Search Results

Search found 9494 results on 380 pages for 'least squares'.

Page 300/380 | < Previous Page | 296 297 298 299 300 301 302 303 304 305 306 307  | Next Page >

  • Rails: Getting rid of generic "X is invalid" validation errors

    - by DJTripleThreat
    I have a sign-up form that has nested associations/attributes whatever you want to call them. My Hierarchy is this: class User < ActiveRecord::Base acts_as_authentic belongs_to :user_role, :polymorphic => true end class Customer < ActiveRecord::Base has_one :user, :as => :user_role, :dependent => :destroy accepts_nested_attributes_for :user, :allow_destroy => true validates_associated :user end class Employee < ActiveRecord::Base has_one :user, :as => :user_role, :dependent => :destroy accepts_nested_attributes_for :user, :allow_destroy => true validates_associated :user end I have some validation stuff in these classes as well. My problem is that if I try to create and Customer (or Employee etc) with a blank form I get all of the validation errors I should get plus some Generic ones like "User is invalid" and "Customer is invalid" If I iterate through the errors I get something like: user.login can't be blank User is invalid customer.whatever is blah blah blah...etc customer.some_other_error etc etc Since there is at least one invalid field in the nested User model, an extra "X is invalid" message is added to the list of errors. This gets confusing to my client and so I'm wondering if there is a quick way to do this instead of having to filer through the errors myself.

    Read the article

  • Exception calling UpdateModel - Value cannot be null or empty

    - by James Alexander
    This is probably something silly I'm missing but I'm definitely lost. I'm using .NET 4 RC and VS 2010. This is also my first attempt to use UpdateModel in .NET 4, but every time I call it, I get an exception saying Value cannont be null or empty. I've got a simple ViewModel called LogOnModel: [MetadataType(typeof(LogOnModelMD))] public class LogOnModel { public string Username { get; set; } public string Password { get; set; } public class LogOnModelMD { [StringLength(3), Required] public object Username { get; set; } [StringLength(3), Required] public object Password { get; set; } } } My view uses the new strongly typed helpers in MVC2 to generate a textbox for username and one for the password. When I look at FormCollection in my controller method, I see values for both coming through. And last but not least, here's are post controller methods: // POST: /LogOn/ [HttpPost] public ActionResult Index(FormCollection form) { var lm = new LogOnModel(); UpdateModel(lm, form); var aservice = new AuthenticationService(); if (!aservice.AuthenticateLocal(lm.Username, lm.Password)) { ModelState.AddModelError("User", "The username or password submitted is invalid, please try again."); return View(lm); } return Redirect("~/Home"); } Can someone please lend some insight into why UpdateModel would be throwing this exception? Thanks!

    Read the article

  • PHP package manager

    - by Mathias
    Hey, does anyone know a package manager library for PHP (as e.g. apt or yum for linux distros) apart from PEAR? I'm working on a system which should include a package management system for module management. I managed to get a working solution using PEAR, but using the PEAR client for anything else than managing a PEAR installation is not really the optimal solution as it's not designed for that. I would have to modify/extend it (e.g. to implement actions on installation/upgrade or to move PEAR specific files like lockfiles away from the system root) and especially the CLI client code is quite messy and PHP4. So maybe someone has some suggestions for an alternative PEAR client library which is easy to use and extend (the server side has some nice implementations like Pirum and pearhub) for completely different package management systems written in PHP (ideally including dependency tracking and different channels) for some general ideas how to implement such a PM system (yes, I'm still tinkering with the idea of implementing such a system from scratch) I know that big systems like Magento and symfony use PEAR for their PM. Magento uses a hacked version of the original PEAR client (which I'd like to avoid), symfony's implementation seems quite integrated with the framework, but would be a good starting point to at least write the client from scratch. Anyway, if anybody has suggestions: please :)

    Read the article

  • How to output multicolumn html without "widows"?

    - by user314850
    I need to output to HTML a list of categorized links in exactly three columns of text. They must be displayed similar to columns in a newspaper or magazine. So, for example, if there are 20 lines total the first and second columns would contain 7 lines and the last column would contain 6. The list must be dynamic; it will be regularly changed. The tricky part is that the links are categorized with a title and this title cannot be a "widow". If you have a page layout background you'll know that this means the titles cannot be displayed at the bottom of the column -- they must have at least one link underneath them, otherwise they should bump to the next column (I know, technically it should be two lines if I were actually doing page layout, but in this case one is acceptable). I'm having a difficult time figuring out how to get this done. Here's an example of what I mean: Shopping Link 3 Link1 Link 1 Link 4 Link2 Link 2 Link 3 Link 3 Cars Link 1 Music Games Link 2 Link 1 Link 1 Link 2 News As you can see, the "News" title is at the bottom of the middle column, and so is a "widow". This is unacceptable. I could bump it to the next column, but that would create an unnecessarily large amount of white space at the bottom of the second column. What needs to happen instead is that the entire list needs to be re-balanced. I'm wondering if anyone has any tips for how to accomplish this, or perhaps source code or a plug in. Python is preferable, but any language is fine. I'm just trying to get the general concept down.

    Read the article

  • Javascript "Match" Function Not Returning Proper Results in Safari or IE (but yes in FF)

    - by Jascha
    Forgive me as this is a time sensitive issue and I will have to switch the site back in a few hours so the link will be bad... but: I am simply comparing two strings looking for a match with this function... I have an array of objects called linkArray and I need to match the .src of each object to a .src I send it (the src of the clicked image). if the the src of the image I clicked matches the src of an object in my array, I set a variable to the link string of that object and return true, letting my page know that the link is available. Now, this works great in FF. But not in any other browser and I can't figure out for the life of me why. I have set up a dialogue box to literally compare, by eye, the two strings that should at the very least throw the message "match". Can anyone see what I am missing here??? here is the link... http://7thart.com/Jewish-History-and-Culture/Jews-and-Baseball-An-American-Love-Story If you click any of the thumbnails on the left, you will activate the function. Again, I apologize as after a few hours I have to switch back to the original site and this link will be invalid. Thanks in advance for your help. (function below)... function matchLink(a){ for(var i=0;i<linkArray.length;i++){ var fixLink = '../' + linkArray[i]['src']; alert(fixLink + '\n = \n' + a); if(fixLink == a){ alert('match'); newLink = linkArray[i]['link']; return true; } } return false; } Note: The "match" will return on two of the images.. the initial image, and the first thumbnail on the left. The second thumbnail SHOULD match, and the third one SHOULD NOT match.

    Read the article

  • Reorganizing development environment for single developer/small shop

    - by Matthew
    I have been developing for my company for approximately three years. We serve up a web portal using Microsoft .NET and MS SQL Server on DotNetNuke. I am going to leave my job full time at the end of April. I am leaving on good terms, and I really care about this company and the state of the web project. Because I haven't worked in a team environment in a long time, I have probably lost touch with what 'real' setups look like. When I leave, I predict the company will either find another developer to take over, or at least have developers work on a contractual basis. Because I have not worked with other developers, I am very concerned with leaving the company (and the developer they hire) with a jumbled mess. I'd like to believe I am a good developer and everything makes sense, but I have no way to tell. My question, is how do I set up the development environment, so the company and the next developer will have little trouble getting started? What would you as a developer like in place before working on a project you've never worked on? Here's some relevant information: There is a development server onsite and a production server offsite in a data center . There is a server where backups and source code (Sourcegear Vault) are stored. There is no formal documentation but there are comments in the code. The company budget is tight so free suggestions will help the best. I will be around after the end of April on a consulting basis so I can ask simple questions but I will not be available full time to train someone

    Read the article

  • Python and the self parameter

    - by Svend
    I'm having some issues with the self parameter, and some seemingly inconsistent behavior in Python is annoying me, so I figure I better ask some people in the know. I have a class, Foo. This class will have a bunch of methods, m1, through mN. For some of these, I will use a standard definition, like in the case of m1 below. But for others, it's more convinient to just assign the method name directly, like I've done with m2 and m3. import os def myfun(x, y): return x + y class Foo(): def m1(self, y, z): return y + z + 42 m2 = os.access m3 = myfun f = Foo() print f.m1(1, 2) print f.m2("/", os.R_OK) print f.m3(3, 4) Now, I know that os.access does not take a self parameter (seemingly). And it still has no issues with this type of assignment. However, I cannot do the same for my own modules (imagine myfun defined off in mymodule.myfun). Running the above code yields the following output: 3 True Traceback (most recent call last): File "foo.py", line 16, in <module> print f.m3(3, 4) TypeError: myfun() takes exactly 2 arguments (3 given) The problem is that, due to the framework I work in, I cannot avoid having a class Foo at least. But I'd like to avoid having my mymodule stuff in a dummy class. In order to do this, I need to do something ala def m3(self,a1, a2): return mymodule.myfun(a1,a2) Which is hugely redundant when you have like 20 of them. So, the question is, either how do I do this in a totally different and obviously much smarter way, or how can I make my own modules behave like the built-in ones, so it does not complain about receiving 1 argument too many.

    Read the article

  • Implementation of MVC with SQLite and NSURLConnection, use cases?

    - by user324723
    I'm interested in knowing how others have implemented/designed database & web services in their iphone app and how they simplified it for the entire application. My application is dependent on these services and I can't figure out a efficient way to use them together due to the (semi)complexity of my requirements. My past attempts on combining them haven't been completely successful or at least optimal in my mind. I'm building a database driven iphone app that uses a relational database in sqlite and consumes web services based on missing content or user interaction. Like this hasn't been done before...right? Since I am using a relational database - any web services consumed requires normalization, parsing the result and persisting it to the database before it can be displayed in a table view controller. The applications UI consists of nested(nav controller) table views where a user can select a cell and be taken to the next table view where it attempts to populate the table views data source from the database. If nothing exists in the database then it will send a request via web services to download its content, thus download - parse - persist - query - display. Since the user has the ability to request a refresh of this data it still requires the same process. Quickly describing what I've implemented and tried to run with - 1st attempt - Used a singleton web service class that handled sending web service requests, parsing the result and returning it to the table view controller via delegate protocols. Once the controller received that data it would then be responsible for persisting it to the database and re-returning the result. I didn't like the idea of only preventing the case where the app delegate selector doesn't exists(released) causing the app to crash. 2nd attempt - Used NSNotificationCenter for easy access to both database and web services but later realized it was more complex due to adding and removing observers per view(which isn't advised anyways).

    Read the article

  • Executing logic before save or validation with EF Code-First Models

    - by Ryan Norbauer
    I'm still getting accustomed to EF Code First, having spent years working with the Ruby ORM, ActiveRecord. ActiveRecord used to have all sorts of callbacks like before_validation and before_save, where it was possible to modify the object before it would be sent off to the data layer. I am wondering if there is an equivalent technique in EF Code First object modeling. I know how to set object members at the time of instantiation, of course, (to set default values and so forth) but sometimes you need to intervene at different moments in the object lifecycle. To use a slightly contrived example, say I have a join table linking Authors and Plays, represented with a corresponding Authoring object: public class Authoring { public int ID { get; set; } [Required] public int Position { get; set; } [Required] public virtual Play Play { get; set; } [Required] public virtual Author Author { get; set; } } where Position represents a zero-indexed ordering of the Authors associated to a given Play. (You might have a single "South Pacific" Play with two authors: a "Rodgers" author with a Position 0 and a "Hammerstein" author with a Position 1.) Let's say I wanted to create a method that, before saving away an Authoring record, it checked to see if there were any existing authors for the Play to which it was associated. If no, it set the Position to 0. If yes, it would find set the Position of the highest value associated with that Play and increment by one. Where would I implement such logic within an EF code first model layer? And, in other cases, what if I wanted to massage data in code before it is checked for validation errors? Basically, I'm looking for an equivalent to the Rails lifecycle hooks mentioned above, or some way to fake it at least. :)

    Read the article

  • Moving to an arbitrary position in a file in Python

    - by B Rivera
    Let's say that I routinely have to work with files with an unknown, but large, number of lines. Each line contains a set of integers (space, comma, semicolon, or some non-numeric character is the delimiter) in the closed interval [0, R], where R can be arbitrarily large. The number of integers on each line can be variable. Often times I get the same number of integers on each line, but occasionally I have lines with unequal sets of numbers. Suppose I want to go to Nth line in the file and retrieve the Kth number on that line (and assume that the inputs N and K are valid --- that is, I am not worried about bad inputs). How do I go about doing this efficiently in Python 3.1.2 for Windows? I do not want to traverse the file line by line. I tried using mmap, but while poking around here on SO, I learned that that's probably not the best solution on a 32-bit build because of the 4GB limit. And in truth, I couldn't really figure out how to simply move N lines away from my current position. If I can at least just "jump" to the Nth line then I can use .split() and grab the Kth integer that way. The nuance here is that I don't just need to grab one line from the file. I will need to grab several lines: they are not necessarily all near each other, the order in which I get them matters, and the order is not always based on some deterministic function. Any ideas? I hope this is enough information. Thanks!

    Read the article

  • Code-Golf: one line PHP syntax

    - by Kendall Hopkins
    Explanation PHP has some holes in its' syntax and occasionally in development a programmer will step in them. This can lead to much frustration as these syntax holes seem to exist for no reason. For example, one can't easily create an array and access an arbitrary element of that array on the same line (func1()[100] is not valid PHP syntax). The workaround for this issue is to use a temporary variable and break the statement into two lines, but sometimes that can lead to very verbose, clunky code. Challenge I know of a few of these holes (I'm sure there are more). It is quite hard to even come up with a solution, let alone in a code-golf style. Winner is the person with in the least characters total for all four Syntax Holes. Rules Statement must be one line in this form: $output = ...;, where ... doesn't contain any ;'s. Only use standard library functions (no custom functions allowed) Statement works identically to the assumed functional of the non-working syntax (even in cases that it fails). Statement must run without syntax error of any kind with E_STRICT | E_ALL. Syntax Holes $output = func_return_array()[$key]; - accessing an arbitrary offset (string or integer) of the returned array of a function $output = new {$class_base.$class_suffix}(); - arbitrary string concatenation being used to create a new class $output = {$func_base.$func_suffix}(); - arbitrary string concatenation being called as function $output = func_return_closure()(); - call a closure being returned from another function

    Read the article

  • C++ brain teaser

    - by mxp
    I recently refactored code like this (MyClass to MyClassR). class SomeMember { long m_value; public: SomeMember() : m_value(0) {} SomeMember(int a) : m_value(a) {} SomeMember(int a, int b) : m_value(a+b) {} }; class MyClass { SomeMember m_first, m_second, m_third; public: MyClass(const bool isUp, const int x, const int y) { if (isUp) { m_first = SomeMember(x); m_second = SomeMember(y); m_third = SomeMember(x, y); } else { m_first = SomeMember(y); m_second = SomeMember(x); m_third = SomeMember(y, x); } } }; class MyClassR { SomeMember m_first, m_second, m_third; public: MyClassR(const bool isUp, const int x, const int y) : m_first(isUp ? x : y) , m_second(isUp ? y : x) , m_third(isUp ? x, y : y, x) { } }; What is the error, why does it compile (at least VC6 with warning level 3 doesn't complain) and what is the right way of doing it? I (assume) I already have all these answers but I think it's and interesting problem to share.

    Read the article

  • Bootstrap - Typehead on multiple inputs

    - by Clem
    I have two text intputs, both have to run an autocompletion. The site is using Bootstrap, and the « typeahead » component. I have this HTML : <input type="text" class="js_typeahead" data-role="artist" /> <input type="text" class="js_typeahead" data-role="location" /> I'm using the « data-role » attribute (that is sent to the Ajax controller as a $_POST index), in order to determine what kind of data has to be retrieved from the database. The Javascript goes this way : var myTypeahead = $('input.js_typeahead').typeahead({ source: function(query, process){ var data_role; data_role = myTypeahead.attr('data-role'); return $.post('/ajax/typeahead', { query:query,data_role:data_role },function(data){ return process(data.options); }); } }); With PHP, I check what $_POST['data-role'] contains, an run the MySQL query (in this case, a query either on a list of Artists, or a list of Locations). But the problem is the second "typeahead" returns the same values than the first one (list of Artists). I assume it's because the listener is attached to the object « myTypeahead », and this way the "data-role" attribute which is used, will always be the same. I think I could fix it by using something like : data_role = $(this).attr('data-role'); But of course this doesn't work, as it's a different scope. Maybe I'm doing it all wrong, but at least maybe you people could give me a hint. Sorry if this has already been discussed, I actually searched but without success. Thanks in advance, Clem (from France, sorry for my english)

    Read the article

  • how to send value to the from action page from database

    - by Mayank swami
    I am creating a faq panel for there can be multiple answers for question and i want to take the answer id .because i am storing comment by answer id the problem is that how to sent the $answer_id to the comment_submit_process.php and how to recognize the answer ? $selected_ques= mysql_prep($_GET['ques']); $query = "SELECT * FROM formanswer where question_id = {$selected_ques}"; $ans= mysql_query($query); if($ans){ while($answer = mysql_fetch_array($ans)) //here is the form <form id="add-comment" action="comment_submit_process.php" > <textarea class="comment-submit-textarea" cols="78" name="comment" style="height: 64px;"></textarea> <input type="submit" name="submitbutton" value="Add Comment" class="comment-submit-button" > <br> <?php $ans_id= $answer['id']; echo $ans_id; ?> <input type="hidden" name="ques" value="<?php echo $_GET['$ans_id'] ?>" /> <span class="counter ">enter at least 15 characters</span> <span class="form-error"></span> </form> <?php }} ?>

    Read the article

  • Does unboxing just return a pointer to the value within the boxed object on the heap?

    - by Charles
    I this MSDN Magazine article, the author states (emphasis mine): Note that boxing always creates a new object and copies the unboxed value's bits to the object. On the other hand, unboxing simply returns a pointer to the data within a boxed object: no memory copy occurs. However, it is commonly the case that your code will cause the data pointed to by the unboxed reference to be copied anyway. I'm confused by the sentence I've bolded and the sentence that follows it. From everything else I've read, including this MSDN page, I've never before heard that unboxing just returns a pointer to the value on the heap. I was under the impression that unboxing would result in you having a variable containing a copy of the value on the stack, just as you began with. After all, if my variable contains "a pointer to the value on the heap", then I haven't got a value type, I've got a pointer. Can someone explain what this means? Was the author on crack? (There is at least one other glaring error in the article). And if this is true, what are the cases where "your code will cause the data pointed to by the unboxed reference to be copied anyway"? I just noticed that the article is nearly 10 years old, so maybe this is something that changed very early on in the life of .Net.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Validate HAML from ActiveRecord: scope/controller/helpers for link_to etc?

    - by Chris Boyle
    I like HAML. So much, in fact, that in my first Rails app, which is the usual blog/CMS thing, I want to render the body of my Page model using HAML. So here is app/views/pages/_body.html.haml: .entry-content= Haml::Engine.new(body, :format => :html5).render ...and it works (yay, recursion). What I'd like to do is validate the HAML in the body when creating or updating a Page. I can almost do that, but I'm stuck on the scope argument to render. I have this in app/models/page.rb: validates_each :body do |record, attr, value| begin Haml::Engine.new(value, :format => :html5).render(record) rescue Exception => e record.errors.add attr, "line #{(e.respond_to? :line) && e.line || 'unknown'}: #{e.message}" end end You can see I'm passing record, which is a Page, but even that doesn't have a controller, and in particular doesn't have any helpers like link_to, so as soon as a Page uses any of that it's going to fail to validate even when it would actually render just fine. So I guess I need a controller as scope for this, but accessing that from here in the model (where the validator is) is a big MVC no-no, and as such I don't think Rails gives me a way to do it. (I mean, I suppose I could stash a controller in some singleton somewhere or something, but... excuse me while I throw up.) What's the least ugly way to properly validate HAML in an ActiveRecord validator?

    Read the article

  • Dynamically invoke web service at runtime

    - by Ulrik Rasmussen
    So, our application needs support for dynamically calling web services which are unknown at compile time. The user should therefore be able to specify a URL to a WSDL, and specify some data bindings for the request and reply parameters. When Googling for answers, it seems like the way to do this is by actually compiling a web service proxy class at runtime, loading it, and invoking the methods using reflection. I think this seems like a rather clunky approach, given that I don't really need a strongly typed set of classes when I'm going to cast my data dynamically anyway. Dynamically compiling code for doing something that simple also just seems like The Wrong Way To Do It. Restricting ourself to the SOAP protocol, is there any library for C# that implements this protocol for dynamic use? I can imagine that it would be possible to generate runtime key/value data structures from the WSDL, which could be used to specify the request messages, as well as reading the replies. The library should then be able to send well-formed SOAP messages to the server, and parse the replies, without the programmer having to generate the XML manually (at least not the headers and other plumbing). I can't seem to find any library that actually does this. Is what I want to do really that esoteric, or have I just searched the wrong places? Thanks, Ulrik

    Read the article

  • Force windows video driver reload. Is it possible at all?

    - by somemorebytes
    Hi there, Some drivers use parameters written in the registry to configure themselves when they get loaded at boot time. I can modify those values and then reboot, but I would like to know if it is possible to force the driver reload, making the changes effective without rebooting. Specifically, I am talking about the video driver (nvidia). I read somewhere, that calling through pINvoke() [User32.ll]::ChangeDisplaySettings() with a 640x480x8bits resolution,(which is so low that it should not be supported by a modern driver) will force windows to load the "Standard VGA driver", and making another call with the current resolution will load the nvidia driver again. This does not work though. At least in Windows 7, even if the low res is not displayed as "supported" the system reduces the screen to a little square in the center of the screen, showing the low res wihtout unloading the nvidia driver. So, is there any .NET/Win32 API, service to restart, or any way at all to force a video driver reload? Perhaps programatically disabling the device (as you could do from the Device Manager) and reenabling it again? Any idea? Thanks a lot.

    Read the article

  • Intel MKL memory management and exceptions

    - by Andrew
    Hello everyone, I am trying out Intel MKL and it appears that they have their own memory management (C-style). They suggest using their MKL_malloc/MKL_free pairs for vectors and matrices and I do not know what is a good way to handle it. One of the reasons for that is that memory-alignment is recommended to be at least 16-byte and with these routines it is specified explicitly. I used to rely on auto_ptr and boost::smart_ptr a lot to forget about memory clean-ups. How can I write an exception-safe program with MKL memory management or should I just use regular auto_ptr's and not bother? Thanks in advance. EDIT http://software.intel.com/sites/products/documentation/hpc/mkl/win/index.htm this link may explain why I brought up the question UPDATE I used an idea from the answer below for allocator. This is what I have now: template <typename T, size_t TALIGN=16, size_t TBLOCK=4> class aligned_allocator : public std::allocator<T> { public: pointer allocate(size_type n, const void *hint) { pointer p = NULL; size_t count = sizeof(T) * n; size_t count_left = count % TBLOCK; if( count_left != 0 ) count += TBLOCK - count_left; if ( !hint ) p = reinterpret_cast<pointer>(MKL_malloc (count,TALIGN)); else p = reinterpret_cast<pointer>(MKL_realloc((void*)hint,count,TALIGN)); return p; } void deallocate(pointer p, size_type n){ MKL_free(p); } }; If anybody has any suggestions, feel free to make it better.

    Read the article

  • Migrate Data and Schema from MySQL to MSSQL

    - by colithium
    Are there any free solutions for automatically migrating a database from MySQL to MSSQL Server that "just works"? I've been attempting this simple (at least I thought so) task all day now. I've tried: MSSQL Server Management Studio's Import Data feature Create an empty database Tasks - Import Data... .NET Framework Data Provider for Odbc Valid DSN (verified it connects) Copy data from one or more tables or views Check 1 VERY simple table Click Preview Get Error: The preview data could not be retrieved. ADDITIONAL INFORMATION: ERROR [42000] [MySQL][ODBC 5.1 Driver][mysqld-5.1.45-community]You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '"table_name"' at line 1 (myodbc5.dll) A similar error occurs if I go through the rest of the wizard and perform the operation. The failed step is "Setting Source Connection" the error refers to retrieving column information and then lists the above error. It can retrieve column information just fine when I modify column mappings so I really don't know what the issue is. I've also tried getting various MySql tools to output ddl statements that MSSQL understand but haven't succeeded. I've tried with MySQL v5.1.11 to SQL Server 2005 and with MySQL v5.1.45 to SQL Server 2008 (with ODBC drivers 3.51.27.00 and 5.01.06.00 respectively)

    Read the article

  • Floated element not included in parent, causing margin-bottom problems

    - by Christian Mann
    Right, so I've got a section of a page: <div class="article"> <div class="author"> <img src="images/officers/john_q_public_thm.jpg" /> <span class="name">John Q. Public</span> <span class="position">President</span> </div> <abbr class="postdate"> <span class="month m-01">Jan</span> <span class="day d-31">31</span> <span class="year y-2009">2009</span> </abbr> <div class="content"> <h2 class="title">Article Title</h2> <p>Pellentesque habitant morbi...facilisis luctus, metus</p> <p>Pellentesque habitant morbi...facilisis luctus, metus</p> </div> </div> <div class="article">...</div> <div class="article">...</div> The author and abbr divs are floated to the left. Each one of these article divs needs to be separated from its siblings by 5px or so. However, the author div is extending beyond the technical "height" of the div. The margin-bottom is doing nothing, as the space is being taken up by the floated author. This is somewhat difficult to envision, so I've placed it on my web server Is there any way to force the parent to be at least as tall as all of the floated elements within? If anyone figures out what I'm saying, thanks.

    Read the article

  • HTTP Negotiate windows vs. Unix server implementation using python-kerberos

    - by ondra
    I tried to implement a simple single-sign-on in my python web server. I have used the python-kerberos package which works nicely. I have tested it from my Linux box (authenticating against active directory) and it was without problem. However, when I tried to authenticate using Firefox from Windows machine (no special setup, just having the user logged into the domain + added my server into negotiate-auth.trusted-uris), it doesn't work. I have looked at what is sent and it doesn't even resemble the things the Linux machine sends. This Microsoft description of the process pretty much resembles the way my interaction from Linux works, but the Windows machine generally sends a very short string, which doesn't even resemble the things microsoft documentation states, and when base64 decoded, it is something like 12 zero bytes followed by 3 or 4 non-zero bytes (GSS functions then return that it doesn't support such scheme) Either there is something wrong with the client Firefox settings, or there is some protocol which I am supposed to follow for the Negotiate protocol, but which I cannot find any reference anywhere. Any ideas what's wrong? Do you have any idea what protocol I should by trying to find, as it doesn' look like SPNEGO, at least from MS documentation.

    Read the article

  • How do I create a Status Icon / System Tray Icon with custom text and transparent background using P

    - by Raugturi
    Here is the code that I have so far to define the icon: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, w, h) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 0, 0, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) This works to get the png into the icon, but falls short in two areas. First, transparency is not working. If I use a 22x22 png with transparent background and the image centered, I end up with sections of other active icons showing up inside of mine, like this: http://i237.photobucket.com/albums/ff311/Raugturi/22x22_image_with_transparency.png The icon it choose to steal from is somewhat random. Sometimes it's part of the dropbox icon, others the NetworkManager Applet. If I instead use this code: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, 22, 22) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 3, 6, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) And an image that is only 16x11 with the transparent edges removed, what I end up with is this: Same URL but file is 16x11_image_positioned_in_middle.png So how do I end up with a transparent block like the 1st one that doesn't pull in stuff from other icons? As for the second problem, I need the ability to write on the image before converting it to the icon. I tried using draw_glyphs and it told me I should be using Pango layout/context instead. Unfortunately all the Pango tutorials I could find deal with actual windows, not the status icon. Is there a good tutorial out there for Pango that would apply to this issue (and also maybe have at least some explanation of how to tell it what font to use as all of them that I found seem to lack this and it won't write anything without it). Note: Sorry for the lack of actual images and only one working link, apparently this is a spam prevention feature due to my lack of reputation.

    Read the article

  • How can I generate an "unlimited" world?

    - by snowlord
    I would like to create a game with an endless (in reality an extremely large) world in which the player can move about. Whether or not I will ever get around to implement the game is one matter, but I find the idea interesting and would like some input on how to do it. The point is to have a world where all data is generated randomly on-demand, but in a deterministic way. Currently I focus on a large 2D map from which it should be possible to display any part without knowledge about the surrounding parts. I have implemented a prototype by writing a function that gives a random-looking, but deterministic, integer given the x and y of a pixel on the map (see my recent question about this function). Using this function I populate the map with "random" values, and then I smooth the map using a simple filter based on the surrounding pixels. This makes the map dependent on a few pixels outside its edge, but that's not a big problem. The final result is something that at least looks like a map (especially with a good altitude color map). Given this, one could maybe first generate a coarser map which is used to generate bigger differences in altitude to create mountain ranges and seas. Anyway, that was my idea, but I am sure that there exist ways to do this already and I also believe that given the specification, many of you can come up with better ideas. EDIT: Forgot the link to my question.

    Read the article

< Previous Page | 296 297 298 299 300 301 302 303 304 305 306 307  | Next Page >