Search Results

Search found 2490 results on 100 pages for 'matching'.

Page 3/100 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • F# pattern matching when mixing DU's and other values

    - by Roger Alsing
    What would be the most effective way to express the following code? match cond.EvalBool() with | true -> match body.Eval() with | :? ControlFlowModifier as e -> match e with | Break(scope) -> e :> obj //Break is a DU element of ControlFlowModifier | _ -> next() //other members of CFM should call next() | _ -> next() //all other values should call next() | false -> null cond.EvalBool returns a boolean result where false should return null and true should either run the entire block again (its wrapped in a func called next) or if the special value of break is found, then the loop should exit and return the break value. Is there any way to compress that block of code to something smaller?

    Read the article

  • Scala: Matching optional Regular Expression groups

    - by Brian Heylin
    I'm trying to match on an option group in Scala 2.8 (beta 1) with the following code: import scala.xml._ val StatementPattern = """([\w\.]+)\s*:\s*([+-])?(\d+)""".r def buildProperty(input: String): Node = input match { case StatementPattern(name, value) => <propertyWithoutSign /> case StatementPattern(name, sign, value) => <propertyWithSign /> } val withSign = "property.name: +10" val withoutSign = "property.name: 10" buildProperty(withSign) // <propertyWithSign></propertyWithSign> buildProperty(withoutSign) // <propertyWithSign></propertyWithSign> But this is not working. What is the correct way to match optional regex groups?

    Read the article

  • Eliminating matching values in a SQL result set

    - by Burgess Taylor
    I have a table with a list of transactions (invoices and credits) and I need to get a list of all the rows where the invoices and credits don't match up. eg user product value bill ThingA 200 jim ThingA -200 sue ThingB 100 liz ThingC 50 I only want to see the third and fourth rows, as the values of the others match off. I can do this if I select product, sum(value) ... group by product having sum(value) < 0 which works well, but I want to return the user name as well. As soon as I add the user to the select, I need to group by it as well, which messes it up as the amounts don't match up by user AND product. Any ideas ? I am using MS SQL 2000... Cheers

    Read the article

  • Haskell: Pattern Matching with Lists

    - by user1670032
    I'm trying to make a function that takes in a list, and if one of the elements is negative, then any elements in that list that are equal to its positive counterpart should be changed to 0. Eg, if there is a -2 in a list, then all 2's in that list should be changed to 0. Any ideas why it only works for some cases and not others? I'm not understanding why this is, I've looked it over several times. changeToZero [] = [] changeToZero [x] = [x] changeToZero (x:zs:y:ws) | (x < 0) && ((-1)*(x) == y) = x : zs : 0 : changeToZero ws changeToZero (x:xs) = x : changeToZero xs *Main changeToZero [-1,1,-2,2,-3,3] [-1,1,-2,2,-3,3] *Main changeToZero [-2,1,2,3] [-2,1,0,3] *Main changeToZero [-2,1,2,3,2] [-2,1,0,3,2] *Main changeToZero [1,-2,2,2,1] [1,-2,2,0,1]

    Read the article

  • Is it possible, with simple F# pattern matching transformations, to ignore unmatched values without

    - by Phobis
    So, I previously asked this question: http://stackoverflow.com/questions/2820234/can-someone-help-me-compare-using-f-over-c-in-this-specific-example-ip-address I was looking at the posted code and I was wondering if this code could be written without it producing a warning: let [|a;b;c;d|] = s.Split [|'.'|] IP(parseOrParts a, parseOrParts b, parseOrParts c, parseOrParts d) Is it possible to do something for the match _ pattern ot ignore? Without adding in something like Active Patterns? i want to keep the code as simple as possible... can I do this without drastically changing this code? NOTE: Warning is as follows Warning Incomplete pattern matches on this expression. For example, the value '[|_; _; _; _; _|]' may indicate a case not covered by the pattern(s).

    Read the article

  • How to implement best matching logic in TSQL (SQL Server 2000)

    - by sanjay-kumar1911
    I have two tables X and Y: Table X C1 C2 C3 1 A 13 2 B 16 3 C 8 Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 N 3 A 12 N 4 A 5 N 5 B 7 N 6 B 16 N 7 B 9 N 8 B 5 N 9 C 8 N 10 C 2 N 11 C 8 N 12 C 6 N Records in Table Y can be n number CREATE TABLE X(C1 INT, C2 CHAR(1), C3 INT); CREATE TABLE Y(C1 INT, C2 CHAR(1), C3 INT, C4 CHAR(1)); with following data: INSERT INTO X VALUES (1 'A',13 ); INSERT INTO X VALUES (2 'B',16 ); INSERT INTO X VALUES (3 'C',8 ); INSERT INTO Y VALUES (1,'A', 2,'N'); INSERT INTO Y VALUES (2,'A', 8,'N'); INSERT INTO Y VALUES (3,'A', 12,'N'); INSERT INTO Y VALUES (4,'A', 5,'N'); INSERT INTO Y VALUES (5,'B', 7,'N'); INSERT INTO Y VALUES (6,'B', 16,'N'); INSERT INTO Y VALUES (7,'B', 9,'N'); INSERT INTO Y VALUES (8,'B', 5,'N'); INSERT INTO Y VALUES (9,'C', 8,'N'); INSERT INTO Y VALUES (10,'C', 2,'N'); INSERT INTO Y VALUES (11,'C', 8,'N'); INSERT INTO Y VALUES (12,'C', 6,'N'); EXPECTED RESULT Table Y C1 C2 C3 C4 1 A 2 N 2 A 8 Y 3 A 12 N 4 A 5 Y 5 B 7 N 6 B 16 Y 7 B 9 N 8 B 5 N 9 C 8 Y 10 C 2 N 11 C 8 N 12 C 6 N How do I compare value of column C3 in Table X with all possible matches of column C3 of Table Y and to mark records as matched and unmatched in column C4 of Table Y? Possible matches for A (i.e. value of column C2 in Table X) would be (where R is row number i.e. value of column C1 in Table Y): R1, R2, R3, R4, R1+R2, R1+R3, R1+R4, R2+R3, R2+R4, R3+R4, R4+R5, R1+R2+R3, R1+R2+R4, R2+R3+R4, R1+R2+R3+R4

    Read the article

  • Matching a rotated bitmap to a collage image

    - by Dmi
    Hi, My problem is that I have an image of a detailed street map. On this map, there can be a certain small image of a sign (such as a traffic light icon) rotated at any angle, maybe resized. I have this small image in a bitmap. Is there any algorithm or technique by which I can locate this bitmap if a copy of it exists, rotated and maybe resized, in the large collage image? This is similar to the problem with Augmented Reality and locating the marker image, but mine is only 2D with no perspective distortion.

    Read the article

  • Correct syntax for matching a string inside a variable against an array

    - by Jamex
    Hi, I have a variable, $var, that contains a string of characters, this is a dynamic variable that contains the values from inputs. $var could be 'abc', or $var could be 'blu', I want to match the string inside variable against an array, and return all the matches. $array = array("blue", "red", "green"); What is the correct syntax for writing the code in php, my rough code is below $match = preg_grep($var, $array); (incorrect syntax of course) I tried to put quotes and escape slashes, but so far no luck. Any suggestion? TIA

    Read the article

  • Strange pattern matching with functions instancing Show

    - by Sean D
    So I'm writing a program which returns a procedure for some given arithmetic problem, so I wanted to instance a couple of functions to Show so that I can print the same expression I evaluate when I test. The trouble is that the given code matches (-) to the first line when it should fall to the second. {-# OPTIONS_GHC -XFlexibleInstances #-} instance Show (t -> t-> t) where show (+) = "plus" show (-) = "minus" main = print [(+),(-)] returns [plus,plus] Am I just committing a motal sin printing functions in the first place or is there some way I can get it to match properly? edit:I realise I am getting the following warning: Warning: Pattern match(es) are overlapped In the definition of `show': show - = ... I still don't know why it overlaps, or how to stop it.

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • Pattern Matching of Units of Measure in F#

    - by Oldrich Svec
    This function: let convert (v: float<_>) = match v with | :? float<m> -> v / 0.1<m> | :? float<m/s> -> v / 0.2<m/s> | _ -> failwith "unknown" produces an error The type 'float<'u>' does not have any proper subtypes and cannot be used as the source of a type test or runtime coercion. Is there any way how to pattern match units of measure?

    Read the article

  • Pattern matching against Scala Map type

    - by Tom Morris
    Imagine I have a Map[String, String] in Scala. I want to match against the full set of key–value pairings in the map. Something like this ought to be possible val record = Map("amenity" -> "restaurant", "cuisine" -> "chinese", "name" -> "Golden Palace") record match { case Map("amenity" -> "restaurant", "cuisine" -> "chinese") => "a Chinese restaurant" case Map("amenity" -> "restaurant", "cuisine" -> "italian") => "an Italian restaurant" case Map("amenity" -> "restaurant") => "some other restaurant" case _ => "something else entirely" } The compiler complains thulsy: error: value Map is not a case class constructor, nor does it have an unapply/unapplySeq method What currently is the best way to pattern match for key–value combinations in a Map?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to do this Python / MySQL manipulation (match) more efficiently?

    - by NJTechie
    Following is my data : Company Table : ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Plains NY 07654 7376578901 6 AB 1 W.House SField PA 87656 7329878901 Branch Office Table : ID Address City State Zip Phone 1 323 Alk St Philly PA 17542 7329832221 1 171 Joe St Newark NJ 08654 3 287 Foe St Brick NJ 07740 7321178901 3 700 Wall Ocean NJ 07764 7322278901 1 89 Blk St Surrey NY 07154 7376222901 File to be Matched (In MySQL): ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 AB 171 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 K 87 Ilk St Plains NY 07654 7376578901 Resulting File : ID Company Address City State Zip Phone appendedID 1 ABC 123 Oak St Philly PA 17542 7329878901 [Original record, field always empty] 1 ABC 171 Joe St Newark NJ 08654 1 [Company Table] 1 ABC 323 Alk St Philly PA 17542 7329832221 1 [Branch Office Table] 1 AB 1 W.House SField PA 87656 7329878901 6 [Partial firm and State, Zip match] 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 3 GHI 700 Wall Ocean NJ 07764 7322278901 3 3 GHI 287 Foe St Brick NJ 07740 7321178901 3 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Surrey NY 07654 7376578901 5 KLE 89 Blk St Surrey NY 07154 7376222901 5 Requirement : 1) I have to match each firm on the 'File to be Matched' to that of Company and Branch Office tables (MySQL). 2) If there are multiple exact/partial matches, then the ID from Company, Branch Office table is inserted as a new row in the resulting file. 3) Not all the firms will be matched perfectly, in that case I have to match on partial Company names (like 5/8th of the company name) and any of the address fields and insert them in the resulting file. Please help me out in the most efficient solution for this problem.

    Read the article

  • OOW content for Pattern Matching....

    - by KLaker
    If you missed my sessions at OpenWorld then don't worry - all the content we used for pattern matching (presentation and hands-on lab) is now available for download. My presentation "SQL: The Best Development Language for Big Data?" is available for download from the OOW Content Catalog, see here: https://oracleus.activeevents.com/2013/connect/sessionDetail.ww?SESSION_ID=9101 For the hands-on lab ("Pattern Matching at the Speed of Thought with Oracle Database 12c") we used the Oracle-By-Example content. The OOW hands-on lab uses Oracle Database 12c Release 1 (12.1) and uses the MATCH_RECOGNIZE clause to perform some basic pattern matching examples in SQL. This lab is broken down into four main steps: Logically partition and order the data that is used in the MATCH_RECOGNIZE clause with its PARTITION BY and ORDER BY clauses. Define patterns of rows to seek using the PATTERN clause of the MATCH_RECOGNIZE clause. These patterns use regular expressions syntax, a powerful and expressive feature, applied to the pattern variables you define. Specify the logical conditions required to map a row to a row pattern variable in the DEFINE clause. Define measures, which are expressions usable in the MEASURES clause of the SQL query. You can download the setup files to build the ticker schema and the student notes from the Oracle Learning Library. The direct link to the example on using pattern matching is here: http://apex.oracle.com/pls/apex/f?p=44785:24:0::NO:24:P24_CONTENT_ID,P24_PREV_PAGE:6781,2.

    Read the article

  • CRM Webcast: Territory Setup and Manage Matching Attributes

    - by LuciaC
    Subject:  Territory Setup and Manage Matching Attributes Date: July 9, 2013 at 1pm ET, 12pm CT, 11am MT, 10am PT, 6pm, BST (London, GMT+01:00), 10:30 pm IST (Mumbai, GMT+05:30)Territories are used in a number of different EBS CRM applications, including Sales, Field Service and Service Contracts.  If you want to know more about how territories work and how to set them up, join our experts in this webcast.  The webcast will a demonstrate a high level setup for one of the Sales products and examples of how other applications use the Territory Manager. Topics will include: Enabling Matching Attributes Custom Matching Attributes Examples for Account, Leads, Quote, Proposals, Opportunities in the Sales product. Running Concurrent Requests Details & Registration: Doc ID 1544622.1

    Read the article

  • Effective and simple matching for 2 unequal small-scale point sets

    - by Pavlo Dyban
    I need to match two sets of 3D points, however the number of points in each set can be different. It seems that most algorithms are designed to align images and trimmed to work with hundreds of thousands of points. My case are 50 to 150 points in each of the two sets. So far I have acquainted myself with Iterative Closest Point and Procrustes Matching algorithms. Implementing Procrustes algorithms seems like a total overkill for this small quantity. ICP has many implementations, but I haven't found any readily implemented version accounting for the so-called "outliers" - points without a matching pair. Besides the implementation expense, algorithms like Fractional and Sparse ICP use some statistics information to cancel points that are considered outliers. For series with 50 to 150 points statistic measures are often biased or statistic significance criteria are not met. I know of Assignment Problem in linear optimization, but it is not suitable for cases with unequal sets of points. Are there other, small-scale algorithms that solve the problem of matching 2 point sets? I am looking for algorithm names, scientific papers or C++ implementations. I need some hints to know where to start my search.

    Read the article

  • Any software for pattern-matching and -rewriting source code?

    - by Steven A. Lowe
    I have some old software (in a language that's not dead but is dead to me ;-)) that implements a basic pattern-matching and -rewriting system for source code. I am considering resurrecting this code, translating it into a modern language, and open-sourcing the project as a refactoring power-tool. Before I go much further, I want to know if anything like this exists already (my google-fu is fanning air on this tonight). Here's how it works: the pattern-matching part matches source-code patterns spanning multiple lines of code using a template with binding variables, the pattern-rewriting part uses a template to rewrite the matched code, inserting the contents of the bound variables from the matching template matching and rewriting templates are associated (1:1) by a simple (unconditional) rewrite rule the software operates on the abstract syntax tree (AST) of the input application, and outputs a modified AST which can then be regenerated into new source code for example, suppose we find a bunch of while-loops that really should be for-loops. The following template will match the while-loop pattern: Template oldLoopPtrn int @cnt@ = 0; while (@cnt@ < @max@) { … @body@ ++@cnt@; } End_Template while the following template will specify the output rewrite pattern: Template newLoopPtrn for(int @cnt@ = 0; @cnt@ < @max@; @cnt@++) { @body@ } End_Template and a simple rule to associate them Rule oldLoopPtrn --> newLoopPtrn so code that looks like this int i=0; while(i<arrlen) { printf("element %d: %f\n",i,arr[i]); ++i; } gets automatically rewritten to look like this for(int i = 0; i < arrlen; i++) { printf("element %d: %f\n",i,arr[i]); } The closest thing I've seen like this is some of the code-refactoring tools, but they seem to be geared towards interactive rewriting of selected snippets, not wholesale automated changes. I believe that this kind of tool could supercharge refactoring, and would work on multiple languages (even HTML/CSS). I also believe that converting and polishing the code base would be a huge project that I simply cannot do alone in any reasonable amount of time. So, anything like this out there already? If not, any obvious features (besides rewrite-rule conditions) to consider? EDIT: The one feature of this system that I like very much is that the template patterns are fairly obvious and easy to read because they're written in the same language as the target source code, not in some esoteric mutated regex/BNF format.

    Read the article

  • How does pattern matching work behind the scenes in F#?

    - by kryptic
    Hello Everyone, I am completely new to F# (and functional programming in general) but I see pattern matching used everywhere in sample code. I am wondering for example how pattern matching actually works? For example, I imagine it working the same as a for loop in other languages and checking for matches on each item in a collection. This is probably far from correct, how does it actually work behind the scenes?

    Read the article

  • Improving performance of fuzzy string matching against a dictionary [closed]

    - by Nathan Harmston
    Hi, So I'm currently working for with using SecondString for fuzzy string matching, where I have a large dictionary to compare to (with each entry in the dictionary has an associated non-unique identifier). I am currently using a hashMap to store this dictionary. When I want to do fuzzy string matching, I first check to see if the string is in the hashMap and then I iterate through all of the other potential keys, calculating the string similarity and storing the k,v pair/s with the highest similarity. Depending on which dictionary I am using this can take a long time ( 12330 - 1800035 entries ). Is there any way to speed this up or make it faster? I am currently writing a memoization function/table as a way of speeding this up, but can anyone else think of a better way to improve the speed of this? Maybe a different structure or something else I'm missing. Many thanks in advance, Nathan

    Read the article

  • Excel 2013: VLookup for cells that share common characters within cell but are both surrounded by other non-matching text

    - by Kylie Z
    I am pulling information from 2 different databases. The databases use different naming protocol for the exact same item/specified placement however they always have certain components of the name in common. The length of these names can vary throughout each of the databases (see the pic below) so I don't think counting characters would help. I need a formula (probably a vlookup/match/index of some sort) to pair up the names from the 2nd database name with the 1st database name and then place it in the adjacent column(B2) on sheet1. Until this point I've had to match, copy, and paste the pairs manually from one sheet to the other and it takes FOREVER. Any help would be much appreciated!!! For example: Database1 Name in Sheet1,A2: 728x90_Allstate_629930_ALL_JUL_2013_MASSACHUSETTSAUTO_BAN_MSN_ROSMSNAUTOSMASSACHUSETTS_7.2.13 Database2 Name in Sheet2, A13: BAN_MSN_ROSMSNAUTOSMASSACHUSETTS728X90_728X90_DFA Common Factors: "ROSMSNAUTOSMASSACHUSETTS" & "728X90" Therefore A2 and A13 need to pair up In some cases, Database 1 and 2 will have a common name aspect but sizing will be different. They need to have BOTH aspects in common in order to be paired so I would NOT want the below example to pair up. Database1 Name in Sheet1,A2: 728x90_Allstate_629930_ALL_JUL_2013_MASSACHUSETTSAUTO_BAN_MSN_ROSMSNAUTOSMASSACHUSETTS_7.2.13 Database2 Name in Sheet2, A12: BAN_MSN_ROSMSNAUTOSMASSACHUSETTS300X250_300X250_DFA Common Factor: Only "ROSMSNAUTOSMASSACHUSETTS" matches. "728x90" is not equal to "300X250" - Sizing is different so they should not be paired.

    Read the article

  • Data structure for pattern matching.

    - by alvonellos
    Let's say you have an input file with many entries like these: date, ticker, open, high, low, close, <and some other values> And you want to execute a pattern matching routine on the entries(rows) in that file, using a candlestick pattern, for example. (See, Doji) And that pattern can appear on any uniform time interval (let t = 1s, 5s, 10s, 1d, 7d, 2w, 2y, and so on...). Say a pattern matching routine can take an arbitrary number of rows to perform an analysis and contain an arbitrary number of subpatterns. In other words, some patterns may require 4 entries to operate on. Say also that the routine (may) later have to find and classify extrema (local and global maxima and minima as well as inflection points) for the ticker over a closed interval, for example, you could say that a cubic function (x^3) has the extrema on the interval [-1, 1]. (See link) What would be the most natural choice in terms of a data structure? What about an interface that conforms a Ticker object containing one row of data to a collection of Ticker so that an arbitrary pattern can be applied to the data. What's the first thing that comes to mind? I chose a doubly-linked circular linked list that has the following methods: push_front() push_back() pop_front() pop_back() [] //overloaded, can be used with negative parameters But that data structure seems very clumsy, since so much pushing and popping is going on, I have to make a deep copy of the data structure before running an analysis on it. So, I don't know if I made my question very clear -- but the main points are: What kind of data structures should be considered when analyzing sequential data points to conform to a pattern that does NOT require random access? What kind of data structures should be considered when classifying extrema of a set of data points?

    Read the article

  • List of events triggered on pages matching regex

    - by Cubius
    Is there a way to get the grouped list of events (such as in Top events) which were triggered on pages matching a regular expression? I may add the Page secondary dimension in Top events and apply the regex filter but this way I won't get a grouped list. I may apply the filter to Events - Pages report but this way the events will be grouped only inside pages whilst I need global grouping. Any suggestions?

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >