = true; } I'm now testing it without a running server and the client (when run from Eclipse 4.2) just bombs with 31.10.2012 10:40:09 com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl WARNUNG: "IOP00410201: (COMM_FAILURE) Connection failure: socketType: IIOP_CLEAR_TEXT; hostname: localhost; port: 3700" org.omg.CORBA.COMM_FAILURE: vmcid: SUN minor code: 201 completed: No at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2783) at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2804) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:261) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:274) at com.sun.corba.ee.impl.transport.SocketOrChannelContactInfoImpl.createConnection(SocketOrChannelContactInfoImpl.java:130) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.beginRequest(CorbaClientRequestDispatcherImpl.java:192) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.request(CorbaClientDelegateImpl.java:184) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.is_a(CorbaClientDelegateImpl.java:328) at org.omg.CORBA.portable.ObjectImpl._is_a(ObjectImpl.java:112) at org.omg.CosNaming.NamingContextHelper.narrow(NamingContextHelper.java:69) at com.sun.enterprise.naming.SerialContext.narrowProvider(SerialContext.java:134) at com.sun.enterprise.naming.SerialContext.getCachedProvider(SerialContext.java:259) at com.sun.enterprise.naming.SerialContext.getRemoteProvider(SerialContext.java:204) at com.sun.enterprise.naming.SerialContext.getProvider(SerialContext.java:159) at com.sun.enterprise.naming.SerialContext.lookup(SerialContext.java:409) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.werkii.latex.generator.Generator.main(Generator.java:344) Caused by: java.lang.RuntimeException: java.net.ConnectException: Connection refused: connect at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:347) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:244) ... 14 more Caused by: java.net.ConnectException: Connection refused: connect at sun.nio.ch.Net.connect(Native Method) at sun.nio.ch.SocketChannelImpl.connect(SocketChannelImpl.java:532) at com.sun.corba.ee.impl.orbutil.ORBUtility.openSocketChannel(ORBUtility.java:105) at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:332) ... 15 more It's o.k. for now (while I'm still in development) that it bombs, but it does this repeatedly and the catch clause is never reached (even though I'm catching Throwable) - the message is not printed. So how can I handle connection errors during lookup in my program?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • extra white line under li items that have no border

    - by isabel018
    I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

    Read the article

  • App losing db connection

    - by DaveKub
    I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

    Read the article

  • Trouble using South with Django and Heroku

    - by Dan
    I had an existing Django project that I've just added South to. I ran syncdb locally. I ran manage.py schemamigration app_name locally I ran manage.py migrate app_name --fake locally I commit and pushed to heroku master I ran syncdb on heroku I ran manage.py schemamigration app_name on heroku I ran manage.py migrate app_name on heroku I then receive this: $ heroku run python notecard/manage.py migrate notecards Running python notecard/manage.py migrate notecards attached to terminal... up, run.1 Running migrations for notecards: - Migrating forwards to 0005_initial. > notecards:0003_initial Traceback (most recent call last): File "notecard/manage.py", line 14, in <module> execute_manager(settings) File "/app/lib/python2.7/site-packages/django/core/management/__init__.py", line 438, in execute_manager utility.execute() File "/app/lib/python2.7/site-packages/django/core/management/__init__.py", line 379, in execute self.fetch_command(subcommand).run_from_argv(self.argv) File "/app/lib/python2.7/site-packages/django/core/management/base.py", line 191, in run_from_argv self.execute(*args, **options.__dict__) File "/app/lib/python2.7/site-packages/django/core/management/base.py", line 220, in execute output = self.handle(*args, **options) File "/app/lib/python2.7/site-packages/south/management/commands/migrate.py", line 105, in handle ignore_ghosts = ignore_ghosts, File "/app/lib/python2.7/site-packages/south/migration/__init__.py", line 191, in migrate_app success = migrator.migrate_many(target, workplan, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 221, in migrate_many result = migrator.__class__.migrate_many(migrator, target, migrations, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 292, in migrate_many result = self.migrate(migration, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 125, in migrate result = self.run(migration) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 99, in run return self.run_migration(migration) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 81, in run_migration migration_function() File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 57, in <lambda> return (lambda: direction(orm)) File "/app/notecard/notecards/migrations/0003_initial.py", line 15, in forwards ('user', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['auth.User'])), File "/app/lib/python2.7/site-packages/south/db/generic.py", line 226, in create_table ', '.join([col for col in columns if col]), File "/app/lib/python2.7/site-packages/south/db/generic.py", line 150, in execute cursor.execute(sql, params) File "/app/lib/python2.7/site-packages/django/db/backends/util.py", line 34, in execute return self.cursor.execute(sql, params) File "/app/lib/python2.7/site-packages/django/db/backends/postgresql_psycopg2/base.py", line 44, in execute return self.cursor.execute(query, args) django.db.utils.DatabaseError: relation "notecards_semester" already exists I have 3 models. Section, Semester, and Notecards. I've added one field to the Notecards model and I cannot get it added on Heroku. Thank you.

    Read the article

  • complex URL remapping with friendly_id

    - by DerNalia
    I have the URL http://acme.example.com/view/view_container_content/15?javascript_disabled=true&container=aoeu but I want it to look like http://acme.example.com/view/container_name/content_name/ with friendly_id, I've seen how to do URL mapping with one object... but I haven't seen an example with two... ideas?

    Read the article

  • iPhone: how to keep integer value on UILabel

    - by Nandakishore
    i am working on Twitter on iPhone now i have to keep the count of Friend, Tweets, Followers etc on UILabel how to work with this (void)userInfoReceived:(NSArray *)userInfo forRequest:(NSString *)connectionIdentifier { NSLog(@"User Info Received: %@", userInfo); // userInfo contains all user details like userName, screenName, count of Friends, Followers, Following, Status Count etc NSLog(@"User Info Received: %d", [userInfo count]); NSMutableDictionary *profileData = [userInfo objectAtIndex:0]; //converting userInfo array into profileData dictionary lblUserName.text = [profileData objectForKey:@"name"]; // lblUserName is UILabel, userName keeping on Label lblLocation.text = [profileData objectForKey:@"location"]; // lblLocation is UILabel, Location keeping on Label lblDescription.text = [profileData objectForKey:@"description"]; // lblDescription is UILabel, Location keeping on Label /////* Up to here all working but how to Keep integer value on UILabel *///// lblFolCount = (NSNumber *)[profileData objectForKey:@"followers_count"]; //how to keep user Followers Count on UILable lblFavCount = (NSNumber *)[profileData objectForKey:@"favourites_count"]; //how to keep user Followers Count on UILable lblStatusCount = (NSNumber *) [profileData objectForKey:@"statuses_count"]; //how to keep user statuses count on UILable lblFriends = (NSNumber *) [profileData objectForKey:@"friends_count"]; //how to keep user friends count on UILable } ////**This info Display on debugger console*/////// ////NSLog(@"User Info Received: %@", userInfo); // by this we get info on debugger console User Info Received: ( { "created_at" = "Tue Nov 02 14:42:42 +0000 2010"; description = "being honest"; favorited = false; "favourites_count" = 0; "followers_count" = 5; "friends_count" = 21; "listed_count" = 0; location = Chennai; name = "nanda kishore reddyv"; "profile_background_color" = EDECE9; "profile_background_image_url" = "http://a2.twimg.com/a/1292975674/images/themes/theme3/bg.gif"; "profile_background_tile" = false; "profile_image_url" = "http://a2.twimg.com/a/1292975674/images/default_profile_6_normal.png"; "retweet_count" = 0; "screen_name" = velugotinanda; source = "<a href=\"http://www.icodeblog.com\" rel=\"nofollow\">iCodeBlog Oauth Demo</a>"; status = "Mon Dec 27 09:22:44 +0000 2010"; "statuses_count" = 15; "time_zone" = "Indiana (East)"; verified = false; } ) 2011-01-01 10:38:29.460 IdeaTweet[471:207] User Info Received: 1 Thanks YOU can you tell me how to Keep integer Value on UILabel

    Read the article

  • BizTalk - generating schema from Oracle stored proc with table variable argument

    - by Ron Savage
    I'm trying to set up a simple example project in BizTalk that gets changes made to a table in a SQL Server db and updates a copy of that table in an Oracle db. On the SQL Server side, I have a stored proc named GetItemChanges() that returns a variable number of records. On the Oracle side, I have a stored proc named Update_Item_Region_Table() designed to take a table of records as a parameter so that it can process all the records returned from GetItemChanges() in one call. It is defined like this: create or replace type itemrec is OBJECT ( UPC VARCHAR2(15), REGION VARCHAR2(5), LONG_DESCRIPTION VARCHAR2(50), POS_DESCRIPTION VARCHAR2(30), POS_DEPT VARCHAR2(5), ITEM_SIZE VARCHAR2(10), ITEM_UOM VARCHAR2(5), BRAND VARCHAR2(10), ITEM_STATUS VARCHAR2(5), TIME_STAMP VARCHAR2(20), COSTEDBYWEIGHT INTEGER ); create or replace type tbl_of_rec is table of itemrec; create or replace PROCEDURE Update_Item_Region_table ( Item_Data tbl_of_rec ) IS errcode integer; errmsg varchar2(4000); BEGIN for recIndex in 1 .. Item_Data.COUNT loop update FL_ITEM_REGION_TEST set Region = Item_Data(recIndex).Region, Long_description = Item_Data(recIndex).Long_description, Pos_Description = Item_Data(recIndex).Pos_description, Pos_Dept = Item_Data(recIndex).Pos_dept, Item_Size = Item_Data(recIndex).Item_Size, Item_Uom = Item_Data(recIndex).Item_Uom, Brand = Item_Data(recIndex).Brand, Item_Status = Item_Data(recIndex).Item_Status, Timestamp = to_date(Item_Data(recIndex).Time_stamp, 'yyyy-mm-dd HH24:mi:ss'), CostedByWeight = Item_Data(recIndex).CostedByWeight where UPC = Item_Data(recIndex).UPC; log_message(Item_Data(recIndex).Region, '', 'Updated item ' || Item_Data(recIndex).UPC || '.'); end loop; EXCEPTION WHEN OTHERS THEN errcode := SQLCODE(); errmsg := SQLERRM(); log_message('CE', '', 'Error in Update_Item_Region_table(): Code [' || errcode || '], Msg [' || errmsg || '] ...'); END; In my BizTalk project I generate the schemas and binding information for both stored procedures. For the Oracle procedure, I specified a path for the GeneratedUserTypesAssemblyFilePath parameter to generate a DLL to contain the definition of the data types. In the Send Port on the server, I put the path to that Types DLL in the UserAssembliesLoadPath parameter. I created a map to translate the GetItemChanges() schema to the Update_Item_Region_Table() schema. When I run it the data is extracted and transformed fine but causes an exception trying to pass the data to the Oracle proc: *The adapter failed to transmit message going to send port "WcfSendPort_OracleDBBinding_HOST_DATA_Procedure_Custom" with URL "oracledb://dvotst/". It will be retransmitted after the retry interval specified for this Send Port. Details:"System.InvalidOperationException: Custom type mapping for 'HOST_DATA.TBL_OF_REC' is not specified or is invalid.* So it is apparently not getting the information about the custom data type TBL_OF_REC into the Types DLL. Any tips on how to make this work?

    Read the article

  • UNIX pipes on C block on read

    - by Toni Cárdenas
    I'm struggling to implement a shell with pipelines for class. typedef struct { char** cmd; int in[2]; int out[2]; } cmdio; cmdio cmds[MAX_PIPE + 1]; Commands in the pipeline are read and stored in cmds. cmdio[i].in is the pair of file descriptors of the input pipe returned by pipe(). For the first command, which reads from terminal input, it is just {fileno(stdin), -1}. cmdin[i].outis similar for the output pipe/terminal output. cmdio[i].in is the same as cmd[i-1].out. For example: $ ls -l | sort | wc CMD: ls -l IN: 0 -1 OUT: 3 4 CMD: sort IN: 3 4 OUT: 5 6 CMD: wc IN: 5 6 OUT: -1 1 We pass each command to process_command, which does a number of things: for (cmdi = 0; cmds[cmdi].cmd != NULL; cmdi++) { process_command(&cmds[cmdi]); } Now, inside process_command: if (!(pid_fork = fork())) { dup2(cmd->in[0], fileno(stdin)); dup2(cmd->out[1], fileno(stdout)); if (cmd->in[1] >= 0) { if (close(cmd->in[1])) { perror(NULL); } } if (cmd->out[0] >= 0) { if (close(cmd->out[0])) { perror(NULL); } } execvp(cmd->cmd[0], cmd->cmd); exit(-1); } The problem is that reading from the pipe blocks forever: COMMAND $ ls | wc Created pipe, in: 5 out: 6 Foreground pid: 9042, command: ls, Exited, info: 0 [blocked running read() within wc] If, instead of exchanging the process with execvp, I just do this: if (!(pid_fork = fork())) { dup2(cmd->in[0], fileno(stdin)); dup2(cmd->out[1], fileno(stdout)); if (cmd->in[1] >= 0) { if (close(cmd->in[1])) { perror(NULL); } } if (cmd->out[0] >= 0) { if (close(cmd->out[0])) { perror(NULL); } } char buf[6]; read(fileno(stdin), buf, 5); buf[5] = '\0'; printf("%s\n", buf); exit(0); } It happens to work: COMMAND $ cmd1 | cmd2 | cmd3 | cmd4 | cmd5 Pipe creada, in: 11 out: 12 Pipe creada, in: 13 out: 14 Pipe creada, in: 15 out: 16 Pipe creada, in: 17 out: 18 hola! Foreground pid: 9251, command: cmd1, Exited, info: 0 Foreground pid: 9252, command: cmd2, Exited, info: 0 Foreground pid: 9253, command: cmd3, Exited, info: 0 Foreground pid: 9254, command: cmd4, Exited, info: 0 hola! Foreground pid: 9255, command: cmd5, Exited, info: 0 What could be the problem?

    Read the article

  • Calculate total time between Dates in Hours and Minutes

    - by matthew parkes
    Hi I’m trying to resolve a problem using VB and I need some assistance. I’m very new to the language (1 week). The problem is I have created a user form to show how many hours and minutes has elapsed between two different times similar to a time sheet. The user form consists of two calendars, and under each calendar there are two text boxes; one box each to record the Hour and Minute they left and two further boxes to record the time they arrived back. I have used the code to minus the calendars together (e.g calendar in – calendar out) then times this by 24 to indicate the hours away. Then under the calendar out I have a text box for the user to type in the hour they left. Then I minus the 24 by the Hour out e.g. if it was 24 -15 it will appear 9 ( 9 hours of that day ) then I would add that to the figure they inserted in the text box Hour in (Return Time). e.g 14. Then I would add them to together e.g. 9 + 14 = 23 and have this displayed in another text box Total Hours. Therefore it would display 23 meaning 23 hours. I have then want to show another two text boxes to indicate minutes. One for Minutes Out then Minutes In. I have the problem to convert these minutes for instance if it is the out time is 15:50 and the in time the next day is at 15:55 it displays as 24 (in one text box) and 105 minutes (in the other text box). I would like the minutes added to the hour and have the balance of the remaining minutes in the minute text box. This should display 24 (in one text box) and 5 (in another text box). The ultimate aim is to get a result that shows a person was absent for a number of days, hours and minutes, eg, 2 days, 5 hours and 10 minutes. Any ideas on how I can modify my code to achieve this? Here’s my code. Please Help Dim number1 As Date Dim number2 As Date Dim number3 As Integer Dim number4 As Integer Dim Number5 As Integer Dim Number6 As Integer Dim answer As Integer Dim answer2 As Integer Dim answer3 As Integer Dim answer4 As Integer Dim answer5 As String number1 = DTPicker1 number2 = DTPicker2 number3 = Txthourout number4 = TxtHourin Number5 = TxtMinuteout Number6 = TxtMinuetIn answer = number2 - number1 answer2 = answer * 24 answer3 = answer2 - number3 answer4 = answer3 + number4 answer5 = Number5 + Number6 TextBox1.Text = answer4 TextBox2.Text = answer5 End Sub

    Read the article

  • jms unresolved message-destination-ref

    - by portoalet
    hi, I am using netbeans 6.8, and glassfish v3, and making a simple jms application to work. I got this: com.sun.enterprise.container.common.spi.util.InjectionException: Exception attempting to inject Unresolved Message-Destination-Ref jms/[email protected]@null into class enterpriseapplication4.Main Code: public class Main { @Resource(name = "jms/myQueue") private static Topic myQueue; @Resource(name = "jms/myFactory") private static ConnectionFactory myFactory; ... // the rest is just boiler plate created by netbeans } In my Glassfish v3 admin console, I have jms/myFactory as my ConnectionFactory and jms/myQueue as my Destination Resources. What am I missing? Full stack: WARNING: enterprise.deployment.backend.invalidDescriptorMappingFailure com.sun.enterprise.container.common.spi.util.InjectionException: Exception attempting to inject Unresolved Message-Destination-Ref jms/[email protected]@null into class enterpriseapplication4.Main at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl._inject(InjectionManagerImpl.java:614) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl.inject(InjectionManagerImpl.java:384) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl.injectClass(InjectionManagerImpl.java:210) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl.injectClass(InjectionManagerImpl.java:202) at org.glassfish.appclient.client.acc.AppClientContainer$ClientMainClassSetting.getClientMainClass(AppClientContainer.java:599) at org.glassfish.appclient.client.acc.AppClientContainer.getMainMethod(AppClientContainer.java:498) at org.glassfish.appclient.client.acc.AppClientContainer.completePreparation(AppClientContainer.java:397) at org.glassfish.appclient.client.acc.AppClientContainer.prepare(AppClientContainer.java:311) at org.glassfish.appclient.client.AppClientFacade.prepareACC(AppClientFacade.java:264) at org.glassfish.appclient.client.acc.agent.AppClientContainerAgent.premain(AppClientContainerAgent.java:75) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at sun.instrument.InstrumentationImpl.loadClassAndStartAgent(InstrumentationImpl.java:323) at sun.instrument.InstrumentationImpl.loadClassAndCallPremain(InstrumentationImpl.java:338) Caused by: javax.naming.NamingException: Lookup failed for 'java:comp/env/jms/myQueue' in SerialContext targetHost=localhost,targetPort=3700 [Root exception is javax.naming.NameNotFoundException: No object bound for java:comp/env/jms/myQueue [Root exception is java.lang.NullPointerException]] at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:442) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.sun.enterprise.container.common.impl.util.InjectionManagerImpl._inject(InjectionManagerImpl.java:513) ... 15 more Caused by: javax.naming.NameNotFoundException: No object bound for java:comp/env/jms/myQueue [Root exception is java.lang.NullPointerException] at com.sun.enterprise.naming.impl.JavaURLContext.lookup(JavaURLContext.java:218) at com.sun.enterprise.naming.impl.SerialContext.lookup(SerialContext.java:428) ... 17 more Caused by: java.lang.NullPointerException at javax.naming.InitialContext.getURLScheme(InitialContext.java:269) at javax.naming.InitialContext.getURLOrDefaultInitCtx(InitialContext.java:318) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.sun.enterprise.naming.util.JndiNamingObjectFactory.create(JndiNamingObjectFactory.java:75) at com.sun.enterprise.naming.impl.GlassfishNamingManagerImpl.lookup(GlassfishNamingManagerImpl.java:688) at com.sun.enterprise.naming.impl.GlassfishNamingManagerImpl.lookup(GlassfishNamingManagerImpl.java:657) at com.sun.enterprise.naming.impl.JavaURLContext.lookup(JavaURLContext.java:148) ... 18 more Regards

    Read the article

  • Adding google.maps.latlng within a loop

    - by Mick Morrison
    I am new to Java Script. I am using it, in combination with Java Server Faces. I want to add some points to define a Polilyne using GoogleMaps Apiv3. My problem is that I can't add a FOR statement to the javascript, because it dumps. If I comment this FOR loop, it also dumps. The dump I am getting is: "javax.servlet.ServletException: null source". Has anyone any suggestion to solve this? Thanks in advance, Emanuel <script type="text/javascript"> function initialize() { var longit = "${dateRange.longitude}" ; var lat = "${dateRange.latitude}" ; var latlng = new google.maps.LatLng(lat, longit); var myOptions = { zoom: 15, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; var map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var points = []; var cadena1 = "${dateRange.latArray}" ; var cadena2 = "${dateRange.longArray}" ; var latArray = cadena1.split('?'); var longArray = cadena2.split('?'); /* The code Below is the one that fails */ for (var i=0; i < latArray.length; i++) { points.push(new google.maps.LatLng(latArray[i], longArray[i])); } /* Finish of the error code */ // The Polilyne is created var mapPath = new google.maps.Polyline ({ path: points, strokeColor: "#FF0000", strokeOpacity: 1.0, strokeWeight: 4 }); mapPath.setMap(map); } </script> </head> <body onload="initialize()"> <h:graphicImage url="http://localhost:8080/gps_tracking/faces/resources/images/logo.jpg"> </h:graphicImage> <h1 align="center">Sol-Tech</h1><br /> <hr></hr> <div id="map_canvas" style="width:100%; height:100%"></div> </body>

    Read the article

  • Why I get a segmentation fault?

    - by frx08
    Why I get a segmentation fault? int main() { int height, width, step, step_mono, channels; int y, x; char str[15]; uchar *data, *data_mono; CvMemStorage* storage = cvCreateMemStorage(0); CvSeq* contour = 0; CvPoint* p; CvFont font; CvCapture *capture; IplImage *frame = 0, *mono_thres = 0; capture = cvCaptureFromAVI("source.avi"); //capture video if(!cvGrabFrame(capture)) exit(0); frame = cvRetrieveFrame(capture); //capture the first frame from video source cvNamedWindow("Result", 1); while(1){ mono_thres = cvCreateImage(cvGetSize(frame), 8, 1); height = frame -> height; width = frame -> width; step = frame -> widthStep; step_mono = mono_thres -> widthStep; channels = frame -> nChannels; data = (uchar *)frame -> imageData; data_mono = (uchar *)mono_thres -> imageData; //converts the image to a binary highlighting the lightest zone for(y=0;y < height;y++) for(x=0;x < width;x++) data_mono[y*step_mono+x*1+0] = data[y*step+x*channels+0]; cvThreshold(mono_thres, mono_thres, 230, 255, CV_THRESH_BINARY); cvFindContours(mono_thres, storage, &contour, sizeof(CvContour), CV_RETR_CCOMP, CV_CHAIN_APPROX_SIMPLE); //gets the coordinates of the contours and draws a circle and the coordinates in that point p = CV_GET_SEQ_ELEM(CvPoint, contour, 1); cvCircle(frame, *p, 1, CV_RGB(0,0,0), 2); cvInitFont(&font, CV_FONT_HERSHEY_PLAIN, 1.1, 1.1, 0, 1); sprintf(str, "(%d ,%d)", p->x, p->y); cvPutText(frame, str, cvPoint(p->x+5,p->y-5), &font, CV_RGB(0,0,0)); cvShowImage("Result", mono_thres); //next frame if(!cvGrabFrame(capture)) break; frame = cvRetrieveFrame(capture); if((cvWaitKey(10) & 255) == 27) break; } cvReleaseCapture(&capture); cvDestroyWindow("Result"); return 0; }

    Read the article

  • how to use window.onload?

    - by Patrick
    I'm refactoring a website using MVC. What was a set of huge pages with javascript, php, html etc etc is becoming a series of controllers and views. I'm trying to do it in a modular way so views are split in 'modules' that I can reuse in other pages when needed eg. "view/searchform displays only one div with the searchform "view/display_events displays a list of events and so on. One of the old pages was supposed to load a google map with a marker on it. Amongst the rest of the code, I can identify the relevant bits as follows <head> <script src="http://maps.google.com/maps?file=api&amp;v=2&amp;key=blablabla" type="text/javascript"></script> <script type="text/javascript"> //<![CDATA[ function load() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById("map")); var point = new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>); map.setCenter(new GLatLng(<?php echo ($info->lat && $info->lng) ? $info->lat .",". $info->lng : "51.502759,-0.126171"; ?>), 15); map.addControl(new GLargeMapControl()); map.addControl(new GScaleControl()); map.addOverlay(new GMarker(point)); var marker = createMarker(point,GIcon(),"CIAO"); map.addOverlay(marker); } } //]]> </script> </head> ...then <body onload="load()" onunload="GUnload()"> ...and finally this div where the map should be displayed <div id="map" style="width: 440px; height: 300px"> </div> Don't know much about js, but my understanding is that a) I have to include the scripts in the view module I'm writing (directly in the HTML? I would prefer to load a separate script) b) I have to trigger that function using the equivalent of body onload... (obviously there's no body tag in my view. In my ignorance I've tried div onload=.... but didn't seem to be working :) What do you suggest I do? I've read about window.onload but don't know what's the correct syntax for that. please keep in mind that other parts of the page include other js functions (eg, google adsense) that are called after the footer.

    Read the article

  • php foreach getting values from an array

    - by sea_1987
    I am having trouble accessing the values in an array, the array looks like this, Array ( [0] => Array ( [id] => 1661 [code] => 849651318 [job_status] => 4 [looking_for] => Lorem ipsum [keywords_education] => Derby University [sector_id_csv] => 10,21,9,22,26 [last_job_title_1] => Programmer [last_job_employer_1] => HBOS [city] => Bury [expected_salary_level] => LEVEL_2 [education_level] => COLLEGE [job_looking_for] => [is_contract] => Y [is_permanent] => N [is_temporary] => Y ) ) Array ( [0] => Array ( [id] => 402 [code] => 849650059 [job_status] => 3 [looking_for] => Lorem ipsum [keywords_education] => Paris College [sector_id_csv] => 27,22,19,21,12 [last_job_title_1] => Programmer [last_job_employer_1] => HSBC [city] => Bury [expected_salary_level] => LEVEL_2 [education_level] => COLLEGE [job_looking_for] => [is_contract] => N [is_permanent] => Y [is_temporary] => Y ) ) Array ( [0] => Array ( [id] => 1653 [code] => 849651310 [job_status] => 3 [looking_for] => Lorem ipsum [keywords_education] => Crewe University [sector_id_csv] => 27,15,19,21,24 [last_job_title_1] => Programmer [last_job_employer_1] => ICI [city] => Bury [expected_salary_level] => LEVEL_2 [education_level] => UNIVERSITY [job_looking_for] => [is_contract] => N [is_permanent] => Y [is_temporary] => Y ) ) I am trying to get the values out, I have tried doing the following, foreach ($result as $rslt) { echo $rslt->id; } I have also tried, foreach ($result as $rslt) { $rslt['id']; } But none of this works, I dont know why, can anyone help?

    Read the article

  • java : how to handle the design when template methods throw exception when overrided method not throw

    - by jiafu
    when coding. try to solve the puzzle: how to design the class/methods when InputStreamDigestComputor throw IOException? It seems we can't use this degisn structure due to the template method throw exception but overrided method not throw it. but if change the overrided method to throw it, will cause other subclass both throw it. So can any good suggestion for this case? abstract class DigestComputor{ String compute(DigestAlgorithm algorithm){ MessageDigest instance; try { instance = MessageDigest.getInstance(algorithm.toString()); updateMessageDigest(instance); return hex(instance.digest()); } catch (NoSuchAlgorithmException e) { LOG.error(e.getMessage(), e); throw new UnsupportedOperationException(e.getMessage(), e); } } abstract void updateMessageDigest(MessageDigest instance); } class ByteBufferDigestComputor extends DigestComputor{ private final ByteBuffer byteBuffer; public ByteBufferDigestComputor(ByteBuffer byteBuffer) { super(); this.byteBuffer = byteBuffer; } @Override void updateMessageDigest(MessageDigest instance) { instance.update(byteBuffer); } } class InputStreamDigestComputor extends DigestComputor{ // this place has error. due to exception. if I change the overrided method to throw it. evey caller will handle the exception. but @Override void updateMessageDigest(MessageDigest instance) { throw new IOException(); } }

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • .NET Windows Service with timer stops responding

    - by Biri
    I have a windows service written in c#. It has a timer inside, which fires some functions on a regular basis. So the skeleton of my service: public partial class ArchiveService : ServiceBase { Timer tickTack; int interval = 10; ... protected override void OnStart(string[] args) { tickTack = new Timer(1000 * interval); tickTack.Elapsed += new ElapsedEventHandler(tickTack_Elapsed); tickTack.Start(); } protected override void OnStop() { tickTack.Stop(); } private void tickTack_Elapsed(object sender, ElapsedEventArgs e) { ... } } It works for some time (like 10-15 days) then it stops. I mean the service shows as running, but it does not do anything. I make some logging and the problem can be the timer, because after the interval it does not call the tickTack_Elapsed function. I was thinking about rewrite it without a timer, using an endless loop, which stops the processing for the amount of time I set up. This is also not an elegant solution and I think it can have some side effects regarding memory. The Timer is used from the System.Timers namespace, the environment is Windows 2003. I used this approach in two different services on different servers, but both is producing this behavior (this is why I thought that it is somehow connected to my code or the framework itself). Does somebody experienced this behavior? What can be wrong? Edit: I edited both services. One got a nice try-catch everywhere and more logging. The second got a timer-recreation on a regular basis. None of them stopped since them, so if this situation remains for another week, I will close this question. Thank you for everyone so far. Edit: I close this question because nothing happened. I mean I made some changes, but those changes are not really relevant in this matter and both services are running without any problem since then. Please mark it as "Closed for not relevant anymore".

    Read the article

  • populate CoreData data model from JSON files prior to app start

    - by johannes_d
    I am creating an iPad App that displays data I got from an API in JSON format. My Core Data model has several entities(Countries, Events, Talks, ...). For each entity I have one .json file that contains all instances of the entity and its attributes as well as its relationships. I would like to populate my Core Data data model with these entities before the start of the App (otherwise it takes about 15 minutes for the iPad to create all the instances of the entities from the several JSON files using factory methods). I am currently importing the data into CoreData like this: -(void)fetchDataIntoDocument:(UIManagedDocument *)document { dispatch_queue_t dataQ = dispatch_queue_create("Data import", NULL); dispatch_async(dataQ, ^{ //Fetching data from application bundle NSURL *tedxgroupsurl = [[NSBundle mainBundle] URLForResource:@"contries" withExtension:@"json"]; NSURL *tedxeventsurl = [[NSBundle mainBundle] URLForResource:@"events" withExtension:@"json"]; //converting the JSON files to NSDictionaries NSError *error = nil; NSDictionary *countries = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:countriesurl] options:kNilOptions error:&error]; countries = [countries objectForKey:@"countries"]; NSDictionary *events = [NSJSONSerialization JSONObjectWithData:[NSData dataWithContentsOfURL:eventsurl] options:kNilOptions error:&error]; events = [events objectForKey:@"events"]; //creating entities using factory methods in NSManagedObject Subclasses (Country / Event) [document.managedObjectContext performBlock:^{ NSLog(@"creating countries"); for (NSDictionary *country in countries) { [Country countryWithCountryInfo:country inManagedObjectContext:document.managedObjectContext]; //creating Country entities } NSLog(@"creating events"); for (NSDictionary *event in events) { [Event eventWithEventInfo:event inManagedObjectContext:document.managedObjectContext]; // creating Event entities } NSLog(@"done creating, saving document"); [document saveToURL:document.fileURL forSaveOperation:UIDocumentSaveForOverwriting completionHandler:NULL]; }]; }); dispatch_release(dataQ); } This combines the different JSON files into one UIManagedDocument which i can then perform fetchRequests on to populate tableViews, mapView, etc. I'm looking for a way to create this document outside my application & add it to the mainBundle. Then I could copy it once to the apps DocumentsDirectory and be able I use it (instead of creating the Document within the app from the original JSON files). Any help is appreciated!

    Read the article

< Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >