Search Results

Search found 3150 results on 126 pages for 'administrator'.

Page 30/126 | < Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >

  • Deal Registration Moves to Oracle Partner Store (OPS)- The Four Action Items for Partners

    - by Richard Lefebvre
    In November 2012, Oracle’s partner deal registration process will move to the Oracle Partner Store (OPS). During this time, OPS will become the single source for partners to register deals, obtain deal status, and place orders. What will partners need to do? 1. Request an OPS Account – If your company is new to OPS the first thing you need to do is request an account (if your company already has an OPS account, go to step 2). It’s important to have the person who will be managing your OPS account make this request as soon as possible. They will be set up as your company’s primary administrator. 2. Set-Up Users in OPS – Setup of users can start immediately, and will be handled by the primary OPS administrator at your company. The process is simple, but all existing users of Global PRM (Partner Relationship Management) deal registration will need to be set up in OPS before November 14, 2012.  3. Review/Action Any Registrations Pending Submission in PRM – Prior to November 14, 2012, all pending registrations should be submitted in the existing PRM system. It is important that this step is complete so registrations will not need to be re-entered when the system is moved to OPS on November 17, 2012. Registrations pending submission are easily identified on the registration listing screen with either “Incomplete” or “Returned to Partner” in the status column.  4. Attend Training – Oracle will offer multiple VAD and VAR training sessions beginning October 29, 2012. It is recommended that all users attend one of these important sessions.  Detailed instructions on each of these tasks can be found on the OPS Information Page. OPS will offer several enhancements to the deal registration process, including: Simplified Registration Form Easier Product Selection Expanded Browser Support Shared Registration Visibility Between VAD and VAR Pre-set Customer Selection From Partner Ordering Base Best Regards, Titina Ott Vice President, Worldwide A&C Systems And Business Processes 

    Read the article

  • Can I set up samba so it automatically allows all the local usernames and passwords?

    - by dialer
    I have set up samba like this (this is the complete smb.conf): [global] log file = /var/log/samba/log log level = 2 security = user [homes] browsable = false read only = no valid users = %S I'd like to enable every user on server to access their home directories, but for some unknown reason only my 'administrator' account can do so. (I have done that with ftp before, but now smb is also needed). When I try to smbclient -L localhost -U [user], I get NT_STATUS_LOGON_FAILURE, except with the administrator (which is the user created during the ubuntu installation, not root). The samba log file says NT_STATUS_NO_SUCH_USER: [2012/04/04 20:26:02.081454, 2] smbd/reply.c:554(reply_special) netbios connect: name1=LOCALHOST 0x20 name2=DIALER-X 0x0 [2012/04/04 20:26:02.081733, 2] smbd/reply.c:565(reply_special) netbios connect: local=localhost remote=dialer-x, name type = 0 [2012/04/04 20:26:02.087200, 2] auth/auth.c:314(check_ntlm_password) check_ntlm_password: Authentication for user [public] - [public] FAILED with error NT_STATUS_NO_SUCH_USER I suspect that I have to manually create samba users, but the man pages state that If the client has passed a username/password pair and that username/password pair is validated by the UNIX system's password programs, the connection is made as that username. To me that sounds like as long as the provided username/password is a valid login on the server, it should work. Am I missing something totally obvious? I don't want / can't afford to manually update the samba users and passwords to match the server's. 11.10

    Read the article

  • Dynamically switching the theme in Orchard

    - by Bertrand Le Roy
    It may sound a little puzzling at first, but in Orchard CMS, more than one theme can be active at any given time. The reason for that is that we have an extensibility point that allows a module (or a theme) to participate in the choice of the theme to use, for each request. The motivation for building the theme engine this way was to enable developers to switch themes based on arbitrary criteria, such as user preferences or the user agent (if you want to serve a mobile theme for phones for example). The choice is made between the active themes, which is why there is a difference between the default theme and the active themes. In order to have a say in the choice of the theme, all you have to do is implement IThemeSelector. That interface is quite simple as it only has one method, GetTheme, that takes the current RequestContext and returns a ThemeSelectorResult or null if the implementation of the interface does not want to participate in the current request (we'll see an example in a moment). ThemeSelectorResult itself is just a ThemeName string property and an integer Priority. We're using a priority so that an arbitrary number of implementations of IThemeSelector can contribute to the choice of a theme. If you look for existing implementations of the interface in Orchard, you'll find four: AdminThemeSelector: selects the TheAdmin theme with a very high priority (100) if the current request is for a page that is part of the admin. Otherwise, null is returned, which enables other implementations to choose the theme. PreviewThemeSelector: selects the preview theme if there is one, with a high priority (90), and null otherwise. This enables administrators to view the site under a different theme while everybody else continues to see the current default theme. SiteThemeSelector: this is the implementation that is doing what you expect most of the time, which is to get the current theme from site settings and set it with a priority of –5. SafeModeThemeSelector: this is the fallback implementation, which should almost never win. It sets the theme as the safe mode theme, which has no style and just uses the default templates for everything. The priority is very low (-100). While this extensibility mechanism is great to have, I wanted to bring that level of choice into the hands of the site administrator rather than just developers. In order to achieve that, I built the Vandelay Theme Picker module. The module provides administration UI to create rules for theme selection. It provides its own extensibility point (the IThemeSelectionRule interface) and one implementation of a rule: UserAgentThemeSelectorRule. This rule gets the current user agent from the context and tries to match it with a regular expression that the administrator can configure in the admin UI. You can for example configure a rule with a regular expression that matches IE6 and serve a different subtheme where the stylesheet has been tweaked for such an antique browser. Another possible configuration is to detect mobile devices from their agent string and serve the mobile theme. All those operations can be done with this module entirely from the admin UI, without writing a line of code. The module also offers the administrator the opportunity to inject a link into the front-end in a specific zone and with a specific position that enables the user to switch to the default theme if he wishes to. This is especially useful for sites that use a mobile theme but still want to allow users to use the full desktop site. While the module is nice and flexible, it may be overkill. On my own personal blog, I have only two active themes: the desktop theme and the mobile theme. I'm fine with going into code to change the criteria on which to switch the theme, so I'm not using my own Theme Picker module. Instead, I made the mobile theme a theme with code (in other words there is a csproj file in the theme). The project includes a single C# file, my MobileThemeSelector for which the code is the following: public class MobileThemeSelector : IThemeSelector { private static readonly Regex _Msie678 = new Regex(@"^Mozilla\/4\.0 \(compatible; MSIE [678]" + @"\.0; Windows NT \d\.\d(.*)\)$", RegexOptions.IgnoreCase); private ThemeSelectorResult _requestCache; private bool _requestCached; public ThemeSelectorResult GetTheme(RequestContext context) { if (_requestCached) return _requestCache; _requestCached = true; var userAgent = context.HttpContext.Request.UserAgent; if (userAgent.IndexOf("phone", StringComparison.OrdinalIgnoreCase) != -1 || _Msie678.IsMatch(userAgent) || userAgent.IndexOf("windows live writer", StringComparison.OrdinalIgnoreCase) != -1) { _requestCache = new ThemeSelectorResult { Priority = 10, ThemeName = "VuLuMobile" }; } return _requestCache; } } .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } The theme selector selects the current theme for Internet Explorer versions 6 to 8, for phones, and for Windows Live Writer (so that the theme that is used when I write posts is as simple as possible). What's interesting here is that it's the theme that selects itself here, based on its own criteria. This should give you a good panorama of what's possible in terms of dynamic theme selection in Orchard. I hope you find some fun uses for it. As usual, I can't wait to see what you're going to come up with…

    Read the article

  • Using Transaction Logging to Recover Post-Archived Essbase data

    - by Keith Rosenthal
    Data recovery is typically performed by restoring data from an archive.  Data added or removed since the last archive took place can also be recovered by enabling transaction logging in Essbase.  Transaction logging works by writing transactions to a log store.  The information in the log store can then be recovered by replaying the log store entries in sequence since the last archive took place.  The following information is recorded within a transaction log entry: Sequence ID Username Start Time End Time Request Type A request type can be one of the following categories: Calculations, including the default calculation as well as both server and client side calculations Data loads, including data imports as well as data loaded using a load rule Data clears as well as outline resets Locking and sending data from SmartView and the Spreadsheet Add-In.  Changes from Planning web forms are also tracked since a lock and send operation occurs during this process. You can use the Display Transactions command in the EAS console or the query database MAXL command to view the transaction log entries. Enabling Transaction Logging Transaction logging can be enabled at the Essbase server, application or database level by adding the TRANSACTIONLOGLOCATION essbase.cfg setting.  The following is the TRANSACTIONLOGLOCATION syntax: TRANSACTIONLOGLOCATION [appname [dbname]] LOGLOCATION NATIVE ENABLE | DISABLE Note that you can have multiple TRANSACTIONLOGLOCATION entries in the essbase.cfg file.  For example: TRANSACTIONLOGLOCATION Hyperion/trlog NATIVE ENABLE TRANSACTIONLOGLOCATION Sample Hyperion/trlog NATIVE DISABLE The first statement will enable transaction logging for all Essbase applications, and the second statement will disable transaction logging for the Sample application.  As a result, transaction logging will be enabled for all applications except the Sample application. A location on a physical disk other than the disk where ARBORPATH or the disk files reside is recommended to optimize overall Essbase performance. Configuring Transaction Log Replay Although transaction log entries are stored based on the LOGLOCATION parameter of the TRANSACTIONLOGLOCATION essbase.cfg setting, copies of data load and rules files are stored in the ARBORPATH/app/appname/dbname/Replay directory to optimize the performance of replaying logged transactions.  The default is to archive client data loads, but this configuration setting can be used to archive server data loads (including SQL server data loads) or both client and server data loads. To change the type of data to be archived, add the TRANSACTIONLOGDATALOADARCHIVE configuration setting to the essbase.cfg file.  Note that you can have multiple TRANSACTIONLOGDATALOADARCHIVE entries in the essbase.cfg file to adjust settings for individual applications and databases. Replaying the Transaction Log and Transaction Log Security Considerations To replay the transactions, use either the Replay Transactions command in the EAS console or the alter database MAXL command using the replay transactions grammar.  Transactions can be replayed either after a specified log time or using a range of transaction sequence IDs. The default when replaying transactions is to use the security settings of the user who originally performed the transaction.  However, if that user no longer exists or that user's username was changed, the replay operation will fail. Instead of using the default security setting, add the REPLAYSECURITYOPTION essbase.cfg setting to use the security settings of the administrator who performs the replay operation.  REPLAYSECURITYOPTION 2 will explicitly use the security settings of the administrator performing the replay operation.  REPLAYSECURITYOPTION 3 will use the administrator security settings if the original user’s security settings cannot be used. Removing Transaction Logs and Archived Replay Data Load and Rules Files Transaction logs and archived replay data load and rules files are not automatically removed and are only removed manually.  Since these files can consume a considerable amount of space, the files should be removed on a periodic basis. The transaction logs should be removed one database at a time instead of all databases simultaneously.  The data load and rules files associated with the replayed transactions should be removed in chronological order from earliest to latest.  In addition, do not remove any data load and rules files with a timestamp later than the timestamp of the most recent archive file. Partitioned Database Considerations For partitioned databases, partition commands such as synchronization commands cannot be replayed.  When recovering data, the partition changes must be replayed manually and logged transactions must be replayed in the correct chronological order. If the partitioned database includes any @XREF commands in the calc script, the logged transactions must be selectively replayed in the correct chronological order between the source and target databases. References For additional information, please see the Oracle EPM System Backup and Recovery Guide.  For EPM 11.1.2.2, the link is http://docs.oracle.com/cd/E17236_01/epm.1112/epm_backup_recovery_1112200.pdf

    Read the article

  • EM CLI, diving in and beyond!

    - by Maureen Byrne
    v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Doing more in less time… Isn’t that what we all strive to do? With this in mind, I put together two screen watches on Oracle Enterprise Manager 12c command line interface, or EM CLI as it is also known. There is a wealth of information on any topic that you choose to read about, from manual pages to coding documents…might I even say blog posts? In our busy lives it is so nice to just sit back with a short video, watch and learn enough to dive in. Doing more in less time, is the essence of EM CLI. It enables you to script fundamental and complex administrative tasks in an elegant way, thanks to the Jython scripting language. Repetitive tasks can be scripted and reused again and again. Sure, a Graphical User Interface provides a more intuitive step by step approach to tasks, and it provides a way of quickly becoming familiar with a product and its many features, and it is definitely the way to go when viewing performance data and historical trending…but for repetitive and complex tasks, scripting is the way to go! Lets us take the everyday task of creating an administrator. Using EM CLI in interactive mode the command could look like this.. emcli>create_user(name='jan.doe', type='EXTERNAL_USER') This command creates an administrator called jan.doe which is an externally authenticated user, possibly LDAP or SSO, defined by the EXTERNAL_USER tag. The create_user procedure takes many arguments; see the documentation for more information. Now, where EM CLI really shines and shows power is in creating multiple users. Regardless of the number, tens or thousands, the effort is the same. With the use of a standard programming construct, a loop, you can place your create_user() procedure within it. Using a loop allows you to iterate through a previously created list, creating new users until the list is complete. Using EM CLI in Script mode, your Jython loop would look something like this… for user in list_of_users:       create_user(name=user, expire=’true’, password=’welcome123’) This Jython code snippet iterates through a previously defined list of names, list_of_users, and iterates through the list, taking each name, user in this case, and creates an administrator sets the password to welcome123, but forces the user to reset it when they first login. This is only one of over four hundred procedures created to expose Oracle Enterprise Manager 12c functionality in a powerful and programmatic way. It is a few months since we released EM CLI with scripting option. We are seeing many users adapt to this fun and powerful way of using Oracle Enterprise Manager 12c. What are the first steps? Watch these screen watches, and dive in. The first screen watch steps you through where and how to download and install and how to run your first few commands. The Second screen watch steps you through a few scripts. Next time, I am going to show you the basic building blocks to writing a Jython script to perform Oracle Enterprise Manager 12c administrative tasks. Join this growing group of EM CLI users…. Dive in! Normal 0 false false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • Using EUSM to manage EUS mappings in OUD

    - by Sylvain Duloutre
    EUSM is a command line tool that can be used to manage the EUS settings starting with the 11.1 release of Oracle. In the 11.1 release the tool is not yet documented in the Oracle EUS documentation, but this is planned for a coming release. The same commands used by EUSM can be performed from the Database Console GUI or from Grid Control*. For more details, search for the document ID 1085065.1 on OTN. The examples below don't include all the EUSM options, only the options that are used by EUS. EUSM is user friendly and intuitive. Typing eusm help <option> lists the parameters to be used for any of the available options. Here are the options related to connectivity with OUD : ldap_host="gnb.fr.oracle.com" - name of the OUD server. ldap_port=1389 - nonSSL (SASL) port used for OUD connections.  ldap_user_dn="cn=directory manager" - OUD administrator nameldap_user_password="welcome1" - OUD administrator password Find below common commands: To List Enterprise roles in OUD eusm listEnterpriseRoles domain_name=<Domain> realm_dn=<realm> ldap_host=<hostname> ldap_port=<port> ldap_user_dn=<oud administrator> ldap_user_password=<oud admin password> To List Mappings eusm listMappings domain_name=<Domain> realm_dn=<realm> ldap_host=<hostname> ldap_port=<port> ldap_user_dn=<oud admin> ldap_user_password=<oud admin password> To List Enterprise Role Info eusm listEnterpriseRoleInfo enterprise_role=<rdn of enterprise role> domain_name=<Domain> realm_dn=<realm> ldap_host=<hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password=<oud admin password> To Create Enterprise Role eusm createRole enterprise_role=<rdn of the enterprise role> domain_name=<Domain> realm_dn=<realm> ldap_host=<hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password=<oud admin password> To Create User-Schema Mapping eusm createMapping database_name=<SID of target database> realm_dn="<realm>" map_type=<ENTRY/SUBTREE> map_dn="<dn of enterprise user>" schema="<name of the shared schema>" ldap_host=<oud hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password="<oud admin password>" To Create Proxy Permission eusm createProxyPerm proxy_permission=<Name of the proxypermission> domain_name=<Domain> realm_dn="<realm>" ldap_host=<hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password=<oud admin password> To Grant Proxy permission to Proxy group eusm grantProxyPerm proxy_permission=<Name of the proxy permission> domain_name=<Domain> realm_dn="<realm>" ldap_host=<hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password=<password> group_dn="<dn of the enterprise group>" To Map proxy permission to proxy user in DB eusm addTargetUser proxy_permission=<Name of the proxy permission> domain_name=<Domain> realm_dn="<realm>" ldap_host=<hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password=<oud admin password> database_name=<SID of the target database> target_user=<target database user> dbuser=<Database user with DBA privileges> dbuser_password=<database user password> dbconnect_string=<database_host>:<port>:<DBSID> Enterprise role to Global role mapping eusm addGlobalRole enterprise_role=<rdn of the enterprise role> domain_name=<Domain> realm_dn="<realm>" database_name=<SID of the target database> global_role=<name of the global role defined in the target database> dbuser=<database user> dbuser_password=<database user password> dbconnect_string=<database_host>:<port>:<DBSID> ldap_host=<oid_hostname> ldap_port=<port> ldap_user_dn="<oud admin>" ldap_user_password=<oud admin password>

    Read the article

  • Network outside internal not reaching TMG Forefront 2010 (Hyper-V environment)

    - by Pascal
    Below is my environment: I have 1 physical machine running Windows 2008 R2, with the Hyper-V role. This machine has 3 physical NICs: One for Internet One for Internal Network One for Wireless Network All 3 have their respective Virtual Networks in Hyper-V, and I have an extra Private virutal machine network for a DMZ Network. In one of the virtual machines, I have TMG Forefront 2010 SP1 installed, with all 4 networks available to it. Below is the IPCONFIG /ALL at the firewall: Windows IP Configuration Host Name . . . . . . . . . . . . : FRW-EXP1-02 Primary Dns Suffix . . . . . . . : exp1.eti.br Node Type . . . . . . . . . . . . : Hybrid IP Routing Enabled. . . . . . . . : Yes WINS Proxy Enabled. . . . . . . . : No DNS Suffix Search List. . . . . . : exp1.eti.br Ethernet adapter Internet: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Microsoft Virtual Machine Bus Network Adapter #4 Physical Address. . . . . . . . . : 00-15-5D-01-06-0E DHCP Enabled. . . . . . . . . . . : Yes Autoconfiguration Enabled . . . . : Yes Link-local IPv6 Address . . . . . : fe80::6d05:6033:4cfc:bdf5%15(Preferred) IPv4 Address. . . . . . . . . . . : 189.100.110.xxx(Preferred) Subnet Mask . . . . . . . . . . . : 255.255.240.0 Lease Obtained. . . . . . . . . . : quarta-feira, 5 de janeiro de 2011 11:17:24 Lease Expires . . . . . . . . . . : quarta-feira, 5 de janeiro de 2011 16:07:02 Default Gateway . . . . . . . . . : 189.100.96.xxx DHCP Server . . . . . . . . . . . : 201.6.2.43 DHCPv6 IAID . . . . . . . . . . . : 436213085 DHCPv6 Client DUID. . . . . . . . : 00-01-00-01-14-6D-75-6F-00-15-5D-01-06-0B DNS Servers . . . . . . . . . . . : 201.6.2.163 201.6.2.43 NetBIOS over Tcpip. . . . . . . . : Enabled Ethernet adapter Rede Interna: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Microsoft Virtual Machine Bus Network Adapter #3 Physical Address. . . . . . . . . : 00-15-5D-01-06-0C DHCP Enabled. . . . . . . . . . . : No Autoconfiguration Enabled . . . . : Yes Link-local IPv6 Address . . . . . : fe80::51ff:4723:ce4c:bbc3%14(Preferred) IPv4 Address. . . . . . . . . . . : 10.50.75.10(Preferred) Subnet Mask . . . . . . . . . . . : 255.255.255.0 Default Gateway . . . . . . . . . : DHCPv6 IAID . . . . . . . . . . . : 352327005 DHCPv6 Client DUID. . . . . . . . : 00-01-00-01-14-6D-75-6F-00-15-5D-01-06-0B DNS Servers . . . . . . . . . . . : 10.50.75.1 10.50.75.2 NetBIOS over Tcpip. . . . . . . . : Enabled Ethernet adapter DMZ: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Microsoft Virtual Machine Bus Network Adapter #2 Physical Address. . . . . . . . . : 00-15-5D-01-06-0A DHCP Enabled. . . . . . . . . . . : No Autoconfiguration Enabled . . . . : Yes Link-local IPv6 Address . . . . . : fe80::d4c5:75cf:e9aa:73e1%13(Preferred) IPv4 Address. . . . . . . . . . . : 192.168.10.1(Preferred) Subnet Mask . . . . . . . . . . . : 255.255.255.0 Default Gateway . . . . . . . . . : DHCPv6 IAID . . . . . . . . . . . : 301995357 DHCPv6 Client DUID. . . . . . . . : 00-01-00-01-14-6D-75-6F-00-15-5D-01-06-0B DNS Servers . . . . . . . . . . . : fec0:0:0:ffff::1%1 fec0:0:0:ffff::2%1 fec0:0:0:ffff::3%1 NetBIOS over Tcpip. . . . . . . . : Enabled Ethernet adapter Wireless: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Microsoft Virtual Machine Bus Network Adapter Physical Address. . . . . . . . . : 00-15-5D-01-06-0B DHCP Enabled. . . . . . . . . . . : No Autoconfiguration Enabled . . . . : Yes Link-local IPv6 Address . . . . . : fe80::459:8ca6:d02:8da1%11(Preferred) IPv4 Address. . . . . . . . . . . : 192.168.1.10(Preferred) Subnet Mask . . . . . . . . . . . : 255.255.255.0 Default Gateway . . . . . . . . . : DHCPv6 IAID . . . . . . . . . . . : 234886493 DHCPv6 Client DUID. . . . . . . . : 00-01-00-01-14-6D-75-6F-00-15-5D-01-06-0B DNS Servers . . . . . . . . . . . : fec0:0:0:ffff::1%1 fec0:0:0:ffff::2%1 fec0:0:0:ffff::3%1 NetBIOS over Tcpip. . . . . . . . : Enabled I have the Networks below at Forefront: External: IP addresses external to the Forefront TMG Networks Internal: 10.50.75.0 - 10.50.75.255 Local Host: Perimiter: 192.168.10.0 - 192.168.10.255 Wireless: 192.168.1.0 - 192.168.1.255 In the Networks Rules, I have: 1 => Route => Local Host => All Networks 2 => Route => Quarantined; VPN => Internal 3 => NAT => Internal; VPN => Perimiter 4 => NAT => Internal; Perimiter; Quarantined; VPN; Wireless => External My problem is that I can only communicate with the Internal and External networks. If a ping www.google.com or 10.50.75.21 from the Forefront VM, I get answer backs without a problem. If I try to ping a machine at the Perimiter network or the Wireless network, it doesn't get routed back to Forefront, and it's the default gateway on all Networks. Here as ping samples: PS C:\Users\Administrator.TPB1> ping www.google.com Pinging www.l.google.com [64.233.163.104] with 32 bytes of data: Reply from 64.233.163.104: bytes=32 time=11ms TTL=58 Reply from 64.233.163.104: bytes=32 time=8ms TTL=58 Ping statistics for 64.233.163.104: Packets: Sent = 2, Received = 2, Lost = 0 (0% loss), Approximate round trip times in milli-seconds: Minimum = 8ms, Maximum = 11ms, Average = 9ms Control-C PS C:\Users\Administrator.TPB1> ping 10.50.75.21 Pinging 10.50.75.21 with 32 bytes of data: Reply from 10.50.75.21: bytes=32 time=1ms TTL=128 Reply from 10.50.75.21: bytes=32 time=1ms TTL=128 Reply from 10.50.75.21: bytes=32 time=1ms TTL=128 Reply from 10.50.75.21: bytes=32 time=1ms TTL=128 Ping statistics for 10.50.75.21: Packets: Sent = 4, Received = 4, Lost = 0 (0% loss), Approximate round trip times in milli-seconds: Minimum = 1ms, Maximum = 1ms, Average = 1ms PS C:\Users\Administrator.TPB1> ping 192.168.10.3 Pinging 192.168.10.3 with 32 bytes of data: Reply from 192.168.10.1: Destination host unreachable. Request timed out. Request timed out. Request timed out. Ping statistics for 192.168.10.3: Packets: Sent = 4, Received = 1, Lost = 3 (75% loss), PS C:\Users\Administrator.TPB1> The ping to the 192.168.10.3 gets the Destination host unreachable. Below is the ipconfig for the perimiter VM: PS C:\Users\Administrator.Administrator> ipconfig /all Windows IP Configuration Host Name . . . . . . . . . . . . : app-exp1-02 Primary Dns Suffix . . . . . . . : Node Type . . . . . . . . . . . . : Unkown IP Routing Enabled. . . . . . . . : No WINS Proxy Enabled. . . . . . . . : No Ethernet adapter Local Area Connection: Connection-specific DNS Suffix . : Description . . . . . . . . . . . : Microsoft Virtual Machine Bus Network Adapter Physical Address. . . . . . . . . : 00-15-5D-01-06-08 DHCP Enabled. . . . . . . . . . . : No IPv4 Address. . . . . . . . . . . : 192.168.10.3 Subnet Mask . . . . . . . . . . . : 255.255.255.0 Default Gateway . . . . . . . . . : 192.168.10.1 DNS Servers . . . . . . . . . . . : 201.6.2.163 201.6.2.43 Trying to ping 192.168.10.1 ( the gateway ) from the DMZ machine also does not work. When I use Log & Reports to monitor packets from Wireless network and Perimiter network, I don't get any packets link PING or HTTP that I try to send. But I do get a lot of spoofing messages for NETBIOS broadcasts... it's like Forefront thinks it's coming from a different network, but I don't know why. Please Help! Tks

    Read the article

  • EM12c: Using the LIST verb in emcli

    - by SubinDaniVarughese
    Many of us who use EM CLI to write scripts and automate our daily tasks should not miss out on the new list verb released with Oracle Enterprise Manager 12.1.0.3.0. The combination of list and Jython based scripting support in EM CLI makes it easier to achieve automation for complex tasks with just a few lines of code. Before I jump into a script, let me highlight the key attributes of the list verb and why it’s simply excellent! 1. Multiple resources under a single verb:A resource can be set of users or targets, etc. Using the list verb, you can retrieve information about a resource from the repository database.Here is an example which retrieves the list of administrators within EM.Standard mode$ emcli list -resource="Administrators" Interactive modeemcli>list(resource="Administrators")The output will be the same as standard mode.Standard mode$ emcli @myAdmin.pyEnter password :  ******The output will be the same as standard mode.Contents of myAdmin.py scriptlogin()print list(resource="Administrators",jsonout=False).out()To get a list of all available resources use$ emcli list -helpWith every release of EM, more resources are being added to the list verb. If you have a resource which you feel would be valuable then go ahead and contact Oracle Support to log an enhancement request with product development. Be sure to say how the resource is going to help improve your daily tasks. 2. Consistent Formatting:It is possible to format the output of any resource consistently using these options:  –column  This option is used to specify which columns should be shown in the output. Here is an example which shows the list of administrators and their account status$ emcli list -resource="Administrators" -columns="USER_NAME,REPOS_ACCOUNT_STATUS" To get a list of columns in a resource use:$ emcli list -resource="Administrators" -help You can also specify the width of the each column. For example, here the column width of user_type is set to 20 and department to 30. $ emcli list -resource=Administrators -columns="USER_NAME,USER_TYPE:20,COST_CENTER,CONTACT,DEPARTMENT:30"This is useful if your terminal is too small or you need to fine tune a list of specific columns for your quick use or improved readability.  –colsize  This option is used to resize column widths.Here is the same example as above, but using -colsize to define the width of user_type to 20 and department to 30.$ emcli list -resource=Administrators -columns="USER_NAME,USER_TYPE,COST_CENTER,CONTACT,DEPARTMENT" -colsize="USER_TYPE:20,DEPARTMENT:30" The existing standard EMCLI formatting options are also available in list verb. They are: -format="name:pretty" | -format="name:script” | -format="name:csv" | -noheader | -scriptThere are so many uses depending on your needs. Have a look at the resources and columns in each resource. Refer to the EMCLI book in EM documentation for more information.3. Search:Using the -search option in the list verb makes it is possible to search for a specific row in a specific column within a resource. This is similar to the sqlplus where clause. The following operators are supported:           =           !=           >           <           >=           <=           like           is (Must be followed by null or not null)Here is an example which searches for all EM administrators in the marketing department located in the USA.$emcli list -resource="Administrators" -search="DEPARTMENT ='Marketing'" -search="LOCATION='USA'" Here is another example which shows all the named credentials created since a specific date.  $emcli list -resource=NamedCredentials -search="CredCreatedDate > '11-Nov-2013 12:37:20 PM'"Note that the timestamp has to be in the format DD-MON-YYYY HH:MI:SS AM/PM Some resources need a bind variable to be passed to get output. A bind variable is created in the resource and then referenced in the command. For example, this command will list all the default preferred credentials for target type oracle_database.Here is an example$ emcli list -resource="PreferredCredentialsDefault" -bind="TargetType='oracle_database'" -colsize="SetName:15,TargetType:15" You can provide multiple bind variables. To verify if a column is searchable or requires a bind variable, use the –help option. Here is an example:$ emcli list -resource="PreferredCredentialsDefault" -help 4. Secure accessWhen list verb collects the data, it only displays content for which the administrator currently logged into emcli, has access. For example consider this usecase:AdminA has access only to TargetA. AdminA logs into EM CLIExecuting the list verb to get the list of all targets will only show TargetA.5. User defined SQLUsing the –sql option, user defined sql can be executed. The SQL provided in the -sql option is executed as the EM user MGMT_VIEW, which has read-only access to the EM published MGMT$ database views in the SYSMAN schema. To get the list of EM published MGMT$ database views, go to the Extensibility Programmer's Reference book in EM documentation. There is a chapter about Using Management Repository Views. It’s always recommended to reference the documentation for the supported MGMT$ database views.  Consider you are using the MGMT$ABC view which is not in the chapter. During upgrade, it is possible, since the view was not in the book and not supported, it is likely the view might undergo a change in its structure or the data in it. Using a supported view ensures that your scripts using -sql will continue working after upgrade.Here’s an example  $ emcli list -sql='select * from mgmt$target' 6. JSON output support    JSON (JavaScript Object Notation) enables data to be displayed in a collection of name/value pairs. There is lot of reading material about JSON on line for more information.As an example, we had a requirement where an EM administrator had many 11.2 databases in their test environment and the developers had requested an Administrator to change the lifecycle status from Test to Production which meant the admin had to go to the EM “All targets” page and identify the set of 11.2 databases and then to go into each target database page and manually changes the property to Production. Sounds easy to say, but this Administrator had numerous targets and this task is repeated for every release cycle.We told him there is an easier way to do this with a script and he can reuse the script whenever anyone wanted to change a set of targets to a different Lifecycle status. Here is a jython script which uses list and JSON to change all 11.2 database target’s LifeCycle Property value.If you are new to scripting and Jython, I would suggest visiting the basic chapters in any Jython tutorials. Understanding Jython is important to write the logic depending on your usecase.If you are already writing scripts like perl or shell or know a programming language like java, then you can easily understand the logic.Disclaimer: The scripts in this post are subject to the Oracle Terms of Use located here.  1 from emcli import *  2  search_list = ['PROPERTY_NAME=\'DBVersion\'','TARGET_TYPE= \'oracle_database\'','PROPERTY_VALUE LIKE \'11.2%\'']  3 if len(sys.argv) == 2:  4    print login(username=sys.argv[0])  5    l_prop_val_to_set = sys.argv[1]  6      l_targets = list(resource="TargetProperties", search=search_list,   columns="TARGET_NAME,TARGET_TYPE,PROPERTY_NAME")  7    for target in l_targets.out()['data']:  8       t_pn = 'LifeCycle Status'  9      print "INFO: Setting Property name " + t_pn + " to value " +       l_prop_val_to_set + " for " + target['TARGET_NAME']  10      print  set_target_property_value(property_records=      target['TARGET_NAME']+":"+target['TARGET_TYPE']+":"+      t_pn+":"+l_prop_val_to_set)  11  else:  12   print "\n ERROR: Property value argument is missing"  13   print "\n INFO: Format to run this file is filename.py <username>   <Database Target LifeCycle Status Property Value>" You can download the script from here. I could not upload the file with .py extension so you need to rename the file to myScript.py before executing it using emcli.A line by line explanation for beginners: Line  1 Imports the emcli verbs as functions  2 search_list is a variable to pass to the search option in list verb. I am using escape character for the single quotes. In list verb to pass more than one value for the same option, you should define as above comma separated values, surrounded by square brackets.  3 This is an “if” condition to ensure the user does provide two arguments with the script, else in line #15, it prints an error message.  4 Logging into EM. You can remove this if you have setup emcli with autologin. For more details about setup and autologin, please go the EM CLI book in EM documentation.  5 l_prop_val_to_set is another variable. This is the property value to be set. Remember we are changing the value from Test to Production. The benefit of this variable is you can reuse the script to change the property value from and to any other values.  6 Here the output of the list verb is stored in l_targets. In the list verb I am passing the resource as TargetProperties, search as the search_list variable and I only need these three columns – target_name, target_type and property_name. I don’t need the other columns for my task.  7 This is a for loop. The data in l_targets is available in JSON format. Using the for loop, each pair will now be available in the ‘target’ variable.  8 t_pn is the “LifeCycle Status” variable. If required, I can have this also as an input and then use my script to change any target property. In this example, I just wanted to change the “LifeCycle Status”.  9 This a message informing the user the script is setting the property value for dbxyz.  10 This line shows the set_target_property_value verb which sets the value using the property_records option. Once it is set for a target pair, it moves to the next one. In my example, I am just showing three dbs, but the real use is when you have 20 or 50 targets. The script is executed as:$ emcli @myScript.py subin Production The recommendation is to first test the scripts before running it on a production system. We tested on a small set of targets and optimizing the script for fewer lines of code and better messaging.For your quick reference, the resources available in Enterprise Manager 12.1.0.4.0 with list verb are:$ emcli list -helpWatch this space for more blog posts using the list verb and EM CLI Scripting use cases. I hope you enjoyed reading this blog post and it has helped you gain more information about the list verb. Happy Scripting!!Disclaimer: The scripts in this post are subject to the Oracle Terms of Use located here. Stay Connected: Twitter | Facebook | YouTube | Linkedin | Newsletter mt=8">Download the Oracle Enterprise Manager 12c Mobile app

    Read the article

  • Blocking access to websites with objective-C / root privileges in objective-C

    - by kvaruni
    I am writing a program in Objective-C (XCode 3.2, on Snow Leopard) that is capable of either selectively blocking certain sites for a duration or only allow certain sites (and thus block all others) for a duration. The reasoning behind this program is rather simple. I tend to get distracted when I have full internet access, but I do need internet access during my working hours to get to a number of work-related websites. Clearly, this is not a permanent block, but only helps me to focus whenever I find myself wandering a bit too much. At the moment, I am using a Unix script that is called via AppleScript to obtain Administrator permissions. It then activates a number of ipfw rules and clears those after a specific duration to restore full internet access. Simple and effective, but since I am running as a standard user, it gets cumbersome to enter my administrator password each and every time I want to go "offline". Furthermore, this is a great opportunity to learn to work with XCode and Objective-C. At the moment, everything works as expected, minus the actual blocking. I can add a number of sites in a list, specify whether or not I want to block or allow these websites and I can "start" the blocking by specifying a time until which I want to stay "offline". However, I find it hard to obtain clear information on how I can run a privileged Unix command from Objective-C. Ideally, I would like to be able to store information with respect to the Administrator account into the Keychain to use these later on, so that I can simply move into "offline" mode with the convenience of clicking a button. Even more ideally, there might be some class in Objective-C with which I can block access to some/all websites for this particular user without needing to rely on privileged Unix commands. A third possibility is in starting this program with root permissions and the reducing the permissions until I need them, but since this is a GUI application that is nested in the menu bar of OS X, the results are rather awkward and getting it to run each and every time with root permission is no easy task. Anyone who can offer me some pointers or advice? Please, no security-warnings, I am fully aware that what I want to do is a potential security threat.

    Read the article

  • How to set disabled in MVC htmlAttribute

    - by Ollie
    When using an HTML Helper, what is the best method to set an attribute based on a condition. For example <%if (Page.User.IsInRole("administrator")) {%> <%=Html.TextBoxFor(m => m.FirstName, new {@class='contactDetails'}%> <%} else {%> <%=Html.TextBoxFor(m => m.FirstName, new {@class='contactDetails', disabled = true}%> <%}%> There must be a better way to programmatically add just one additional KeyPair to the anonymous type? Can't use new { .... disabled = Page.User.IsInRole("administrator") ... } as the browser takes any disabled attribute value as making the input disabled

    Read the article

  • Privilege Elevation only when and if required.

    - by Cameron Peters
    My application only very occasionally requires privilege elevation... I need to reference some 3rd party COM components that only work correctly when run as administrator. I would like my application to request privilege elevation only when it needs it... Generally, I don't want my application to run as administrator unless I need to use the 3rd party COM components. I see that CoCreateAsAdmin could potentially solve the problem, but the component author doesn't set up the required registry entries, and I'm not sure how to use CoCreateAsAdmin in C# and in conjuction with Runtime-Callable-Wrapper that is created by tlbimp. Another solution would be to spawn another process, but I have no experience with this yet... I don't want to create a completely separate application... I would be happy to create an assembly that runs in a separated elevated process if someone can show me how to make it work. Thanks...

    Read the article

  • Request a user's roles in AD when caller is not in domain

    - by grootjans
    I would like to get a user's group memberships in an ActiveDirectory, without being in the domain. When I run this inside the domain, all is well. var context = new PrincipalContext(ContextType.Domain); var principal = UserPrincipal.FindByIdentity(context, IdentityType.Name, "administrator"); foreach (var authorizationGroup in principal.GetAuthorizationGroups()) { Console.WriteLine(authorizationGroup.Name); } However, when I run outside the domain, I have to specify the PrincipalContext lie this: var context = new PrincipalContext(ContextType.Domain, "10.0.1.255", "DC=test,DC=ad,DC=be", "administrator", "password"); When I run this code, I get an exception when I execute principal.GetAuthorizationGroups(). The exception I get is: System.DirectoryServices.AccountManagement.PrincipalOperationException: Information about the domain could not be retrieved (1355). at System.DirectoryServices.AccountManagement.Utils.GetDcName(String computerName, String domainName, String siteName, Int32 flags) at System.DirectoryServices.AccountManagement.ADStoreCtx.LoadDomainInfo() at System.DirectoryServices.AccountManagement.ADStoreCtx.get_DnsDomainName() at System.DirectoryServices.AccountManagement.ADStoreCtx.GetGroupsMemberOfAZ(Principal p) at System.DirectoryServices.AccountManagement.UserPrincipal.GetAuthorizationGroupsHelper() at System.DirectoryServices.AccountManagement.UserPrincipal.GetAuthorizationGroups()

    Read the article

  • C# - Screenshot of process under Windows Service

    - by Jonathan.Peppers
    We have to run a process from a windows service and get a screenshot from it. We tried the BitBlt and PrintWindow Win32 calls, but both give blank (black) bitmaps. If we run our code from a normal user process, it works just fine. Is this something that is even possible? Or could there be another method to try? Things we tried: Windows service running as Local System, runs process as Local System - screenshot fails Windows service running as Administrator, runs process as Administrator - screenshot fails. Windows application running as user XYZ, runs a process as XYZ - screenshot works with both BitBlt or PrintWindow. Tried checking "Allow service to interact with desktop" from Local System We also noticed that PrintWindow works better for our case, it works if the window is behind another window. For other requirements, both the parent and child processes must be under the same user. We can't really use impersonation from one process to another.

    Read the article

  • activeX component in axapta

    - by Nico
    hi folks, i'm struggling with an .net activeX i try to use in ms axapta 2009. using this component on my local machine where it was compiled, it's working quite fine. it can be added as activeX element on a form, the methods and events are listed in the axapta-activeX-explorer and i can interact with it without any problems. but trying to distribute the dll to other clients isn't working as intended. the registration of the dll via regasm /codebase /tlb works properly - getting the message, registration was successful. the component is also listed when selecting an activeX-element to add in ax, but neither functions nor properties are listed. and launching the form results in an errormessage - activeX component CLSID ... not found on system, not installed. the classID is indeed the one, defined in .net. strange things happen, having a look on the task-manager. the activeX-component itself is just a wrapper to interact with a com-application. when launching the ax-form with the not working and _not_installed_!! activeX-thing, the taskmanager shows a new process of the com-application, which is instanciated by the activeX :/ things i tried: using different versions of regasm, eg \Windows\Microsoft.NET\Framework\v2.0.50727 ; C:\Windows\Microsoft.NET\Framework64\v2.0.50727 using new GUIDs in .net, prior removing the old ones from the registry compiling, using different versions of the .net framework doing registration via regasm, regasm /codebase, regasm /codebase /tlb, using a visual-studio-setup running registration via command-line as administrator running setup as administrator running even ax as administrator on client-machine moving dll to a different folder followed by new registration ( windows/system32; ax/client/bin ) installing to GAC ( gacutil /i ) different project-options in visual studio ( COM-Visibility; register for COM-Interop; different targetPlatform ) hoped for the fact, that compiling in visual studio with register for COM-Interop option enabled does something more than just the regasm-registration, i used a registry-monitor-microsoft-tool for logging the registry-activity which happend during compilation. using these logs to create all registry-entries on the target-client in addition didn't work either. any hints or help would be so much appreciated! this thing is blocking me for days now :(

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Voice transmission over LAN using java?

    - by Ala ABUDEEB
    Hello I'm building a java application which works in a LAN environment, every computer on that LAN have this application installed on it, at some point i need this application to transfer voice simultaneously to all computer over the LAN (voice broadcasting) according to the following mechanism: Only one computer of the LAN can send voice using a microphone(the administrator) All computers receive that voice simultaneously (of course using my application) The voice should be recorded on the administrator computer after finishing the session. Could anyone give me an idea of how to use java in working with voice transmission? What java library can help me do that? Please help, thank you

    Read the article

  • Suggest the best options to me to design the dynamic web interface using PHP MYSQL and AJAX

    - by Krishna
    Hello, I am designing a web interface for a company. I am describing the company's profile: company is currently having 5 branches and planning to extend their branches all over the country. it is an insurance surveying company. they are dealing with 6 Categories in the insurance domain, vide .. Engineering Fire Marine Motor Miscellaneous Risk Inspection and branches named as b1, b2, b3, b4, b5 and Extending. and finally they have contract with 22 companies. For each claim they are assign a unique ID. like contractcompany/category/serialno Ex: take a contracted company names as xxx, sss, zzz. xxx/Engineering/001 sss/Engineering/001 . . . xxx/Enginnering/002 sss/Engineering/002 . . . xxx/Fire/001 sss/Fire/001 . . . xxx/Fire/002 . . . xxx/Fire/002 . . . and so on..... by this way they issue the unique ID for each claim. Finally what i want is developing the interface with PHP mysql and ajax auto generating the unique id for each claim. store full details of the claims with reference to unique id. show all claims in one page, and they can view by branch wise and category wise. send monthly Report (All claims they have given and status of claims) to contract companies. give access to contracted companies, but they can view only their respective claims. Each claim has its own documents. So they can be uploaded by own company users or administrator. these files are associated with unique ID. contracted companies can view files. Give access to branches to enter new claims and update old claims. Administrator can create, update and delete all the claims and their details. Only administrator can grant new users (own company branches / contracted companies) Finally the the panel is completely database driven. Could any body can help. Thanks in advance Kindly do the needful and oblige Thanks and Regards Krishna. P [email protected]

    Read the article

  • Error in Jaclplus component

    - by Aruna
    Hi, I am working on Joomla 1.5 and our site is using the Bluehost server.Till March 9th, 2010 our site was working perfectly.And on March 10th,2010 , the following error was shown in the site as Warning: Unexpected character in input: '' (ASCII=28) state=1 in /home1/tcscoinc/public_html/tcsrnd/administrator/components/com_jaclplus/jac lplus.class.php on line 73 Parse error: syntax error, unexpected T_STRING in /home1/tcscoinc/public_html/tcsrnd/administrator/components/com_jaclplus/jac lplus.class.php on line 73 For time being, i have just renamed the file jaclplus.class.php to make the site to function. As we are using Jaclplus component and we have purchased the Jaclplus component from Byos Tech , i have checked in the membership details.And we found that our Membership has been expired on 03/10/2010 . I have asked them but they had replied that it may not be a problem on membership. Please anyone share what can be the reason for the error.I am not able to open that file(jaclplus.class.php) since its a binary file.

    Read the article

  • Coldfusion 9 installation problem with IIS7

    - by Saul
    Windows web server 2008 R2 64 bit, CF9 64 bit, IIS7, ISAPI extensions and filters and II6 metabase compatability installed. OS is on C default, and trying to install CF to D: Testing IIS and it shows index.html correctly from c:\inetpub\wwwroot at http://localhost/index.html Then I install CF to D:\ , single standard server licence, select run with all IIS sites, select C:\inetpub\wwwroot as the web root for administrator, and when it gets to the bit where it is supposed to open up administrator to complete the installation it opens up the browser with a 500 error. Now when I go back to http://localhost/index.html I also get a 500 error, if i uninstall CF I can again reach the html page. CFIDE has been installed in C:\inetpub\wwwroot presumably correctly. Can anyone tell me where I'm going wrong please. Update The exact IIS error is HTTP Error 500.0 - Internal Server Error The page cannot be displayed because an internal server error has occurred. Module IsapiModule Notification ExecuteRequestHandler Handler AboMapperCustom-28262 Error Code 0x800700c1 Requested URL http://127.0.0.1:80/test.htm Physical Path C:\inetpub\wwwroot\test.htm Logon Method Anonymous Logon User Anonymous

    Read the article

  • How to run an application as root without asking for an admin password?

    - by kvaruni
    I am writing a program in Objective-C (XCode 3.2, on Snow Leopard) that is capable of either selectively blocking certain sites for a duration or only allow certain sites (and thus block all others) for a duration. The reasoning behind this program is rather simple. I tend to get distracted when I have full internet access, but I do need internet access during my working hours to get to a number of work-related websites. Clearly, this is not a permanent block, but only helps me to focus whenever I find myself wandering a bit too much. At the moment, I am using a Unix script that is called via AppleScript to obtain Administrator permissions. It then activates a number of ipfw rules and clears those after a specific duration to restore full internet access. Simple and effective, but since I am running as a standard user, it gets cumbersome to enter my administrator password each and every time I want to go "offline". Furthermore, this is a great opportunity to learn to work with XCode and Objective-C. At the moment, everything works as expected, minus the actual blocking. I can add a number of sites in a list, specify whether or not I want to block or allow these websites and I can "start" the blocking by specifying a time until which I want to stay "offline". However, I find it hard to obtain clear information on how I can run a privileged Unix command from Objective-C. Ideally, I would like to be able to store information with respect to the Administrator account into the Keychain to use these later on, so that I can simply move into "offline" mode with the convenience of clicking a button. Even more ideally, there might be some class in Objective-C with which I can block access to some/all websites for this particular user without needing to rely on privileged Unix commands. A third possibility is in starting this program with root permissions and the reducing the permissions until I need them, but since this is a GUI application that is nested in the menu bar of OS X, the results are rather awkward and getting it to run each and every time with root permission is no easy task. Anyone who can offer me some pointers or advice? Please, no security-warnings, I am fully aware that what I want to do is a potential security threat.

    Read the article

  • Visual Studio 2008 - Focus on textbox doesn't work when run from VS2008 as admin

    - by Steve
    This is a minor, esoteric problem and not a showstopper, but I'm wondering what other VS2008 idiosyncrasies are out there. If you make a web app, add a textbox and run a focus function for the textbox on page load, it works when you run VS not as administrator from a Vista non-administrator account or if you run the page from a browser instance run on its own, not from VS. If you browse the page from VS as Admin, the focus doesn't work. This for Cassini and from the local IIS. Stuff like this just makes me trust VS a tad less.

    Read the article

  • ..../All Users/Application data folder permissions

    - by Amit Kumar Jain
    I have a windows desktop application whose application data is stored in the All Users/Application Data/ My Company folder. Now when I install my application on an Windows XP machine using an Administrator login. If I run my application using that administrator's login it works well but when I tried to run my application using a normal users login on that machine it fails. The reason for failure is that the normal user is not able to write anything in the All Users/Application data/ My Company folder. Now is any kind of permission is required for All Users folder on Windows XP machine. If yes then from where I can set that permission.

    Read the article

  • Unable to modify git bash Windows shortcut

    - by netgirlk
    Under Windows 7 I'd like to change the settings for the Git Bash Here shell extension command window, e.g. width, height and font. But when I do this, I get an error "Unable to modify the shortcut". I can modify the shortcut for Git Bash in the Start menu by using "Run as administrator..." This works, but only for Bash windows opened from the Start menu. It doesn't work for the "Git Bash Here" shell extension and there's no "Run as administrator..." option on right-click context menu. How do you do it?

    Read the article

  • IIS 7.5 powershell module usage issues

    - by pmcgrath
    Has anyone managed to use this module with success, i'm running 32bit Windows 7, where i have opened an administrator shell using run as administrator, i have imported the WebAdministration module and then attempted to use the commands with some issues, have provided two examples here Websites I created a web site with the following command new-website -name testsite -port 80 -hostheader testsite -physicalpath c:\temp Then i attempted to get the sites details using the command get-website -name testsite but it always returns all sites, seems to ignore the -name parameter. Only way i can get the site is using a filter get-website | ? { $_.name -eq 'testsite' } | get-member When i use appcmd it works as expected using the following command C:\> C:\Windows\System32\inetsrv\appcmd.exe list site testsite AppPools When i try to list the apppools using the following command dir iis:\apppools i get the following error Get-ChildItem : Access is denied. (Exception from HRESULT: 0x80070005 (E_ACCESSDENIED)) Yet when i use appcmd as follows i get all the apppools as expected without any error C:\Windows\System32\inetsrv\appcmd.exe list apppool Has anyone successfully managed to use the WebAdministration module ? Thanks in advance Pat

    Read the article

< Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >