Search Results

Search found 27698 results on 1108 pages for 'zend form element'.

Page 299/1108 | < Previous Page | 295 296 297 298 299 300 301 302 303 304 305 306  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • How can I process a form's events in another class in VB.NET?

    - by CowKingDeluxe
    Here's my code: Public Class Form1 End Class Public Class Form1Handler Inherits Form1 Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click MsgBox("I") End Sub End Class I'm trying to get Form1Handler to process Form1's events automatically. How can I do this? Should I use a module instead? I'm doing this in VB 2010.

    Read the article

  • JQuery Tabbed Nav Menu and PHP Forms Question?

    - by SlAcKeR
    I'm using a JQuery Tabbed Menu which holds different types of forms and when I select a different form located under a different tab and submit the form the tab will jump to the default tab instead of the current tab the form is located in. I was wondering how would I go about fixing this so that when the form is submitted the current tab is still selected, is it the JQuery or PHP problem? Here is the JQuery. $(document).ready(function() { //When page loads... $(".form-content").hide(); //Hide all content var firstMenu = $("#home-menu ul li:first"); firstMenu.show(); firstMenu.find("a").addClass("selected-link"); //Activate first tab $(".form-content:first").show(); //Show first tab content //On Click Event $("#home-menu ul li").click(function() { $("#home-menu ul li a").removeClass("selected-link"); //Remove any "selected-link" class $(this).find("a").addClass("selected-link"); //Add "selected-link" class to selected tab $(".form-content").hide(); //Hide all tab content var activeTab = $(this).find("a").attr("href"); //Find the href attribute value to identify the selected-link tab + content $(activeTab).fadeIn(); //Fade in the selected-link ID content return false; }); });

    Read the article

  • Submit to open up a popup window and carry through input data

    - by zac
    Hi, I have a input box on one page that on submit opens a new page with a longer form and the first field is populated with what was entered from the previous pages input box. So on page 1 there is this code: <form action="sign-up.php"> <input type="text" name="email" value="sign up for email" onFocus="clearText(this)" onBlur="clearText(this)" style="float: left;"> <input value='Submit' /> </form> Then on the sign-up page the receiving form grabs the string out of the url //<!-- Begin function getParams() { var idx = document.URL.indexOf('?'); if (idx != -1) { var tempParams = new Object(); var pairs = document.URL.substring(idx+1,document.URL.length).split('&'); for (var i=0; i<pairs.length; i++) { nameVal = pairs[i].split('='); tempParams[nameVal[0]] = nameVal[1]; } return tempParams; } } var params = getParams(); // End --> I would like to keep all of this functionality but it have it occur in a popup. I added this function to the submit: function myPopup() { window.open( "sign-up.php", "myWindow", "status = 1, height = 300, width = 300, resizable = 0" ) and the form becomes <form> <input type="text" name="email" value="sign up for email" onFocus="clearText(this)" onBlur="clearText(this)" style="float: left;"> <input onClick="myPopup()" value='Submit' /> </form> But it no longer appends the input data to the url string. Anyone have any ideas on how I can accomplish this?

    Read the article

  • How do I create a simple Windows form to access a SQL Server database?

    - by NoCatharsis
    I believe this is a very novice question, and if I'm using the wrong forum to ask, please advise. I have a basic understanding of databasing with MS SQL Server, and programming with C++ and C#. I'm trying to teach myself more by setting up my own database with MS SQL Server Express 2008 R2 and accessing it via Windows forms created in C# Express 2010. At this point, I just want to keep it to free or Express dev tools (not necessarily Microsoft though). Anyway, I created a database using the instructions provided here and I set the data types appropriately for each column (no errors in setup at least). Now I'm designing the GUI in C# Express but I've kind of hit a wall as far as the database connection. Is there a simple way to access the database I created locally using C# Express? Can anyone suggest a guide that has all this spelled out already? I am a self-learner so I look forward to teaching myself how to use these applications, but any pointers to start me off in the right direction would be greatly appreciated.

    Read the article

  • How can I implement a jquery ajax form which requests information from a web api via a php request?

    - by Jacob Schweitzer
    I'm trying to implement a simple api request to the SEOmoz linkscape api. It works if I only use the php file but I want to do an ajax request using jquery to make it faster and more user friendly. Here is the javascript code I'm trying to use: $(document).ready(function(){ $('#submit').click(function() { var url=$('#url').val(); $.ajax({ type: "POST", url: "api_sample.php", data: url, cache: false, success: function(html){ $("#results").append(html); } }); }); }); And here is the part of the php file where it takes the value: $objectURL = $_POST['url']; I've been working on it all day and can't seem to find the answer... I know the php code works as it returns a valid json object and displays correctly when I do it that way. I just can't get the ajax to show anything at all!!

    Read the article

  • Why does setting a form's enabled property crash the application?

    - by Ruirize
    private void launchbutton_Click(object sender, EventArgs e) { launchbutton.Enabled = false; Process proc = new Process(); proc.EnableRaisingEvents = true; proc.StartInfo.WindowStyle = System.Diagnostics.ProcessWindowStyle.Hidden; //The arguments/filename is set here, just removed for privacy. proc.Exited += new EventHandler(procExit); proc.Start(); } private void procExit(object sender, EventArgs e) { MessageBox.Show("YAY","WOOT"); Thread.Sleep(2000); launchbutton.Enabled = true; } 2 Seconds after I quit the created process, my program crashes. Why?

    Read the article

  • How do I get only two form fields to show instead of all 5 on initial page load? CSS

    - by marcamillion
    Here is the implementation: http://jsfiddle.net/AdQfB/2/ If you notice, when you click 'Login' or 'Register' before entering anything, you should see a few fields disappear and re-appear respectively. I would like for this page to display the view of just the two fields on the first load (rather than the current 5 it shows on first load), then when the user clicks the 'register' link, it shows the other 3 - for a total of 5. How do I do that? Thanks

    Read the article

  • Wasteful Ajax Page Loading

    - by Matt Dawdy
    I've started a new job, and the portion of the project I'm working has a very odd structure. Every pages is a .Net aspx page, and it loads just fine, but nothing is really done at load time. Everything is really loaded from a jquery document.onready handler. What is even more...interesting...is that the onready handler calls some ajax calls that drop entire .aspx pages into divs on the page, but first it strips out several parts of the the returned page. This is the "magic" script the previous programmer ran on all the returned html from his ajax calls: function CleanupResponseText(responseText, uniqueName) { responseText = responseText.replace("theForm.submit();", "SubmitSubForm(theForm, $(theForm).parent());"); responseText = responseText.replace(new RegExp("theForm", "g"), uniqueName); responseText = responseText.replace(new RegExp("doPostBack", "g"), "doPostBack" + uniqueName); return responseText; } He then intercepts any kind of form postback and runs his own form submission function: function SubmitSubForm(form, container) { //ShowLoading(container); $(form).ajaxSubmit( { url: $(form).attr("action"), success: function(responseText) { $(container).html(CleanupResponseText(responseText, form.id)); $("form", container).css("margin-top", "0").css("padding-top", "0"); //HideLoading(container); } } ); } Am I way offbase in thinking that this is less than optimal? I mean, how does a browser take out the html and head and other tags that don't have anything to do with what you are really trying to drop into that div? Also, he's returning things like asp:gridview controls, and the associate viewstate, which can be quite large if his dataset is big. Has anyone seen this before?

    Read the article

  • How can I align the left edge of HTML form elements using CSS?

    - by Naor
    I want to do the following: aa: ________ bbbb: ________ ccc: ________ So I wrote: <span>aa:</span><input type="text" /><br/> <span>bbbb:</span><input type="text" /><br/> <span>cc:</span><input type="text" /> And I get: aa:________ bbbb:________ ccc:________ I know I can arrange it easy with table. How do I do it without tables with as few css as I can. Thanks.

    Read the article

  • In ASP.NET MVC Should A Form Post To Itself Or Another Action?

    - by Sohnee
    Which of these two scenario's is best practice in ASP.NET MVC? 1 Post to self In the view you use using (Html.BeginForm) { ... } And in the controller you have [HttpGet] public ActionResult Edit(int id) [HttpPost] public ActionResult Edit(EditModel model) 2 Post from Edit to Save In the view you use using (Html.BeginForm("Save", "ControllerName")) { And in the controller you have [HttpGet] public ActionResult Edit(int id) [HttpPost] public ActionResult Save(EditModel model) Summary I can see the benefits of each of these, the former gives you a more restful style, with the same address being used in conjunction with the correct HTTP verb (GET, POST, PUT, DELETE and so on). The latter has a URL schema that makes each address very specific. Which is the correct way to do this?

    Read the article

  • send post data in jsf

    - by milostrivun
    I just cannot figure this out, it looks really simple but I'm relatively new at jsf. Here is the old stuff: Plain old html form tag like this: <form name="someForm" action="somewhere" method="post"> <input name="param1"/> <input name="param2" /> </form That is sending data by post to a location specified in the action attribute of the form. The new stuff: <h:form id="paymentForm"> <h:panelGroup> <h:inputText id="param1" value="#{facesView.param1}" ></h:inputText> <h:inputText id="param1" value="#{facesView.param2}" ></h:inputText> <h:panelGroup> <h:commandLink>Submit</h:commandLink> </h:panelGroup> </h:form> This other new stuff doesn't work. 1.How do I specify to this h:form where to go(like setting action in old html) because I need it to go to a totally new url. 2.how to pass params with POST? Any help is appreciated. Milos

    Read the article

  • Rails partial gets double escaped when using link_to_function

    - by dombesz
    Hi, I have the following code. def add_resume_link(name, form) link_to_function name do |page| html = form.fields_for :resumes, @general_resume.resumes.build, :child_index => 'NEW_RECORD' do |form_parent| render :partial => 'resume_form', :locals=>{:form=>form_parent} end page << "$('resumes').insert({ bottom: '#{escape_javascript(html)}'.replace(/NEW_RECORD/g, id) });" end end And on the resume_form i have somewhere: =add_skill_link("Add Skill", form, "resume_#{id}_skills") and the function looks like: def add_skill_link(name, form, id) link_to_function name do |page| html = form.fields_for :skill_items, @general_resume.skill_items.build, :child_index => 'NEW_RECORD' do |form_parent| render :partial=>'skill_form', :locals=>{:form=>form_parent, :parent=>id} end page << "$('#{id}').insert({ bottom: '#{escape_javascript(html)}'.replace(/NEW_RECORD/g, new Date().getTime()) });" end end So basically i have a javascript code which dinamically adds a piece of html (add_resume) and contains another javascript code which dinamically adds a select box to the page. My problem is that the add_skill_link works fine if i use from the server side, i mean rendering from server side. And gets double escaped when using within the upper described way. I tried to remove the escape_javascript from the add_skill_link bit still not good. Any ideas?

    Read the article

  • How to remove caracters like (), ' * [] form a grep results with grep, awk or sed?

    - by easyyu
    For example if I made a file with grep that give me a next result: 16 Jan 07:18:42 (name1), xx.210.49.xx), 16 Jan 07:19:14 (name2), xx.210.xx.24), 16 Jan 07:19:17 (name3), xx.140.xxx.79), 16 Jan 07:19:44 (name4), xx.210.49.xx), 16 Jan 07:19:56 (name5), xx.140.xxx.79), ,then how to sed awk or grep to remove all except date name and IP to look like this: 16 Jan 07:18:42 name1 xx.210.49.xx 16 Jan 07:19:14 name2 xx.210.xx.24 16 Jan 07:19:17 name3 xx.140.xxx.79 16 Jan 07:19:44 name4 xx.210.49.xx 16 Jan 07:19:56 name5 xx.140.xxx.79 My grep command look like this: grep 'double' $DAEMON | awk -F" " '{print $2" "$1" "$3" "$8" "$10}' > $DBLOG Thx.

    Read the article

  • Form Field: How do I change the background on blur?

    - by Liso22
    I managed to remove the background when the user clicks on the field but I cannot restore it when it blurs! This is the field: <textarea class="question-box" style="width: 240px; background: white url('http://chusmix.com/Imagenes/contawidget.png') no-repeat 50% 50%; color: grey;" cols="12" rows="5" id="question-box-' . $questionformid . '" name="title" onblur="if(this.value == '') { this.style.color='#848484'; this.value=''this.style.background=' white url('http://chusmix.com/Imagenes/contawidget.png') no-repeat 50% 50%;e';}" onfocus="if (this.value == '') {this.style.color='#444'; this.style.background='none';}" type="text" maxlength="200" size="28"></textarea> Anyone knows what I'm doing wrong?? Thanks

    Read the article

  • Running PowerShell file in C#, how to do that in an ASP.NET form?

    - by samir
    I have made a PowerShell script, which is running perfectly fine and generating a text file when I run it standalone. I wanted to automate that whenever my ASP.NET page loads I invoke a process from C# that calls my PowerShell script and executes that leading to a text file being generated. The problem is the script is being called, but not excuted. Giving some error about permissions, etc.

    Read the article

  • How to modify posted form data within controller action before sending to view?

    - by Gary
    I want to render the same view after a successful action (rather than use RedirectToAction), but I need to modify the model data that is rendered to that view. The following is a contrived example that demonstrates two methods that that do not work: [AcceptVerbs("POST")] public ActionResult EditProduct(int id, [Bind(Include="UnitPrice, ProductName")]Product product) { NORTHWNDEntities entities = new NORTHWNDEntities(); if (ModelState.IsValid) { var dbProduct = entities.ProductSet.First(p => p.ProductID == id); dbProduct.ProductName = product.ProductName; dbProduct.UnitPrice = product.UnitPrice; entities.SaveChanges(); } /* Neither of these work */ product.ProductName = "This has no effect"; ViewData["ProductName"] = "This has no effect either"; return View(product); } Does anyone know what the correct method is for accomplishing this?

    Read the article

  • What Windows Form control would be a good fit for this use case?

    - by Sergio Tapia
    I'm going create an open source Help desk solution free of charge for small to medium businesses to use. I'm currently working on the client application. I want to have a list of tickets that have been opened by the user. So it would be like a table TicketsByUser: Ticket Number | Type | Description | Date | Handled? 123456 | Hardware | My mouse broke | 10/20/2010 | No 123456 | Hardware | My mouse broke | 10/20/2010 | Yes I was thinking of using ListView because of it's name, but I have zero experience with it, so maybe it's not what I'm looking for. I'm going to be pulling the data from a WCF service which in turn pulls it from a MS SQL database.

    Read the article

  • Ajax and JSF 1.1 using hidden iframe with "proxy forms", what do you think about this development st

    - by Steel Plume
    Hi, currently I am using yet 1.1 specs, so I am trying to make simple what is too complex for me :p, managing backing beans with conflicting navigation rules, external params breaking rules and so on... for example when I need a backing bean used by other "views" simply I call it using FacesContext inside other backing beans, but often it's too wired up to JSF navigation/initialization rules to be really usable, and of course more simple is more useful become the FacesContext. So with only a bit of cross browser Javascript (simply a form copy and a read-write on a "proxy" form), I create a sort of proxy form inside the main user page (totally disassociated from JSF navigation rules, but using JSF taglibs). Ajax gives me flexibility on the user interaction, but data is always managed by JSF. Pratically I demand all "fictious" user actions to an hidden "iframe" which build up all needed forms according JSF rules, then a javascript simply clone its form output and put it into the user view level (CSS for showing/hiding real command buttons and making pretty), the user plays around and when he click submit, a script copies all "proxied" form values into the real JSF form inside the "iframe" that invokes the real submit of the form, what it returns is obviously dependent by your choice. Now JSF is really a pleasure :-p My real interest is to know what are your alternative strategy for using pure Ajax and JSF 1.1 without adopting middle layer like ajax4jsf and others, all good choices but too much "plugins" than specs.

    Read the article

  • Why would the same web form control render different "onclick" logic based on the page structure?

    - by zk812
    It was hard to title this question. :) I have a user control that is used to display a list of lookup items in my database and a delete button for each item (Editor User Control below). The delete button has an onClientClick event used to display a confirmation dialog in JavaScript. On page one, the confirmation pops up and functions correctly. The overall structure is: Master Page Page Editor User Control List of items with delete button On page two, the confirmation pops up but regardless of the answer, the page posts back anyway. The structure of this page is: Master Page Page User Control Editor User Control List of items with delete button For some reason, this makes a difference in how the delete button is rendered. Page one: <input type="image" name="ctl00...RequestTypesDataList$ctl01$ctl01" src="Images/Disable.png" alt="Delete" onclick="return ProcessDeleteCommand(1);" /> Page two: <input type="image" name="ctl00...RequestTypesDataList$ctl07$ctl01" src="Images/Disable.png" alt="Delete" onclick="return ProcessDeleteCommand(2);WebForm_DoPostBackWithOptions(new WebForm_PostBackOptions(&quot;ctl00$ContentPlaceHolder1$RequestCreator1$RequestTypeEditor1$RequestTypesDataList$ctl07$ctl01&quot;, &quot;&quot;, true, &quot;&quot;, &quot;&quot;, false, false))" /> Does anyone know why page two renders WebForm_DoPostBackWithOptions after my JS check? It's causing the postback regardless of the confirmation choice.

    Read the article

  • how to access a label form user control in Parent class ?

    - by haansi
    I have a class UserControlBase that inherits System.Web.UI.UserControl and my user controls inherit UserControlBase class. UserControlBase has some common functions that are used in all user controls. I want to put error display funtion to UserControlBase as well so that I may not have to declare and manage it in all user controls. Error will be displayed in some label in usercontrol. Issue is how to access label which is in usercontrol in UserControlBase in function ? I dont want to pass label as argument. Please guide me on this issue. thanks

    Read the article

< Previous Page | 295 296 297 298 299 300 301 302 303 304 305 306  | Next Page >