Search Results

Search found 9051 results on 363 pages for 'apply templates'.

Page 30/363 | < Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >

  • C++ Class Templates (Queue of a class)

    - by Dalton Conley
    Ok, so I have my basic linked Queue class with basic functions such as front(), empty() etc.. and I have transformed it into a template. Now, I also have a class called Student. Which holds 2 values: Student name and Student Id. I can print out a student with the following code.. Student me("My Name", 2); cout << me << endl; Here is my display function for student: void display(ostream &out) const { out << "Student Name: " << name << "\tStudent Id: " << id << "\tAddress: " << this << endl; } Now it works fine, you can see the basic output. Now I'm declaring a queue like so.. Queue<Student> qstu; Storing data in this queue is fine, I can add new values and such.. now what I'm trying to do is print out my whole queue of students with: cout << qstu << endl; But its simply returning an address.. here is my display function for queues. void display(ostream & out) const { NodePointer ptr; ptr = myFront; while(ptr != NULL) { out << ptr->data << " "; ptr = ptr->next; } out << endl; } Now, based on this, I assume ptr-data is a Student type and I would assume this would work, but it doesn't. Is there something I'm missing? Also, when I Try: ptr->data.display(out); (Making the assumtion ptr-data is of type student, it does not work which tells me I am doing something wrong. Help on this would be much appreciated!

    Read the article

  • In registration form adding date dialogbox how can apply validation in system date in dialog ends

    - by narasimha
    hi i am implementing registration form adding date field then click icon to display date dialog window then limit date validation in system date below date only how can implement the validation protected Dialog onCreateDialog(int id) { Calendar c = Calendar.getInstance(); int cyear = c.get(Calendar.YEAR); int cmonth = c.get(Calendar.MONTH); int cday = c.get(Calendar.DAY_OF_MONTH); switch (id) { case DATE_DIALOG_ID: return new DatePickerDialog(this, mDateSetListener, cyear, cmonth, cday); } return null; } private DatePickerDialog.OnDateSetListener mDateSetListener = new DatePickerDialog.OnDateSetListener() { public void onDateSet(DatePicker view, int year, int monthOfYear, int dayOfMonth) { String date_selected = String.valueOf(monthOfYear+1)+" /"+String.valueOf(dayOfMonth)+" /"+String.valueOf(year); EditText birthday=(EditText) findViewById(R.id.EditTextBirthday); birthday.setText(date_selected); } }; public void onClick(View v) { if(v == b1) showDialog(DATE_DIALOG_ID); } } ** showing in system date in below dates only how can implemented some solution in running year to below years are display not incrementing above years this condition are appliying validations how can implemented ?

    Read the article

  • Are There Any 3rd-Party Free Deployment Templates for Visual Studio Express Edition

    - by Peter Lee
    Hi, Due to the lack of Deployment functionality of Visual Studio Express edition, I'm here asking if anyone can recommend a very nice free Deployment template for the express edition. I'm mainly working with C# desktop project. I know that there is still ClickOnce deployment in the Express edition, but it seems to me that it is not so difficult to control, which means, you do "click once", then the tool will give you a bunch of files out of my control, not so easy to maintain. Thanks. Peter

    Read the article

  • Apply PHP regex replace on a multi-line repeted pattern

    - by Hussain
    Let's say I have this input: I can haz a listz0rs! # 42 # 126 I can haz another list plox? # Hello, world! # Welcome! I want to split it so that each set of hash-started lines becomes a list: I can haz a listz0rs! <ul> <li>42</li> <li>126</li> </ul> I can haz another list plox? <ul> <li>Hello, world!</li> <li>Welcome!</li> </ul> If I run the input against the regex "/(?:(?:(?<=^# )(.*)$)+)/m", I get the following result: Array ( [0] => Array ( [0] => 42 ) Array ( [0] => 126 ) Array ( [0] => Hello, world! ) Array ( [0] => Welcome! ) ) This is fine and dandy, but it doesn't distinguish between the two different lists. I need a way to either make the quantifier return a concatenated string of all the occurrences, or, ideally, an array of all the occurrences. Idealy, this should be my output: Array ( [0] = Array ( [0] = 42 [1] = 126 ) Array ( [0] = Hello, world! [1] = Welcome! ) ) Is there any way of achieving this, and if not, is there a close alternative? Thanks in advance!

    Read the article

  • Dynamically register constructor methods in an AbstractFactory at compile time using C++ templates

    - by Horacio
    When implementing a MessageFactory class to instatiate Message objects I used something like: class MessageFactory { public: static Message *create(int type) { switch(type) { case PING_MSG: return new PingMessage(); case PONG_MSG: return new PongMessage(); .... } } This works ok but every time I add a new message I have to add a new XXX_MSG and modify the switch statement. After some research I found a way to dynamically update the MessageFactory at compile time so I can add as many messages as I want without need to modify the MessageFactory itself. This allows for cleaner and easier to maintain code as I do not need to modify three different places to add/remove message classes: #include <stdio.h> #include <stdlib.h> #include <string.h> #include <inttypes.h> class Message { protected: inline Message() {}; public: inline virtual ~Message() { } inline int getMessageType() const { return m_type; } virtual void say() = 0; protected: uint16_t m_type; }; template<int TYPE, typename IMPL> class MessageTmpl: public Message { enum { _MESSAGE_ID = TYPE }; public: static Message* Create() { return new IMPL(); } static const uint16_t MESSAGE_ID; // for registration protected: MessageTmpl() { m_type = MESSAGE_ID; } //use parameter to instanciate template }; typedef Message* (*t_pfFactory)(); class MessageFactory· { public: static uint16_t Register(uint16_t msgid, t_pfFactory factoryMethod) { printf("Registering constructor for msg id %d\n", msgid); m_List[msgid] = factoryMethod; return msgid; } static Message *Create(uint16_t msgid) { return m_List[msgid](); } static t_pfFactory m_List[65536]; }; template <int TYPE, typename IMPL> const uint16_t MessageTmpl<TYPE, IMPL >::MESSAGE_ID = MessageFactory::Register( MessageTmpl<TYPE, IMPL >::_MESSAGE_ID, &MessageTmpl<TYPE, IMPL >::Create); class PingMessage: public MessageTmpl < 10, PingMessage > {· public: PingMessage() {} virtual void say() { printf("Ping\n"); } }; class PongMessage: public MessageTmpl < 11, PongMessage > {· public: PongMessage() {} virtual void say() { printf("Pong\n"); } }; t_pfFactory MessageFactory::m_List[65536]; int main(int argc, char **argv) { Message *msg1; Message *msg2; msg1 = MessageFactory::Create(10); msg1->say(); msg2 = MessageFactory::Create(11); msg2->say(); delete msg1; delete msg2; return 0; } The template here does the magic by registering into the MessageFactory class, all new Message classes (e.g. PingMessage and PongMessage) that subclass from MessageTmpl. This works great and simplifies code maintenance but I still have some questions about this technique: Is this a known technique/pattern? what is the name? I want to search more info about it. I want to make the array for storing new constructors MessageFactory::m_List[65536] a std::map but doing so causes the program to segfault even before reaching main(). Creating an array of 65536 elements is overkill but I have not found a way to make this a dynamic container. For all message classes that are subclasses of MessageTmpl I have to implement the constructor. If not it won't register in the MessageFactory. For example commenting the constructor of the PongMessage: class PongMessage: public MessageTmpl < 11, PongMessage > { public: //PongMessage() {} /* HERE */ virtual void say() { printf("Pong\n"); } }; would result in the PongMessage class not being registered by the MessageFactory and the program would segfault in the MessageFactory::Create(11) line. The question is why the class won't register? Having to add the empty implementation of the 100+ messages I need feels inefficient and unnecessary.

    Read the article

  • Apply CSS Style on all elements except with a SPECIFIC ID

    - by Rajesh Paul
    CSS Code(what I need) <style> div[id!='div1']// I actually needed an inequality operator for NOT EQUAL TO { font-size:40px; } </style> HTML code <body> <div>abc</div> <div>def</div> <div id='div1'>ghi</div> </body> The CSS didn't work as I intended. I actually wanted to define the style for all <div>-elements except the one with id='div1'. How can I do that?

    Read the article

  • Trapping events within list box item templates in WPF

    - by AC
    I've got listbox that employs an item template. Within each item in the list, as defined in the template there is a button. When the user clicks the button I change a value in the data source that defines the sort order of the list. Changing the datasource is not a problem as this is working just fine within my application template. However my next step is to reload the listbox with the new sorted data source. I've tried doing this from the tempalte but it apparently doesn't have access (or I can't figure out how to get access) to the parent elements so I can reset the .ItemSource property with a newly sorted data source. Seems like this is possible but the solution is eluding me :(

    Read the article

  • how to apply group by on xslt elements

    - by Amit
    Hello All, I need to group the value based on some attribute and populate it. below mentioned is i/p xml and if you see there are 4 rows for Users and for id 2,4 Division is same i.e. HR while generating actual o/p I need to group by Division ... Any help ??? I/P XML <Users> <User id="2" name="ABC" Division="HR"/> <User id="3" name="xyz" Division="Admin"/> <User id="4" name="LMN" Division="Payroll"/> <User id="5" name="PQR" Division="HR"/> </Users> expected Result: I need to group the values based on Division and populate i.e. <AllUsers> <Division value="HR"> <User> <id>2</id> <name>ABC</name> </User> <User> <id>5</id> <name>PQR</name> </User> </Division> <Division value="ADMIN"> <User> <id>3</id> <name>XYZ</name> </User> </Division> <Division value="Payroll"> <User> <id>4</id> <name>LMN</name> </User> </Division> </AllUsers>

    Read the article

  • Drupal administration theme doesn't apply to Blocks pages (admin/build/block)

    - by hfidgen
    A site I'm creating for a customer in D6 has various images overlaying parts of the main content area. It looks very pretty and they have to be there for the general effect. The problem is, if you use this theme in the administration pages, the images get in the way of everything. My solution was to create a custom admin theme, based on the default one, which has these image areas disabled in the output template files - page.tpl.php The problem is that when you try and edit the blocks page, it uses the default theme and half the blocks admin settings are unclickable behind the images. I KNOW this is by design in Drupal, but it's annoying the hell out of me and is edging towards "bug" rather than "feature" in my mind. It also appears that there is no way of getting around it. You can edit /modules/blocks/block.admin.inc to force Drupal to show the blocks page in the chosen admin theme. BUT whichever changes you then make will not be transferred to the default theme, as Drupal treats each theme separately and each theme can have different block layouts. :x function block_admin_display($theme = NULL) { global $custom_theme; // If non-default theme configuration has been selected, set the custom theme. // $custom_theme = isset($theme) ? $theme : variable_get('theme_default', 'garland'); // Display admin theme $custom_theme = variable_get('admin_theme', '0'); // Fetch and sort blocks $blocks = _block_rehash(); usort($blocks, '_block_compare'); return drupal_get_form('block_admin_display_form', $blocks, $theme); } Can anyone help? the only thing I can think of is to push the $content area well below the areas where the image appear and use blocks only for content display. Thanks!

    Read the article

  • Generic CSS templates anywhere (not layout)?

    - by TruMan1
    I am looking for a place where I can download a bunch of CSS stylesheets to change the appearance of my titles, links, paragraphs, etc. I am not an artist, so I am hoping to leverage other people's skills in choosing the right fonts, colors, sizes, etc. I do not want to include layout because then it won't be as generic. Does anyone know where I can get something like this?

    Read the article

  • Apply PHP regex replace on a multi-line repeated pattern

    - by Hussain
    Let's say I have this input: I can haz a listz0rs! # 42 # 126 I can haz another list plox? # Hello, world! # Welcome! I want to split it so that each set of hash-started lines becomes a list: I can haz a listz0rs! <ul> <li>42</li> <li>126</li> </ul> I can haz another list plox? <ul> <li>Hello, world!</li> <li>Welcome!</li> </ul> If I run the input against the regex "/(?:(?:(?<=^# )(.*)$)+)/m", I get the following result: Array ( [0] => Array ( [0] => 42 ) [1] => Array ( [0] => 126 ) [2] => Array ( [0] => Hello, world! ) [3] => Array ( [0] => Welcome! ) ) This is fine and dandy, but it doesn't distinguish between the two different lists. I need a way to either make the quantifier return a concatenated string of all the occurrences, or, ideally, an array of all the occurrences. Ideally, this should be my output: Array ( [0] => Array ( [0] => 42 [1] => 126 ) [1] => Array ( [0] => Hello, world! [1] => Welcome! ) ) Is there any way of achieving this, and if not, is there a close alternative? Thanks in advance!

    Read the article

  • BizTalk 2009 XSLT and Attribute Value Templates

    - by amok
    I'm trying to make use of attribute value type in a BizTalk XSL transformation to dynamically setting attribute or other element names. Read more here: http://www.w3.org/TR/xslt#dt-attribute-value-template The following code is an example of an XSL template to add an attribute optionally. <xsl:template name="AttributeOptional"> <xsl:param name="value"/> <xsl:param name="attr"/> <xsl:if test="$value != ''"> <xsl:attribute name="{$attr}"> <xsl:value-of select="$value"/> </xsl:attribute> </xsl:if> </xsl:template> Running this script in BizTalk results in "Exception from HRESULT: 0x80070002)" An alternative I was thinking of was to call a msxsl:script function to do the same but i cannot get a handle on the XSL output context from within the function. An ideas?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do .so files avoid problems associated with passing header-only templates like MS dll files have?

    - by Doug T.
    Based on the discussion around this question. I'd like to know how .so files/the ELF format/the gcc toolchain avoid problems passing classes defined purely in header files (like the std library). According to Jan in that answer, the dynamic linker/loader only picks one version of such a class to load if its defined in two .so files. So if two .so files have two definitions, perhaps with different compiler options/etc, the dynamic linker can pick one to use. Is this correct? How does this work with inlining? For example, MSVC inlines templates aggressively. This makes the solution I describe above untenable for dlls. Does Gcc never inline header-only templates like the std library as MSVC does? If so wouldn't that make the functionality of ELF described above ineffective in these cases?

    Read the article

  • How to apply Containstable 4 two join table?

    - by jaykanth
    product table pid modelnumber 1 a 2 b 3 c ProductTransation pid name description... 1 ball ball 2 bat cricket bat i create fullText for Modelnumber in product table. " for name & Description in productTrasaction table. Now i want to join this table if i search through modelnumber or name result should be pid name modelnumber 1 ball a

    Read the article

  • How to apply changes without access to svn server

    - by JoelFan
    We are using svn for development of a large web application, and we do periodic updates to production. The production server does not have access to svn (for security reasons). What is the best way to push the changes since the last production release for a new release? We would like to avoid re-creating the whole site each time, since it is very large.

    Read the article

  • [C++] My First Go With Function Templates

    - by bobber205
    Thought it was pretty straight forward. But I get a "iterator not dereferencable" errro when running the below code. What's wrong? template<typename T> struct SumsTo : public std::binary_function<T, T, bool> { int myInt; SumsTo(int a) { myInt = a; } bool operator()(const T& l, const T& r) { cout << l << " + " << r; if ((l + r) == myInt) { cout << " does add to " << myInt; } else { cout << " DOES NOT add to " << myInt; } return true; } }; void main() { list<int> l1; l1.push_back(1); l1.push_back(2); l1.push_back(3); l1.push_back(4); list<int> l2; l2.push_back(9); l2.push_back(8); l2.push_back(7); l2.push_back(6); transform(l1.begin(), l1.end(), l2.begin(), l2.end(), SumsTo<int>(10) ); }

    Read the article

  • how to apply filters in jsf

    - by johnbritto
    Hi I have filter code Page not Found error while any client request for Jsf Page in my Jsf application.I dont Know How to Fix this issue This is My Filter Code: HttpServletRequest req =(HttpServletRequest)request; HttpServletResponse res =(HttpServletResponse)response; HttpSession ses = req.getSession(true); String pageRequested =req.getRequestURL().toString(); if (ses.getAttribute("userDetails")!=null) { fc.doFilter(request,response); }else{ RequestDispatcher dis = request.getRequestDispatcher(LOGIN_PAGE); dis.forward(request,response); } This code inside the DoFilter Method I done all The settings in Web.xml deployment Descriptor

    Read the article

  • How to apply Abstract Factory Pattern ???

    - by Amit
    I am new to Design Pattern and I have a scenario here... and not sure as how to implement the pattern ... We have multiple vendors Philips, Onida... Each vendor (philips, onida...) may have different type of product i.e. Plasma or Normal TV I want specific product of each vendor using Abstract Factory Pattern... Thanks in advance for any help... My implementation so far... public enum TvType { Samsung = 0,LG = 1,Philips = 2, Sony = 3 } public enum Product { Plasma = 0,NormalTV = 1 } concrete class of each vendor.... that returns each product and also the interface that contains ProductInfo i.e. if Vendor is ... then it must have this product....

    Read the article

  • WPF data templates

    - by imekon
    I'm getting started with WPF and trying to get my head around connecting data to the UI. I've managed to connect to a class without any issues, but what I really want to do is connect to a property of the main window. Here's the XAML: <Window x:Class="test3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:custom="clr-namespace:test3" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <CollectionViewSource Source="{Binding Source={x:Static Application.Current}, Path=Platforms}" x:Key="platforms"/> <DataTemplate DataType="{x:Type custom:Platform}"> <StackPanel> <CheckBox IsChecked="{Binding Path=Selected}"/> <TextBlock Text="{Binding Path=Name}"/> </StackPanel> </DataTemplate> </Window.Resources> <Grid> <ListBox ItemsSource="{Binding Source={StaticResource platforms}}"/> </Grid> Here's the code for the main window: public partial class MainWindow : Window { ObservableCollection<Platform> m_platforms; public MainWindow() { m_platforms = new ObservableCollection<Platform>(); m_platforms.Add(new Platform("PC")); InitializeComponent(); } public ObservableCollection<Platform> Platforms { get { return m_platforms; } set { m_platforms = value; } } } Here's the Platform class: public class Platform { private string m_name; private bool m_selected; public Platform(string name) { m_name = name; m_selected = false; } public string Name { get { return m_name; } set { m_name = value; } } public bool Selected { get { return m_selected; } set { m_selected = value; } } } This all compiles and runs fine but the list box displays with nothing in it. If I put a breakpoint on the get method of Platforms, it doesn't get called. I don't understand as Platforms is what the XAML should be connecting to!

    Read the article

  • Where is the best place to find stock website templates?

    - by Billy ONeal
    I think I'm in the majority of programmers in saying I can't do visual design for s***. But I do write programs occasionally, and I'd like to have a nice website to tell people about said programs. I used to use a site called "OSWD" to find templates, but it's been forever since it's been looked at, and most of the designs seem overly specifically tailored to a single kind of site -- for example, a site featuring a large picture of an ice cube wouldn't make much sense for a site displaying software for people to use. I know there are plenty of template sites out there which have freely available designs, but I'm not sure which ones are good, and which ones are garbage. Where is the best place to find website templates?

    Read the article

  • Creating custom Android project templates in Eclipse?

    - by Rich
    Every app I make starts out with a number of common base classes, interfaces, utility classes and a basic package structure that has been working for me. Is there a way for me to set up a project template in Eclipse that will give me all of the basic Android project stuff PLUS a bunch of custom packages, classes and interfaces? I guess I could just put all of this stuff into one or more libraries as opposed to creating a whole project template, so if you have a preferred approach or information/links/etc on how to do any of the above, please share (I'm relatively inexperienced with Eclipse, so the more detail the better). Thanks.

    Read the article

  • Issues with taglibs while using jasmine-maven-plugin to test dojo widgets with templates

    - by user2880454
    I am using jasmine-maven-plugin to run javascript unit tests for my dojo widgets. One of my dojo widgets refers to a html template jsp file with taglibs. When I initialize my dojo widgets, I get the following error: Error: Invalid template: <%@ taglib uri="http://www.springframework.org/security/tags" prefix="sec"% The plugin uses jetty to deploy the scripts to test. I tried including jstl jar into the WEB-INF folder but it doesn't work. I am assuming it's just not DOJO and this taglib issue can occur even with simple js file. I am looking for some clue on why taglibs are not recognized here. If I remove the taglib entries, my tests just work fine.

    Read the article

< Previous Page | 26 27 28 29 30 31 32 33 34 35 36 37  | Next Page >