Search Results

Search found 82 results on 4 pages for 'substrings'.

Page 3/4 | < Previous Page | 1 2 3 4  | Next Page >

• Converting delimited string to multiple values in mysql

  - by epo

  I have a mysql legacy table which contains an client identifier and a list of items, the latter as a comma-delimited string. E.g. "xyz001", "foo,bar,baz". This is legacy stuff and the user insists on being able to edit a comma delimited string. They now have a requirement for a report table with the above broken into separate rows, e.g. "xyz001", "foo" "xyz001", "bar" "xyz001", "baz" Breaking the string into substrings is easily doable and I have written a procedure to do this by creating a separate table, but that requires triggers to deal with deletes, updates and inserts. This query is required rarely (say once a month) but has to be absolutely up to date when it is run, so e.g. the overhead of triggers is not warranted and scheduled tasks to create the table might not be timely enough. Is there any way to write a function to return a table or a set so that I can join the identifier with the individual items on demand?

  Read the article

• immutable strings vs std::string

  - by Caspin

  I've recent been reading about immutable strings, here and here as well some stuff about why D chose immutable strings. There seem to be many advantages. trivially thread safe more secure more memory efficient in most use cases. cheap substrings (tokenizing and slicing) Not to mention most new languages have immutable strings, D2.0, Java, C#, Python, Ruby, etc. Would C++ benefit from immutable strings? Is it possible to implement an immutable string class in c++ (or c++0x) that would have all of these advantages?

  Read the article

• named_scope and substings

  - by Philb28

  I have a named_scope in rails that finds episodes by there directors given name named_scope :director_given, lambda { |dr| {:joins => :director, :conditions => ['given = ?', dr]} } It works great but I would like it to also work on substrings one the name. e.g. instead of having to search for 'Lucy' you could just search 'Lu'. P.S. I also have another named scope which does exactly the same thing but on the directors last name. It there a way to combine the two? Thanks,

  Read the article

• Attributed strings in UITableViewCells without WebView?

  - by arnekolja

  Hello, does anyone know if there's a way in with 3.0+ to display attributed strings within a UITableViewCell without using a UIWebView for that? I need to display a string with linked, tappable substrings as the typical detailTextLabel. I wouldn't mind exchanging this UILabel against another type of view, but I think a UIWebView could be just too slow when rendering a table with hundrets of cells. Or does someone have opposite experiences here? So my question is: what's the best way to achieve mixed strings in a very large table without a great performance hit? I searched for this almost a whole day now, but I can only find old posts mentioning that there's no attributed string on the iPhone (outdated, as this was pre-3.0) and/or saying that they use a UIWebView for that. But really, I don't think this would perform very well on large tables, would it? Many, many thanks in advance Arne

  Read the article

• Longest substring that appears n times

  - by xcoders

  For a string of length L, I want to find the longest substring that appears n (n<L) or more times in ths string. For example, the longest substring that occurs 2 or more times in "BANANA" is "ANA", once starting from index 1, and once again starting from index 3. The substrings are allowed to overlap. In the string "FFFFFF", the longest string that appears 3 or more times is "FFFF". The brute force algorithm for n=2 would be selecting all pairs of indexes in the string, then running along until the characters are different. The running-along part takes O(L) and the number of pairs is O(L^2) (duplicates are not allowed but I'm ignoring that) so the complexity of this algorithm for n=2 would be O(L^3). For greater values of n, this grows exponentially. Is there a more efficient algorithm for this problem?

  Read the article

• C++ String manipulation isn't making sense to me...

  - by Andrew Bolster

  I am trying some of the Stanford SEE courses online to learn some new languages; this particular assignment has to do with removing substrings from strings. What I've got so far is below, but if text = "hello hello" and remove ="el", it gets stuck in a loop, but if i change text to text = "hello hllo", it works, making me think I'm doing something obviously stupid. There is a stipulation in the assignment not to modify the incoming strings, and instead to return a new string. string CensorString1(string text, string remove){ string returned; size_t found=0, lastfound=0; found = (text.substr(lastfound,text.size())).find(remove); while (string::npos != found ){ returned += text.substr(lastfound,found); lastfound = found + remove.size(); found = (text.substr(lastfound,text.size())).find(remove); } returned += text.substr(lastfound,found); return returned; } Guidance would be appreciated :-) Thanks

  Read the article

• How can I construct and parse a JSON string in Scala / Lift

  - by David Carlson

  I am using JsonResponse to send some JSON to the client. To test that I am sending the correct response it seemed natural to me to parse the resulting JSON and validate against a data structure rather than comparing substrings. But for some reason I am unable to parse the JSON I just constructed: def tryToParse = { val jsObj :JsObj = JsObj(("foo", "bar")); // 1) val jsObjStr :String = jsObj.toJsCmd // 2) jsObjStr is: "{'foo': 'bar'}" val result = JSON.parseFull(jsObjStr) // 3) result is: None // the problem seems to be caused by the quotes: val works = JSON.parseFull("{\"foo\" : \"bar\"}") // 4) result is: Some(Map(foo -> bar)) val doesntWork = JSON.parseFull("{'foo' : 'bar'}") // 5) result is: None } How do I programmatically construct a valid JSON message in Scala/Lift that can also be parsed again?

  Read the article

• How to find longest common substring using trees?

  - by user384706

  The longest common substring problem according to wiki can be solved using a suffix tree. From wiki: The longest common substrings of a set of strings can be found by building a generalised suffix tree for the strings, and then finding the deepest internal nodes which have leaf nodes from all the strings in the subtree below it I don't get this. Example: if I have: ABCDE and XABCZ then the suffix tree is (some branches from XABCZ omitted due to space): The longest common substring is ABC but it is not I can not see how the description of wiki helps here. ABC is not the deepest internal nodes with leaf nodes. Any help to understand how this works?

  Read the article

• Finding if all elements in a vector<string> are in a string

  - by devin

  I have a vector and I need to see if all the strings in that vector are substrings of another given string. eg vector<string> v; v.push_back("str1"); v.push_back("str2"); string s1 = "str1, str2, str3"; string s2 = "str1, str3"; Is there a way to get true from s1 and false from s2 without looping over the vector? Also, note that due to my environment, I can't use boost. I think if I had boost, I could do this.

  Read the article

• Invisible Delimiter for Strings in HTML

  - by noah

  I need a way to identify certain strings in HTML markup. I know what the strings are, but it is possible that they could be substrings of other strings in the document. To find them, I output a special delimiter character (currently using \032). On page load, we go through the HTML and record the location of the strings, and remove the delimiter. Unfortunately, most browsers show the delimiter character until we can find and remove them all. I'd like to avoid that if possible. Is there a character or string that will be preserved in the HTML content (so a comment wont work) but wont be visible to the user? It also needs to be something that is fairly unlikely to appear next to a string, so something like &nbsp; wouldn't work either. EDIT: Sorry, I forgot to mention that the strings will be in attributes, so any sort of tag wont work.

  Read the article

• Converting delimited string to multiple values in mysql

  - by epo

  I have a mysql legacy table which contains an client identifier and a list of items, the latter as a comma-delimited string. E.g. "xyz001", "foo,bar,baz". This is legacy stuff and the user insists on being able to edit a comma delimited string. They now have a requirement for a report table with the above broken into separate rows, e.g. "xyz001", "foo" "xyz001", "bar" "xyz001", "baz" Breaking the string into substrings is easily doable and I have written a procedure to do this by creating a separate table, but that requires triggers to deal with deletes, updates and inserts. This query is required rarely (say once a month) but has to be absolutely up to date when it is run, so e.g. the overhead of triggers is not warranted and scheduled tasks to create the table might not be timely enough. Is there any way to write a function to return a table or a set so that I can join the identifier with the individual items on demand?

  Read the article

• Finding if a string is an iterative substring?

  - by EsotericMe

  I have a string S. How can I find if the string follows S = nT. Examples: Function should return true if 1) S = "abab" 2) S = "abcdabcd" 3) S = "abcabcabc" 4) S = "zzxzzxzzx" But if S="abcb" returns false. I though maybe we can repeatedly call KMP on substrings of S and then decide. eg: for "abab": call on KMP on "a". it returns 2(two instances). now 2*len("a")!=len(s) call on KMP on "ab". it returns 2. now 2*len("ab")==len(s) so return true Can you suggest any better algorithms?

  Read the article

• Is it possible to use a back reference to specify the number of replications in a regular expression

  - by user307894

  Is it possible to use a back reference to specify the number of replications in a regular expression? foo= 'ADCKAL+2AG.+2AG.+2AG.+2AGGG+.+G+3AGGa4.' The substrings that start with '+[0-9]' followed by '[A-z]{n}.' need to be replaced with simply '+' where the variable n is the digit from earlier in the substring. Can that n be back referenced? For example (doesn't work) '+([0-9])[A-z]{/1}.' is the pattern I want replaced with "+" (that last dot can be any character and represents a quality score) so that foo should come out to ADCKAL++++G.G+. foo = 'ADCKAL+2AG.+2AG.+2AG.+2AGGG^+.+G+3AGGa4.' indelpatt = re.compile('\+([0-9])') while indelpatt.search(foo): indelsize=int(indelpatt.search(foo).group(1)) new_regex = '\+%s[ACGTNacgtn]{%s}.' % (indelsize,indelsize) newpatt=re.compile(new_regex) foo = newpatt.sub("+", foo) I'm probably missing an easier way to parse the string.

  Read the article

• Trimming strings in Go

  - by user1263980

  I'm trying to read an entire line from the console (including whitespace), then process it. Using bufio.ReadString, the newline character is read together with the input, so I came up with the following code to trim the newline character: input,_:=src.ReadString('\n') inputFmt:=input[0:len(input)-2]+"" Is there a more idiomatic way to do this? That is, is there already a library that takes care of the ending null byte when extracting substrings for you? (Yes, I know there is already a way to read a line without the newline character in go readline -> string but I'm looking more for elegant string manipulation.)

  Read the article

• String manipulation appears to be inefficient

  - by user2964780

  I think my code is too inefficient. I'm guessing it has something to do with using strings, though I'm unsure. Here is the code: genome = FASTAdata[1] genomeLength = len(genome); # Hash table holding all the k-mers we will come across kmers = dict() # We go through all the possible k-mers by index for outer in range (0, genomeLength-1): for inner in range (outer+2, outer+22): substring = genome[outer:inner] if substring in kmers: # if we already have this substring on record, increase its value (count of num of appearances) by 1 kmers[substring] += 1 else: kmers[substring] = 1 # otherwise record that it's here once This is to search through all substrings of length at most 20. Now this code seems to take pretty forever and never terminate, so something has to be wrong here. Is using [:] on strings causing the huge overhead? And if so, what can I replace it with? And for clarity the file in question is nearly 200mb, so pretty big.

  Read the article

• SQL Server - Multi-Column substring matching

  - by hamlin11

  One of my clients is hooked on multi-column substring matching. I understand that Contains and FreeText search for words (and at least in the case of Contains, word prefixes). However, based upon my understanding of this MSDN book, neither of these nor their variants are capable of searching substrings. I have used LIKE rather extensively (Select * from A where A.B Like '%substr%') Sample table A: ID | Col1 | Col2 | Col3 | ------------------------------------- 1 | oklahoma | colorado | Utah | 2 | arkansas | colorado | oklahoma | 3 | florida | michigan | florida | ------------------------------------- The following code will give us row 1 and row 2: select * from A where Col1 like '%klah%' or Col2 like '%klah%' or Col3 like '%klah%' This is rather ugly, probably slow, and I just don't like it very much. Probably because the implementations that I'm dealing with have 10+ columns that need searched. The following may be a slight improvement as code readability goes, but as far as performance, we're still in the same ball park. select * from A where (Col1 + ' ' + Col2 + ' ' + Col3) like '%klah%' I have thought about simply adding insert, update, and delete triggers that simply add the concatenated version of the above columns into a separate table that shadows this table. Sample Shadow_Table: ID | searchtext | --------------------------------- 1 | oklahoma colorado Utah | 2 | arkansas colorado oklahoma | 3 | florida michigan florida | --------------------------------- This would allow us to perform the following query to search for '%klah%' select * from Shadow_Table where searchtext like '%klah%' I really don't like having to remember that this shadow table exists and that I'm supposed to use it when I am performing multi-column substring matching, but it probably yields pretty quick reads at the expense of write and storage space. My gut feeling tells me there there is an existing solution built into SQL Server 2008. However, I don't seem to be able to find anything other than research papers on the subject. Any help would be appreciated.

  Read the article

• text-area-text-to-be-split-with-conditions repeated

  - by desmiserables

  I have a text area wherein i have limited the user from entering more that 15 characters in one line as I want to get the free flow text separated into substrings of max limit 15 characters and assign each line an order number. This is what I was doing in my java class: int interval = 15; items = new ArrayList(); TextItem item = null; for (int i = 0; i < text.length(); i = i + interval) { item = new TextItem (); item.setOrder(i); if (i + interval < text.length()) { item.setSubText(text.substring(i, i + interval)); items.add(item); } else { item.setSubText(text.substring(i)); items.add(item); } } Now it works properly unless the user presses the enter key. Whenever the user presses the enter key I want to make that line as a new item having only that part as the subText. I can check whether my text.substring(i, i + interval) contains any "\n" and split till there but the problem is to get the remaining characters after "\n" till next 15 or till next "\n" and set proper order and subText.

  Read the article

• What's a good way of building up a String where you specific start and end locations?

  - by Michael Campbell

  (java 1.5) I have a need to build up a String, in pieces. I'm given a set of (sub)strings, each with a start and end point of where they belong in the final string. Was wondering if there were some canonical way of doing this. This isn't homework, and I can use any licensable OSS, such as jakarta commons-lang StringUtils etc. My company has a solution using a CharBuffer, and I'm content to leave it as is (and add some unit tests, of which there are none (?!)) but the code is fairly hideous and I would like something easier to read. As I said this isn't homework, and I don't need a complete solution, just some pointers to libraries or java classes that might give me some insight. The String.Format didn't seem QUITE right... I would have to honor inputs too long and too short, etc. Substrings would be overlaid in the order they appear (in case of overlap). As an example of input, I might have something like: String:start:end FO:0:3 (string shorter than field) BAR:4:5 (String larger than field) BLEH:5:9 (String overlays previous field) I'd want to end up with FO BBLEH 01234567890

  Read the article

• What's a good way of building up a String given specific start and end locations?

  - by Michael Campbell

  (java 1.5) I have a need to build up a String, in pieces. I'm given a set of (sub)strings, each with a start and end point of where they belong in the final string. Was wondering if there were some canonical way of doing this. This isn't homework, and I can use any licensable OSS, such as jakarta commons-lang StringUtils etc. My company has a solution using a CharBuffer, and I'm content to leave it as is (and add some unit tests, of which there are none (?!)) but the code is fairly hideous and I would like something easier to read. As I said this isn't homework, and I don't need a complete solution, just some pointers to libraries or java classes that might give me some insight. The String.Format didn't seem QUITE right... I would have to honor inputs too long and too short, etc. Substrings would be overlaid in the order they appear (in case of overlap). As an example of input, I might have something like: String:start:end FO:0:3 (string shorter than field) BAR:4:5 (String larger than field) BLEH:5:9 (String overlays previous field) I'd want to end up with FO BBLEH 01234567890

  Read the article

• java Getting a list of words from a Trie

  - by adam08

  I'm looking to use the following code to not check whether there is a word matching in the Trie but to return a list all words beginning with the prefix inputted by the user. Can someone point me in the right direction? I can't get it working at all..... public boolean search(String s) { Node current = root; System.out.println("\nSearching for string: "+s); while(current != null) { for(int i=0;i<s.length();i++) { if(current.child[(int)(s.charAt(i)-'a')] == null) { System.out.println("Cannot find string: "+s); return false; } else { current = current.child[(int)(s.charAt(i)-'a')]; System.out.println("Found character: "+ current.content); } } // If we are here, the string exists. // But to ensure unwanted substrings are not found: if (current.marker == true) { System.out.println("Found string: "+s); return true; } else { System.out.println("Cannot find string: "+s +"(only present as a substring)"); return false; } } return false; } }

  Read the article

• Algorithm detect repeating/similiar strings in a corpus of data -- say email subjects, in Python

  - by RizwanK

  I'm downloading a long list of my email subject lines , with the intent of finding email lists that I was a member of years ago, and would want to purge them from my Gmail account (which is getting pretty slow.) I'm specifically thinking of newsletters that often come from the same address, and repeat the product/service/group's name in the subject. I'm aware that I could search/sort by the common occurrence of items from a particular email address (and I intend to), but I'd like to correlate that data with repeating subject lines.... Now, many subject lines would fail a string match, but "Google Friends : Our latest news" "Google Friends : What we're doing today" are more similar to each other than a random subject line, as is: "Virgin Airlines has a great sale today" "Take a flight with Virgin Airlines" So -- how can I start to automagically extract trends/examples of strings that may be more similar. Approaches I've considered and discarded ('because there must be some better way'): Extracting all the possible substrings and ordering them by how often they show up, and manually selecting relevant ones Stripping off the first word or two and then count the occurrence of each sub string Comparing Levenshtein distance between entries Some sort of string similarity index ... Most of these were rejected for massive inefficiency or likelyhood of a vast amount of manual intervention required. I guess I need some sort of fuzzy string matching..? In the end, I can think of kludgy ways of doing this, but I'm looking for something more generic so I've added to my set of tools rather than special casing for this data set. After this, I'd be matching the occurring of particular subject strings with 'From' addresses - I'm not sure if there's a good way of building a data structure that represents how likely/not two messages are part of the 'same email list' or by filtering all my email subjects/from addresses into pools of likely 'related' emails and not -- but that's a problem to solve after this one. Any guidance would be appreciated.

  Read the article

• Creating a Function in SQL Server with a Phone Number as a parameter and returns a Random Number

  - by Emer

  Hi Guys, I am hoping someone can help me here as google is not being as forthcoming as I would have liked. I am relatively new to SQL Server and so this is the first function I have set myself to do. The outline of the function is that it has a Phone number varchar(15) as a parameter, it checks that this number is a proper number, i.e. it is 8 digits long and contains only numbers. The main character I am trying to avoid is '+'. Good Number = 12345678 Bad Number = +12345678. Once the number is checked I would like to produce a random number for each phone number that is passed in. I have looked at substrings, the like operator, Rand(), left(), Right() in order to search through the number and then produce a random number. I understand that Rand() will produce the same random number unless alterations are done to it but right now it is about actually getting some working code. Any hints on this would be great or even point me towards some more documentation. I have read books online and they haven't helped me, maybe I am not looking in the right places. Here is a snippet of code I was working on the Rand declare @Phone Varchar (15) declare @Counter Varchar (1) declare @NewNumber Varchar(15) set @Phone = '12345678' set @Counter = len(@Phone) while @Counter > 0 begin select case when @Phone like '%[0-9]%' then cast(rand()*100000000 as int) else 'Bad Number' end set @counter = @counter - 1 end return Thanks for the help in advance Emer

  Read the article

• MS SQL - Multi-Column substring matching

  - by hamlin11

  One of my clients is hooked on multi-column substring matching. I understand that Contains and FreeText search for words (and at least in the case of Contains, word prefixes). However, based upon my understanding of this MSDN book, neither of these nor their variants are capable of searching substrings. I have used LIKE rather extensively (Select * from A where A.B Like '%substr%') Sample table A: ID | Col1 | Col2 | Col3 | ------------------------------------- 1 | oklahoma | colorado | Utah | 2 | arkansas | colorado | oklahoma | 3 | florida | michigan | florida | ------------------------------------- The following code will give us row 1 and row 2: select * from A where Col1 like '%klah%' or Col2 like '%klah%' or Col3 like '%klah%' This is rather ugly, probably slow, and I just don't like it very much. Probably because the implementations that I'm dealing with have 10+ columns that need searched. The following may be a slight improvement as code readability goes, but as far as performance, we're still in the same ball park. select * from A where (Col1 + ' ' + Col2 + ' ' + Col3) like '%klah%' I have thought about simply adding insert, update, and delete triggers that simply add the concatenated version of the above columns into a separate table that shadows this table. Sample Shadow_Table: ID | searchtext | --------------------------------- 1 | oklahoma colorado Utah | 2 | arkansas colorado oklahoma | 3 | florida michigan florida | --------------------------------- This would allow us to perform the following query to search for '%klah%' select * from Shadow_Table where searchtext like '%klah%' I really don't like having to remember that this shadow table exists and that I'm supposed to use it when I am performing multi-column substring matching, but it probably yields pretty quick reads at the expense of write and storage space. My gut feeling tells me there there is an existing solution built into SQL Server 2008. However, I don't seem to be able to find anything other than research papers on the subject. Any help would be appreciated.

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• getting string.substring(N) not to choke when N > string.length

  - by aape

  I'm writing some code that takes a report from the mainframe and converts it to a spreadsheet. They can't edit the code on the MF to give me a delimited file, so I'm stuck dealing with it as fixed width. It's working okay now, but I need to get it more stable before I release it for testing. My problem is that in any given line of data, say it could have three columns of numbers, each five chars wide at positions 10, 16, and 22. If on this one particular row, there's no data for the last two cols, it won't be padded with spaces; rather, the length of the string will be only 14. So, I can't just blindly have dim s as string = someStream.readline a = s.substring(10, 5) b = s.substring(16, 5) c = s.substring(22, 5) because it'll choke when it substrings past the length of the string. I know I could test the length of the string before processing each row, and I have automated the filling of some of the vsariables using a counter and a loop, and using the counter*theWidthOfTheGivenVariable to jump around, but this project was a dog to start with (come on! turning a report into a spreadsheet?), but there are many different types of rows (it's not just a grid), and the code's getting ugly fast. I'd like this to be clean, clear, and maintainable for the poor sucker that gets this after me. If it matters, here's my code so far (it's really crufty at the moment). You can see some of my/its idiocy in the processSection#data subs So, I'm wondering 1) is there a way baked in to .NET to have string.substring not error when reading past the end of a string without wrapping it in a try...catch? and 2) would it be appropriate in this situation to write a new string class that inherits from string that has a more friendly substring function in it? ETA: Thanks for all the advice and knowledge everyone. I'll go with the extension. Hopefully one of these years, I'll get my chops up enough to pay someone back in kind. :)

  Read the article

< Previous Page | 1 2 3 4  | Next Page >