Search Results

Search found 70 results on 3 pages for 'linebreaks'.

Page 3/3 | < Previous Page | 1 2 3 

  • Is there a "Language-Aware" diff?

    - by JS
    (Appologies for the poor title. I'm open to suggestions for a better one. "Language-gnostic", perhaps?) Does there exist a diff utility (preferably *nix-based) that will diff files based on how a (selectable) language compiler would view the code? For example, to a Python compiler, these two 'graphs are identical: # The quick brown fox jumped vs: # The quick brown # fox jumped Telling most diffs (at least the one's I'm familiar with) to ignore spaces and linebreaks still causes them to flag a difference due to the extra '#'. "Language-sensitivity" would sure help to cut down on the "noise". Ideally, it would work in xemacs....(<-- probably pushing my luck? :-)

    Read the article

  • [Java] Cut <br/>-Tags from String end

    - by Robert M.
    Hello everybody, I am currently developing a Web-Application using Java EE where I'm using a Rich-Javascript-Editor (http://www.primefaces.org/showcase/ui/editor.jsf). As the user can easily add too many linebreaks that will be convertet to linebreak-tags, I need to remove all these Tags from the end of a String. Is there an elegant way of using Regex to accomplish this? An example String would be: "This is a test <b>bold</b><br/><br/>" Where obviously the last two tags have to be removed. Thank you in advance for any help Best Regards, Robert

    Read the article

  • "Zoom" text to be as big as possible within constraints/box

    - by stolsvik
    First problem: You have 400 pixels width to go on, and need to fit some text within that constraint as large as possible (thus, the text shall use that amount of space). Throw in a new constraint: If the text is just "A", then it shall not zoom this above 100 pixels (or some specific font size). Then, a final situation: Linebreaks. Fit some text in the largest possible way within e.g. 400 x 150 pixels. An obvious way is to simply start with point 1, and then increase until you can't fit it anymore. This would work for all three problems, but would be very crude. The fitting of a single line within bounds could be done by writing it with some fixed point size, check the resulting pixel bounds of the text, and then simply scale it with a transform (the text scales properly too then, check out TransformUI). Any ideas of other ways to attack this would be greatly appreciated!

    Read the article

  • Ttstyledtextlabel does not draw properly when text property is assigned multiple times

    - by user210504
    I have A ttstyledtextlabel in my uitableview cell. It has got some web URLs for images which are being rendered. But since images take some time to download i reload the cell after sometime to render the images if they have been downloaded. The problem I am facing is that during subsequent assignment of text if the size of the label changes, happens when images have been successfully loaded the label does not render properly but rather blanks out. But I see the proper label when is scroll and come back to the cell again. Anyone faced this issue or simply when the following line is executed multiple times, the Styled Label goes blank StyledView.text = [TTStyledText textFromXHTML:[self getStyledText] lineBreaks:YES URLs:YES];

    Read the article

  • Is there any injection vunerability in the body of an email?

    - by Brett
    Hey guys..... AFAIK there is only a vulnerability within the HEADERS of an email when using user data correct? I am using the below function to sanitize my data, however I have some textarea fields on the page & hence these may contain linebreaks.. so was wondering if that user data is only going to be put in the body of the email, can it not bother with being sanitized - apart from stripping html of course? Here is the function: function is_injected($str) { $injections = array('(\n+)', '(\r+)', '(\t+)', '(%0A+)', '(%0D+)', '(%08+)', '(%09+)' ); $inject = join('|', $injections); $inject = "/$inject/i"; if (preg_match($inject,$str)) { return true; } else { return false; } } As a side note, surprised there wasn't currently a tag for mail-injection / email-injection. Thanks!

    Read the article

  • Length of text that can just fit into one screen without scrolling

    - by KailZhang
    I find some iphone book apps have such feature: One screen one page of text without scrolling. The text can just fit into the whole screen with linebreaks and indentations. I'm curious of how to implement this. How could I decide the length of text that just fit into the screen. And also, given the whole text, I can calculate out the number of pages. If this is not possible to be done on iPhone(runtime?), then is it possible to process the text before storing it in app? I mean I calculate how many pages I need(how to split the raw text), probably how many lines per page.

    Read the article

  • Hard wrapping in vim without joining

    - by Miles
    Vim newbie here. How can I hard wrap plain text in vim (inserting actual linebreaks), respecting word boundaries, without joining existing lines? For example, given this: Lorem ipsum dolor sit amet, consectetur adipiscing elit. - Nulla cursus accumsan faucibus. - Donec dapibus dignissim ullamcorper. Integer nec malesuada diam. I'd like to get (with textwidth=30): Lorem ipsum dolor sit amet, consectetur adipiscing elit. - Nulla cursus accumsan faucibus. - Donec dapibus dignissim ullamcorper. Integer nec malesuada diam. instead of this (which I can get with gggqG) Lorem ipsum dolor sit amet, consectetur adipiscing elit. - Nulla cursus accumsan faucibus. - Donec dapibus dignissim ullamcorper. Integer nec malesuada diam. Also, for bonus points: when I create a brand new buffer, I get different wrapping behavior (lines beginning with - aren't wrapped specially) than when I open a file ending in .txt. What controls this? I don't notice any difference in the output of :set filetype? or :filetype.

    Read the article

  • Desktop login fails, terminal works

    - by Tobias
    I have a freshly setup 12.04 LTS pc system (120 GB SSD, 1 TB HDD, 16 GiB RAM); since a few days, I can't login to the graphical desktop anymore: there is very short flashing shell window which disappears very quickly, and I'm confronted with the login screen again. I believe there is something about modprobe and vbox, but I can't read it fast enough ... I can login to a terminal (Ctrl+Alt+F1). It did not help to chown all contents of my home directory to me:my-group, like suggested here. This is what I could find in /var/log, grepping for the date and time (I inserted linebreaks after <my-hostname>; real time values preserved): auth.log: <date> 22:43:01 <my-hostname> lightdm: pam_succeed_if(lightdm:auth): requirement "user ingroup nopasswdlogin" not met by user "tobias" <date> 22:43:08 <my-hostname> lightdm: pam_unix(lightdm:session): session closed for user lightdm <date> 22:43:08 <my-hostname> lightdm: pam_unix(lightdm:session): session opened for user tobias by (uid=0) <date> 22:43:08 <my-hostname> lightdm: pam_ck_connector(lightdm:session): nox11 mode, ignoring PAM_TTY :0 <date> 22:43:08 <my-hostname> lightdm: pam_unix(lightdm:session): session closed for user tobias <date> 22:43:09 <my-hostname> lightdm: pam_unix(lightdm:session): session opened for user lightdm by (uid=0) <date> 22:43:09 <my-hostname> lightdm: pam_ck_connector(lightdm:session): nox11 mode, ignoring PAM_TTY :0 <date> 22:43:10 <my-hostname> lightdm: pam_succeed_if(lightdm:auth): requirement "user ingroup nopasswdlogin" not met by user "tobias" <date> 22:43:10 <my-hostname> dbus[756]: [system] Rejected send message, 2 matched rules; type="method_call", sender="1:43" (uid=104 pid=1639 comm="/usr/lib/indicator-datetime/indicator-datetime-ser") interface="org.freedesktop.DBus.Properties" member="GetAll" error name="(unset)" requested_reply="0" destination=":1.15" (uid=0 pid=1005 comm="/usr/sbin/console-kit-daemon --no-daemon ") kern.log: <date> 22:43:00 <my-hostname> kernel: [ 16.084525] eth0: no IPv6 routers present syslog: <date> 22:43:00 <my-hostname> kernel: [ 16.084525] eth0: no IPv6 routers present <date> 22:43:01 <my-hostname> ntpdate[1492]: adjust time server 91.189.94.4 offset -0.162831 sec <date> 22:43:08 <my-hostname> acpid: client 969[0:0] has disconnected <date> 22:43:08 <my-hostname> acpid: client connected from 1553[0:0] <date> 22:43:08 <my-hostname> acpid: 1 client rule loaded I have Virtualbox and Truecrypt installed, but I can't think of a reason why they might prevent a graphical login. I'm confused: What is this about requirement "user ingroup nopasswdlogin" not met? I do login using a password, and the password works ok when logging in to a terminal! Can I somehow read the error output, e.g. by delaying it, redirecting it to a file, or having the system prompt me for pressing a key? Has possibly any recent update caused my problem? Should I install the pending updates? How, btw, without access to the graphical UI? I have some working knowledge about the Linux shell, but I'm new to Ubuntu. Any help would be appreciated.

    Read the article

  • Extract a pattern from the output of curl

    - by allentown
    I would like to use curl, on the command line, to grab a url, pipe it to a pattern, and return a list of urls that match that pattern. I am running into problems with greedy aspects of the pattern, and can not seem to get past it. Any help on this would be apprecaited. curl http://www.reddit.com/r/pics/ | grep -ioE "http://imgur\.com/.+(jpg|jpeg|gif|png)" So, grab the data from the url, which returns a mess of html, which may need some linebreaks somehow replaced in, onless the regex can return more than one pattern in a single line. The patter is pretty simple, any string that matches... starts with http://imgur.com/ has A-Z a-z 0-9 (maybe some others) and is so far, 5 chars long, 8 should cover it forever if I wanted to limit that aspect of the patter, which I don't ends in a .grraphic_file_format_extention (jpg, jpeg, gif, png) Thats about it, at that url, with default settings, I should generally get back a good set of images. I would not be objectionable to using the RSS feel url for the same page, it may be easier to parse actually. Thanks everyone!

    Read the article

  • Why would a WebService return nulls when the actual service returns data?

    - by Jerry
    I have a webservice (out of my control) that I have to talk to. I also have a packet-sniffer on the line, and (SURPRISE!!!) the developers of the webservice aren't lying. They are actually sending back all of the data that I requested. But the web-service code that is auto-generated from the WSDL file is giving me "null" as a value. I used their WSDL file to generate my Web Reference. I checked my data types with the datatypes that the WSDL file has declared. And I used the code as listed below to perform the calls: DT_MaterialMaster_LookupRequest req = new DT_MaterialMaster_LookupRequest(); req.MaterialNumber = "101*"; req.DocumentNo = ""; req.Description = "Pipe*"; req.Plant = "0000"; MI_MaterialMaster_Lookup_OBService srv = new MI_MaterialMaster_Lookup_OBService(); DT_MaterialMaster_Response resp = srv.MI_MaterialMaster_Lookup_OB(new DT_MaterialMaster_LookupRequest[] { req }); // Note that the response here is ALWAYS null!! Console.WriteLine(resp.Status); The resp object is an actual object. It was generated properly. However, the Status and MaterialData fields are always null. When I call the web service, I've placed a packet-sniffer on the line, and I can see that I've sent the following (linebreaks and indentions for my own sanity): <?xml version="1.0" encoding="utf-8"?> <soap:Envelope xmlns:soap="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <soap:Body> <MT_MaterialMaster_Lookup xmlns="http://MyCompany.com/SomeCompany/mm/MaterialMasterSearch"> <Request xmlns=""> <MaterialNumber>101*</MaterialNumber> <Description>Pipe*</Description> <DocumentNo /> <Plant>0000</Plant> </Request> </MT_MaterialMaster_Lookup> </soap:Body> </soap:Envelope> The response that they send back SEEMS to be a valid response (linebreaks and indentions for my own sanity): <SOAP:Envelope xmlns:SOAP='http://schemas.xmlsoap.org/soap/envelope/'> <SOAP:Header /> <SOAP:Body> <n0:MT_MaterialMaster_Response xmlns:n0='http://MyCompany.com/SomeCompany/mm/MaterialMasterSearch' xmlns:prx='urn:SomeCompany.com:proxy:BRD:/1SAI/TAS4FE14A2DE960D61219AE:701:2009/02/10'> <Response> <Status>No Rows Found</Status> <MaterialData /> </Response> </n0:MT_MaterialMaster_Response> </SOAP:Body> </SOAP:Envelope> The status shows that it actually received data... but the resp.Status and resp.MaterialData fields are always null. What have I done wrong? UPDATE: The WSDL file is defined as: <?xml version="1.0" encoding="utf-8"?> <wsdl:definitions xmlns:p1="http://MyCompany.com/SomeCompany/mm/MaterialMasterSearch" name="MI_MaterialMaster_Lookup_AutoCAD_OB" targetNamespace="http://MyCompany.com/SomeCompany/mm/MaterialMasterSearch" xmlns:wsdl="http://schemas.xmlsoap.org/wsdl/"> <wsdl:types> <xsd:schema xmlns="http://MyCompany.com/SomeCompany/mm/MaterialMasterSearch" targetNamespace="http://MyCompany.com/SomeCompany/mm/MaterialMasterSearch" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <xsd:element name="MT_MaterialMaster_Response" type="p1:DT_MaterialMaster_Response" /> <xsd:element name="MT_MaterialMaster_Lookup" type="p1:DT_MaterialMaster_Lookup" /> <xsd:complexType name="DT_MaterialMaster_Response"> <xsd:sequence> <xsd:element name="Status" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">d48d03b040af11df99e300145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element maxOccurs="unbounded" name="MaterialData"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa040a511df843700145eccb24e</xsd:appinfo> </xsd:annotation> <xsd:complexType> <xsd:sequence> <xsd:element name="MaterialNumber" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa140a511df848500145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="Description" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa240a511df95bf00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="DocumentNo" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa340a511dfb23700145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="UOM" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">3b5f14c040a611df9fbe00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="Hierarchy" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa440a511dfc65b00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="Plant" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">d48d03b140af11dfb78e00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="Procurement" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">d48d03b240af11dfb87b00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> <xsd:complexType name="DT_MaterialMaster_Lookup"> <xsd:sequence> <xsd:element maxOccurs="unbounded" name="Request"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa040a511df843700145eccb24e</xsd:appinfo> </xsd:annotation> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" name="MaterialNumber" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa140a511df848500145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="Description" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa240a511df95bf00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="DocumentNo" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa340a511dfb23700145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> <xsd:element minOccurs="0" name="Plant" type="xsd:string"> <xsd:annotation> <xsd:appinfo source="http://SomeCompany.com/xi/TextID">64908aa440a511dfc65b00145eccb24e</xsd:appinfo> </xsd:annotation> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:schema> </wsdl:types> <wsdl:message name="MT_MaterialMaster_Lookup"> <wsdl:part name="MT_MaterialMaster_Lookup" element="p1:MT_MaterialMaster_Lookup" /> </wsdl:message> <wsdl:message name="MT_MaterialMaster_Response"> <wsdl:part name="MT_MaterialMaster_Response" element="p1:MT_MaterialMaster_Response" /> </wsdl:message> <wsdl:portType name="MI_MaterialMaster_Lookup_AutoCAD_OB"> <wsdl:operation name="MI_MaterialMaster_Lookup_AutoCAD_OB"> <wsdl:input message="p1:MT_MaterialMaster_Lookup" /> <wsdl:output message="p1:MT_MaterialMaster_Response" /> </wsdl:operation> </wsdl:portType> <wsdl:binding name="MI_MaterialMaster_Lookup_AutoCAD_OBBinding" type="p1:MI_MaterialMaster_Lookup_AutoCAD_OB"> <binding transport="http://schemas.xmlsoap.org/soap/http" xmlns="http://schemas.xmlsoap.org/wsdl/soap/" /> <wsdl:operation name="MI_MaterialMaster_Lookup_AutoCAD_OB"> <operation soapAction="http://SomeCompany.com/xi/WebService/soap1.1" xmlns="http://schemas.xmlsoap.org/wsdl/soap/" /> <wsdl:input> <body use="literal" xmlns="http://schemas.xmlsoap.org/wsdl/soap/" /> </wsdl:input> <wsdl:output> <body use="literal" xmlns="http://schemas.xmlsoap.org/wsdl/soap/" /> </wsdl:output> </wsdl:operation> </wsdl:binding> <wsdl:service name="MI_MaterialMaster_Lookup_AutoCAD_OBService"> <wsdl:port name="MI_MaterialMaster_Lookup_AutoCAD_OBPort" binding="p1:MI_MaterialMaster_Lookup_AutoCAD_OBBinding"> <address location="http://bxdwas.MyCompany.com/XISOAPAdapter/MessageServlet?channel=:AutoCAD:SOAP_SND_Material_Lookup" xmlns="http://schemas.xmlsoap.org/wsdl/soap/" /> </wsdl:port> </wsdl:service> </wsdl:definitions>

    Read the article

  • regex php: find everything in div

    - by Fifth-Edition
    I'm trying to find eveything inside a div using regexp. I'm aware that there probably is a smarter way to do this - but I've chosen regexp. so currently my regexp pattern looks like this: $gallery_pattern = '/([\s\S]*)<\/div/'; And it does the trick - somewhat. the problem is if i have two divs after each other - like this. <div class="gallery">text to extract here</div> <div class="gallery">text to extract from here as well</div> I want to extract the information from both divs, but my problem, when testing, is that im not getting the text in between as a result but instead: "text to extract here text to extract from here as well" So . to sum up. It skips the first end of the div. and continues on to the next. The text inside the div can contain "<", "/" and linebreaks. just so you know! Does anyone have a simple solution to this problem? Im still a regexp novice.

    Read the article

  • Looking for a fast, compact, streamable, multi-language, strongly typed serialization format

    - by sanity
    I'm currently using JSON (compressed via gzip) in my Java project, in which I need to store a large number of objects (hundreds of millions) on disk. I have one JSON object per line, and disallow linebreaks within the JSON object. This way I can stream the data off disk line-by-line without having to read the entire file at once. It turns out that parsing the JSON code (using http://www.json.org/java/) is a bigger overhead than either pulling the raw data off disk, or decompressing it (which I do on the fly). Ideally what I'd like is a strongly-typed serialization format, where I can specify "this object field is a list of strings" (for example), and because the system knows what to expect, it can deserialize it quickly. I can also specify the format just by giving someone else its "type". It would also need to be cross-platform. I use Java, but work with people using PHP, Python, and other languages. So, to recap, it should be: Strongly typed Streamable (ie. read a file bit by bit without having to load it all into RAM at once) Cross platform (including Java and PHP) Fast Free (as in speech) Any pointers?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • import text file containing line breaks into excel

    - by Maximilian Tyrtania
    I have a plain text file looking like this: "some text containing line breaks" I'm trying to talk excel 2004 (Mac, v.11.5) into opening this file correctly. I'd expect to see only one cell (A1) containing all of the above (without the quotes)... But alas, I can't make it happen, because Excel seems to insist on using the CR's as row delimiters, even if I set the text qualifier to double quote. I was sort of hoping that Excel would understand that those line breaks are part of the value - they are embedded in double quotes which should qualify them as part of the value. So my Excel sheet has 5 rows, which is not what I want. I also tried this Applescript to no avail: tell application "Microsoft Excel" activate open text file filename ¬ "Users:maximiliantyrtania:Desktop:linebreaks" data type delimited ¬ text qualifier text qualifier double quote ¬ field info {{1, text format}} ¬ origin Macintosh with tab end tell If I could tell Excel to use a row delimiter other than CR (or LF), well, I'd be a happy camper, but excel seems to allow the change of the field delimiter only, not the row delimiter. Any pointers? Thanks, Max Excel's open

    Read the article

  • How do you safely wrap a JS string variable in double quote chars?

    - by incombinative
    Obviously when you're creating an actual string literal yourself, you backslash escape the double quote characters yourself. var foo = "baz\"bat"; Just as you would with the handful of other control characters, like linebreaks and backslashes. var bar = "baz\\bat"; but when you already have a variable, and you're wrapping that existing variable in quote characters, there's some confusion. Obviously you have to escape any potential double quote characters that are in the string. (Assuming whatever system you're giving the explicitly quoted string to, needs to be able to parse them correctly. =) var doubleQuoteRe = /\"/g; var quoted = unquoted.replace(escaper, '\\\"'); However from there opinions diverge a little. In particular, according to some you also have to worry about escaping literal backslash characters in the variable. // now say i have a string bar, that has both single backslash character in it, // as well as a double-quote character in it. // the following code ONLY worries about escaping the double quote char. var quoted = bar.replace(doubleQuoteRe, '\\\"'); The above seems fine to me. But is there a problem im not seeing?

    Read the article

  • displaying the file data in correct format

    - by tazim
    hi, In views.py def showfiledata(request): with open("/home/tazim/webexample/tmp.txt") as f: read_data = f.read() f.closed return_dict = {'filedata':read_data} json = simplejson.dumps(return_dict) return HttpResponse(json,mimetype="application/json") In the template: < html < head < script type="text/javascript" src="/jquerycall/" < script type="text/javascript" $(document).ready(function() { $("button").click(function() { $.ajax({ type:"POST", url:"/showfiledata/", datatype:"json", success:function(data) { var s = data.filedata; $("#someid").html(s); } }); }); }); < /script < /head < body < form method="post" < button type="button"Click Me< /button < div id="someid"< /div < /form < /body < /html I am suppose to display file line by line . But, right now the lines get displayed withoout any linebreaks.

    Read the article

  • c# Xna keydown with a delay of 1 sec

    - by bld
    Hi!. im writing a tetris in xna. i have a class with a method rotateBlocks. When i press the "Up" arrow key. i wanna have that when i hold the button down for 1 sec or more that it executes the arguments in the first else if(rotating the blocks fast) right now nothing is happening. i have declared oldState globally in the class. if i remove the gametime check in first the else if the block will rotate fast imedietley. if i try to step through the code with linebreaks the resolution get f****d up public void RotateBlocks(loadBlock lb, KeyboardState newState, GameTime gameTime) { _elapsedSeconds2 += (float)gameTime.ElapsedGameTime.TotalSeconds; if (lb._name.Equals("block1")) { if (newState.IsKeyDown(Keys.Up) && !oldState.IsKeyDown(Keys.Up)) { // the player just pressed Up if (_rotated) { lb._position[0].X -= 16; lb._position[0].Y -= 16; lb._position[2].X += 16; lb._position[2].Y += 16; lb._position[3].X += 32; lb._position[3].Y += 32; _rotated = false; } else if (!_rotated) { lb._position[0].X += 16; lb._position[0].Y += 16; lb._position[2].X -= 16; lb._position[2].Y -= 16; lb._position[3].X -= 32; lb._position[3].Y -= 32; _rotated = true; } } if (newState.IsKeyDown(Keys.Up) && oldState.IsKeyDown(Keys.Up)) { // the player is holding the key down if (gameTime.ElapsedGameTime.TotalSeconds >=1) { if (_rotated) { lb._position[0].X -= 16; lb._position[0].Y -= 16; lb._position[2].X += 16; lb._position[2].Y += 16; lb._position[3].X += 32; lb._position[3].Y += 32; _rotated = false; } else if (!_rotated) { lb._position[0].X += 16; lb._position[0].Y += 16; lb._position[2].X -= 16; lb._position[2].Y -= 16; lb._position[3].X -= 32; lb._position[3].Y -= 32; _rotated = true; } _elapsedSeconds2 = 0; } }

    Read the article

  • XmlException - inserting attribute gives "unexpected token" exception

    - by Anders Svensson
    Hi, I have an XmlDocument object in C# that I transform, using XslTransform, to html. In the stylesheet I insert an id attribute in a span tag, taking the id from an element in the XmlDocument. Here is the template for the element: <xsl:template match="word"> <span> <xsl:attribute name="id"><xsl:value-of select="@id"></xsl:value-of></xsl:attribute> <xsl:apply-templates/> </span> </xsl:template> But then I want to process the result document as an xhtml document (using the XmlDocument dom). So I'm taking a selected element in the html, creating a range out of it, and try to load the element using XmlLoad(): wordElem.LoadXml(range.htmlText); But this gives me the following exception: "'598' is an unexpected token. The expected token is '"' or '''. Line 1, position 10." And if I move the cursor over the range.htmlText, I see the tags for the element, and the "id" shows without quotes, which confuses me (i.e.SPAN id=598 instead of SPAN id="598"). To confuse the matter further, if I insert a blank space or something like that in the value of the id in the stylesheet, it works fine, i.e.: <span> <xsl:attribute name="id"><xsl:text> </xsl:text> <xsl:value-of select="@id"></xsl:value-of></xsl:attribute> <xsl:apply-templates/> </span> (Notice the whitespace in the xsl:text element). Now if I move the cursor over the range.htmlText, I see an id with quotes as usual in attributes (and as it shows if I open the html file in notepad or something). What is going on here? Why can't I insert an attribute this way and have a result that is acceptable as xhtml for XmlDocument to read? I feel I am missing something fundamental, but all this surprises me, since I do this sort of transformations using xsl:attribute to insert attributes all the time for other types of xsl transformations. Why doesn't XmlDocument accept this value? By the way, it doesn't matter if it is an id attribute. i have tried with the "class" attribute, "style" etc, and also using literal values such as "style" and setting the value to "color:red" and so on. The compiler always complains it is an unvalid token, and does not include quotes for the value unless there is a whitespace or something else in there (linebreaks etc.). I hope I have provided enough information. Any help will be greatly appreciated. Basically, what I want to accomplish is set an id in a span element in html, select a word in a webbrowser control with this document loaded, and get the id attribute out of the selected element. I've accomplished everything, and can actually do what I want, but only if I use regex e.g. to get the attribute value, and I want to be able to use XmlDocument instead to simply get the value out of the attribute directly. I'm sure I'm missing something simple, but if so please tell me. Regards, Anders

    Read the article

  • tableView:didSelectRowAtIndexPath: calls TTNavigator openURLAction:applyAnimated: — UITabBar and na

    - by vikingosegundo
    I have an existing iphone project with a UITabBar. Now I need styled text and in-text links to other ViewControllers in my app. I am trying to integrate TTStyledTextLabel. I have a FirstViewController:UITabelViewController with this tableView:didSelectRowAtIndexPath: - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { NSString *url; if ([self.filteredQuestions count]>0) { url = [NSString stringWithFormat:@"%@%d", @"tt://question/", [[self.filteredQuestions objectAtIndex:indexPath.row] id]]; [[TTNavigator navigator] openURLAction:[[TTURLAction actionWithURLPath: url] applyAnimated:YES]]; } else { Question * q = [self.questions objectAtIndex:indexPath.row] ; url = [NSString stringWithFormat:@"%@%d", @"tt://question/", [q.id intValue]]; } TTDPRINT(@"%@", url); TTNavigator *navigator = [TTNavigator navigator]; [navigator openURLAction:[[TTURLAction actionWithURLPath: url] applyAnimated:YES]]; } My mapping looks like this: TTNavigator* navigator = [TTNavigator navigator]; navigator.window = window; navigator.supportsShakeToReload = YES; TTURLMap* map = navigator.URLMap; [map from:@"*" toViewController:[TTWebController class]]; [map from:@"tt://question/(initWithQID:)" toViewController:[QuestionDetailViewController class]]; and my QuestionDetailViewController: @interface QuestionDetailViewController : UIViewController <UIScrollViewDelegate , QuestionDetailViewProtocol> { Question *question; } @property(nonatomic,retain) Question *question; -(id) initWithQID:(NSString *)qid; -(void) goBack:(id)sender; @end When I hit a cell, q QuestionDetailViewController will be called — but the navigationBar wont @implementation QuestionDetailViewController @synthesize question; -(id) initWithQID:(NSString *)qid { if (self = [super initWithNibName:@"QuestionDetailViewController" bundle:nil]) { //; TTDPRINT(@"%@", qid); NSManagedObjectContext *managedObjectContext = [(domainAppDelegate*)[[UIApplication sharedApplication] delegate] managedObjectContext]; NSPredicate *predicate =[NSPredicate predicateWithFormat:@"id == %@", qid]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"Question" inManagedObjectContext:managedObjectContext]; NSFetchRequest *request = [[NSFetchRequest alloc] init]; [request setEntity:entity]; [request setPredicate:predicate]; NSError *error = nil; NSArray *array = [managedObjectContext executeFetchRequest:request error:&error]; if (error==nil && [array count]>0 ) { self.question = [array objectAtIndex:0]; } else { TTDPRINT(@"error: %@", array); } } return self; } - (void)viewDidLoad { [super viewDidLoad]; [TTStyleSheet setGlobalStyleSheet:[[[TextTestStyleSheet alloc] init] autorelease]]; [self.navigationController.navigationBar setTranslucent:YES]; NSArray *includedLinks = [self.question.answer.text vs_extractExternalLinks]; NSMutableDictionary *linksToTT = [[NSMutableDictionary alloc] init]; for (NSArray *a in includedLinks) { NSString *s = [a objectAtIndex:3]; if ([s hasPrefix:@"/answer/"] || [s hasPrefix:@"http://domain.com/answer/"] || [s hasPrefix:@"http://www.domain.com/answer/"]) { NSString *ttAdress = @"tt://question/"; NSArray *adressComps = [s pathComponents]; for (NSString *s in adressComps) { if ([s isEqualToString:@"qid"]) { ttAdress = [ttAdress stringByAppendingString:[adressComps objectAtIndex:[adressComps indexOfObject:s]+1]]; } } [linksToTT setObject:ttAdress forKey:s]; } } for (NSString *k in [linksToTT allKeys]) { self.question.answer.text = [self.question.answer.text stringByReplacingOccurrencesOfString:k withString: [linksToTT objectForKey:k]]; } TTStyledTextLabel *answerText = [[[TTStyledTextLabel alloc] initWithFrame:CGRectMake(0, 0, 320, 700)] autorelease]; if (![[self.question.answer.text stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceCharacterSet]] hasPrefix:@"<div"]) { self.question.answer.text = [NSString stringWithFormat:@"%<div>%@</div>", self.question.answer.text]; } NSString * s = [NSString stringWithFormat:@"<div class=\"header\">%@</div>\n%@",self.question.title ,self.question.answer.text]; answerText.text = [TTStyledText textFromXHTML:s lineBreaks:YES URLs:YES]; answerText.contentInset = UIEdgeInsetsMake(20, 15, 20, 15); [answerText sizeToFit]; [self.navigationController setNavigationBarHidden:NO animated:YES]; [self.view addSubview:answerText]; [(UIScrollView *)self.view setContentSize:answerText.frame.size]; self.view.backgroundColor = [UIColor whiteColor]; [linksToTT release]; } ....... @end This works quite nice, as soon as a cell is touched, a QuestionDetailViewController is called and pushed — but the tabBar will disappear, and the navigationItem — I set it like this: self.navigationItem.title =@"back to first screen"; — won't be shown. And it just appears without animation. But if I press a link inside the TTStyledTextLabel the animation works, the navigationItem will be shown. How can I make the animation, the navigationItem and the tabBar be shown?

    Read the article

  • Silverlight 2.0 - Can't get the text wrapping behaviour that I want

    - by Anthony
    I am having trouble getting Silverlight 2.0 to lay out text exactly how I want. I want text with line breaks and embedded links, with wrapping, like HTML text in a web page. Here's the closest that I have come: <UserControl x:Class="FlowPanelTest.Page" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:Controls="clr-namespace:Microsoft.Windows.Controls;assembly=Microsoft.Windows.Controls" Width="250" Height="300"> <Border BorderBrush="Black" BorderThickness="2" > <Controls:WrapPanel> <TextBlock x:Name="tb1" TextWrapping="Wrap">Short text. </TextBlock> <TextBlock x:Name="tb2" TextWrapping="Wrap">A bit of text. </TextBlock> <TextBlock x:Name="tb3" TextWrapping="Wrap">About half of a line of text.</TextBlock> <TextBlock x:Name="tb4" TextWrapping="Wrap">More than half a line of longer text.</TextBlock> <TextBlock x:Name="tb5" TextWrapping="Wrap">More than one line of text, so it will wrap onto the following line.</TextBlock> </Controls:WrapPanel> </Border> </UserControl> But the issue is that although the text blocks tb1 and tb2 will go onto the same line because there is room enough for them completely, tb3 onwards will not start on the same line as the previous block, even though it will wrap onto following lines. I want each text block to start where the previous one ends, on the same line. I want to put click event handlers on some of the text. I also want paragraph breaks. Essentially I'm trying to work around the lack of FlowDocument and Hyperlink controls in Silverlight 2.0's subset of XAML. To answer the questions posed in the answers: Why not use runs for the non-clickable text? If I just use individual TextBlocks only on the clickable text, then those bits of text will still suffer from the wrapping problem illustrated above. And the TextBlock just before the link, and the TextBlock just after. Essentially all of it. It doesn't look like I have many opportunities for putting multiple runs in the same TextBlock. Dividing the links from the other text with RegExs and loops is not the issue at all, the issue is display layout. Why not put each word in an individual TextBlock in a WrapPanel Aside from being an ugly hack, this does not play at all well with linebreaks - the layout is incorrect. It would also make the underline style of linked text into a broken line. Here's an example with each word in its own TextBlock. Try running it, note that the linebreak isn't shown in the right place at all. <UserControl x:Class="SilverlightApplication2.Page" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:Controls="clr-namespace:Microsoft.Windows.Controls;assembly=Microsoft.Windows.Controls" Width="300" Height="300"> <Controls:WrapPanel> <TextBlock TextWrapping="Wrap">Short1 </TextBlock> <TextBlock TextWrapping="Wrap">Longer1 </TextBlock> <TextBlock TextWrapping="Wrap">Longerest1 </TextBlock> <TextBlock TextWrapping="Wrap"> <Run>Break</Run> <LineBreak></LineBreak> </TextBlock> <TextBlock TextWrapping="Wrap">Short2</TextBlock> <TextBlock TextWrapping="Wrap">Longer2</TextBlock> <TextBlock TextWrapping="Wrap">Longerest2</TextBlock> <TextBlock TextWrapping="Wrap">Short3</TextBlock> <TextBlock TextWrapping="Wrap">Longer3</TextBlock> <TextBlock TextWrapping="Wrap">Longerest3</TextBlock> </Controls:WrapPanel> </UserControl> What about The LinkLabelControl as here and here. It has the same problems as the approach above, since it's much the same. Try running the sample, and make the link text longer and longer until it wraps. Note that the link starts on a new line, which it shouldn't. Make the link text even longer, so that the link text is longer than a line. Note that it doesn't wrap at all, it cuts off. This control doesn't handle line breaks and paragraph breaks either. Why not put the text all in runs, detect clicks on the containing TextBlock and work out which run was clicked Runs do not have mouse events, but the containing TextBlock does. I can't find a way to check if the run is under the mouse (IsMouseOver is not present in SilverLight) or to find the bounding geometry of the run (no clip property). There is VisualTreeHelper.FindElementsInHostCoordinates() The code below uses VisualTreeHelper.FindElementsInHostCoordinates to get the controls under the click. The output lists the TextBlock but not the Run, since a Run is not a UiElement. private void theText_MouseLeftButtonDown(object sender, System.Windows.Input.MouseButtonEventArgs e) { // get the elements under the click UIElement uiElementSender = sender as UIElement; Point clickPos = e.GetPosition(uiElementSender); var UiElementsUnderClick = VisualTreeHelper.FindElementsInHostCoordinates(clickPos, uiElementSender); // show the controls string outputText = ""; foreach (var uiElement in UiElementsUnderClick) { outputText += uiElement.GetType().ToString() + "\n"; } this.outText.Text = outputText; } Use an empty text block with a margin to space following content onto a following line I'm still thinking about this one. How do you calculate the right width for a line-breaking block to force following content onto the following line? Too short and the following content will still be on the same line, at the right. Too long and the "linebreak" will be on the following line, with content after it. You would have to resize the breaks when the control is resized. Some of the code for this is: TextBlock lineBreak = new TextBlock(); lineBreak.TextWrapping = TextWrapping.Wrap; lineBreak.Text = " "; // need adaptive width lineBreak.Margin = new Thickness(0, 0, 200, 0);

    Read the article

< Previous Page | 1 2 3