Search Results

Search found 23449 results on 938 pages for 'browser close'.

Page 301/938 | < Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308 | Next Page >

Coherent access to mainframe files from Win32 application and IBM RDZ/Eclipse?

- by Ira Baxter

I have a suite of tools for processing IBM COBOL source code; these tools are built as Win32 applications and talk to Windows (including network) files using traditional Windows file system calls (open, close, read, write) and work just fine, thank you. I'd like to integrate these with Eclipse; we understand how to get Eclipse to do UI for us we think. The problem is that Eclipse/RDZ users access mainframe files through some IBM magic. In How does RDZ access mainframe files I tried to understand how Eclipse accessed files on a mainframe. Apparantly Eclipse/RDZ has a secret filesystem access backdoor not available to normal mortals. At issue is how our tools, reading some Windows-accessible file (local disk file, NFS to mainframe, ...) can associate such files with the files that Eclipse can access or is using? Ideally we'd like UI-integrated versions of our tools take an Eclipse file-name string for a mainframe file, pass it to our Windows application to process, have the Windows application open/read/process the file, and return results associated with that file to the Eclipse UI. Is there a canonical file name path that would be used with mainframe NFS that would be equivalent to the name or access object the Eclipse RDZ used to access the same file? Are all operations doable internally by Eclipse, doable by the mainframe NFS [for instance, can NFS read/update an element in a partitioned data set? Can Eclipse RDZ? Does it matter?] Is the mainframe file access available to custom Java code running under Eclipse RDZ (e.g., equivalents of open/close/read/write based on filename/path/something?) If so, can somebody steer me towards documentation describing the access methods? Anybody else already solve this problem or have a good suggestion?

Read the article
Blackberry MDS simulator - Can't connect to the internet in the simulator.

- by bcoyour

I'm trying to do some testing of a website through the Blackberry simulator, while the simulator works fine, I can't get to any sites in the Blackberry Browser. Here is the specific setup I'm using. I'm Windows 7 (64-bit) Home Edition I have the latest (at the time) MDS installation - BlackBerry Email and MDS Services Simulators 4.1.4 Finally, I have the latest (at the time) Blackberry Simulator - BlackBerry Smartphone Simulators 5.0.0 (5.0.0.442) - 9700 I first start the MDS service, it briefly pops up the command-prompt and then closes it. I'm assuming that when it does that, it started the MDS service. Then I open the Blackberry simulator (9700), which opens up fine and loads the Blackberry OS. Then with the Blackberry OS all loaded up, I navigate to the browser and for example type www.google.com and then at the bottom it just says "sending request" and loads for about a minute. Then times out and says it can't find a connection. Anyone have any thoughts on what I'm missing? Or, does anyone know of an online simulator for the Blackberry, because thus far this has been a huge pain for testing sites on a Blackberry. Thank you! Ben

Read the article
Problems with QDialog in Qt

- by Martin

I'm using Qt for Symbian. I have some problems with a QDialog that I open from a QMenu. The QDialog shows up fine and in the QDialog I have a QDialogButtonBox with a button to Close the QDialog. BUT if I close the QDialog and then open it from the QMenu again, it will show up but the button from the QDialogButtonBox will not show up. Instead the buttons from the QMainWindow will show but they are grayed out. How can I get the QDialog buttons to show every time? Maybe I have some problems with setting focus on the QDialog? I really can't see what I'm doing wrong here. It's not much code that I use, you can try it yourself. This is my code: In QMainWindow I use the following to create the menu: QAction *menuButton = new QAction("Menu", this); menuButton->setSoftKeyRole(QAction::PositiveSoftKey); QMenu *menu = new QMenu(this); menuButton->setMenu(menu); QAction *popup = new QAction("Show popup",this); connect(popup, SIGNAL(triggered()), this, SLOT(showPopup())); menu->addAction(popup); addAction(menuButton); This shows the QDialog: void MyMainWindow::showPopup(){ TestDialog *test = new TestDialog(this); test->setAttribute(Qt::WA_DeleteOnClose); test->show(); } This is the TestDialog: TestDialog::TestDialog(QWidget *parent) : QDialog(parent) { ui.setupUi(this); QDesktopWidget* desktopWidget = QApplication::desktop(); QRect rect = desktopWidget->availableGeometry(); this->setFixedWidth(rect.width()); }

Read the article
JQuery not Working in chrome?

- by Pete Herbert Penito

Hi everyone! I have some code here which works perfectly in firefox but not in chrome or IE, my javascript is thus ` $(document).ready(function() { $("#clientLoginPop").show(); $("#clientLoginPop").animate({"left": "-=400px"}, "fast"); }); $("#clientLoginCloseLink").click(function () { $("#clientLoginPop").animate({"left": "+=400px"}, "fast"); }); $("#contactUsPopLink").click(function () { $("#contactUsPop").show(); $("#contactUsPop").animate({"left": "-=437px"}, "fast"); }); $("#contactUsClose").click(function () { $("#contactUsPop").animate({"left": "+=474px"}, "fast"); }); }); ` and finally the css of the div looks like this, i think rather importantly it's aligned to the right of the browser: (the client login div looks similar just a different height) ` #contactUsPop { width:437px; right:-437px; margin-top:220px; position:fixed; height:217px; background-color:white; z-index:2; } ` so what happens in firefox is the div animates to the left and then when it closes it moves back to the right. when in chrome the div doesn't seem to pop up at all? the URL of the site is this: http://clearcreativegroup.com/devcorner/clear3/ the tabs are on the right hand side of the browser, any advice would help tons, thank you!

Read the article
Problem with closing excel by c#

- by phenevo

Hi, I've got unit test with this code: Excel.Application objExcel = new Excel.Application(); Excel.Workbook objWorkbook = (Excel.Workbook)(objExcel.Workbooks._Open(@"D:\Selenium\wszystkieSeba2.xls", true, false, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value, Missing.Value)); Excel.Worksheet ws = (Excel.Worksheet)objWorkbook.Sheets[1]; Excel.Range r = ws.get_Range("A1", "I2575"); DateTime dt = DateTime.Now; Excel.Range cellData = null; Excel.Range cellKwota = null; string cellValueData = null; string cellValueKwota = null; double dataTransakcji = 0; string dzien = null; string miesiac = null; int nrOperacji = 1; int wierszPoczatkowy = 11; int pozostalo = 526; cellData = r.Cells[wierszPoczatkowy, 1] as Excel.Range; cellKwota = r.Cells[wierszPoczatkowy, 6] as Excel.Range; if ((cellData != null) && (cellKwota != null)) { object valData = cellData.Value2; object valKwota = cellKwota.Value2; if ((valData != null) && (valKwota != null)) { cellValueData = valData.ToString(); dataTransakcji = Convert.ToDouble(cellValueData); Console.WriteLine("data transakcji to: " + dataTransakcji); dt = DateTime.FromOADate((double)dataTransakcji); dzien = dt.Day.ToString(); miesiac = dt.Month.ToString(); cellValueKwota = valKwota.ToString(); } } r.Cells[wierszPoczatkowy, 8] = "ok"; objWorkbook.Save(); objWorkbook.Close(true, @"C:\Documents and Settings\Administrator\Pulpit\Selenium\wszystkieSeba2.xls", true); objExcel.Quit(); Why after finish test I'm still having excel in process (it does'nt close) And : is there something I can improve to better perfomance ??

Read the article
Call Multiple Stored Procedures with the Zend Framework

- by Brian Fisher

I'm using Zend Framework 1.7.2, MySQL and the MySQLi PDO adapter. I would like to call multiple stored procedures during a given action. I've found that on Windows there is a problem calling multiple stored procedures. If you try it you get the following error message: SQLSTATE[HY000]: General error: 2014 Cannot execute queries while other unbuffered queries are active. Consider using PDOStatement::fetchAll(). Alternatively, if your code is only ever going to run against mysql, you may enable query buffering by setting the PDO::MYSQL_ATTR_USE_BUFFERED_QUERY attribute. I found that to work around this issue I could just close the connection to the database after each call to a stored procedure: if (strtoupper(substr(PHP_OS, 0, 3)) === 'WIN') { //If on windows close the connection $db->closeConnection(); } This has worked well for me, however, now I want to call multiple stored procedures wrapped in a transaction. Of course, closing the connection isn't an option in this situation, since it causes a rollback of the open transaction. Any ideas, how to fix this problem and/or work around the issue. More info about the work around Bug report about the problem

Read the article
Python - Code snippet not working on Python 2.5.6, using IDLE

- by Francisco P.

Hello, everyone I am using a piece of self-modifying code for a college project. Here it is: import datetime import inspect import re import sys def main(): # print the time it is last run lastrun = 'Mon Jun 8 16:31:27 2009' print "This program was last run at ", print lastrun # read in the source code of itself srcfile = inspect.getsourcefile(sys.modules[__name__]) f = open(srcfile, 'r') src = f.read() f.close() # modify the embedded timestamp timestamp = datetime.datetime.ctime(datetime.datetime.now()) match = re.search("lastrun = '(.*)'", src) if match: src = src[:match.start(1)] + timestamp + src[match.end(1):] # write the source code back f = open(srcfile, 'w') f.write(src) f.close() if __name__=='__main__': main() Unfortunately, it doesn't work. Error returned: # This is the script's output This program is last run at Mon Jun 8 16:31:27 2009 # This is the error message Traceback (most recent call last): File "C:\Users\Rui Gomes\Desktop\teste.py", line 30, in <module> main() File "C:\Users\Rui Gomes\Desktop\teste.py", line 13, in main srcfile = inspect.getsourcefile(sys.modules[__name__]) File "C:\Python31\lib\inspect.py", line 439, in getsourcefile filename = getfile(object) File "C:\Python31\lib\inspect.py", line 401, in getfile raise TypeError('{!r} is a built-in module'.format(object)) TypeError: <module '__main__' (built-in)> is a built-in module I'd be thankful for any solutions.

Read the article
Forking with Pipes

- by Luke

Hello I have tried to do fork() and piping in main and it works perfectly fine but when I try to implement it in a function for some reason I don't get any output, this is my code: void cmd(int **pipefd,int count,int type, int last); int main(int argc, char *argv[]) { int pipefd[3][2]; int i, total_cmds = 3,count = 0; int in = 1; for(i = 0; i < total_cmds;i++){ pipe(pipefd[count++]); cmd(pipefd,count,i,0); } /*Last Command*/ cmd(pipefd,count,i,1); exit(EXIT_SUCCESS); } void cmd(int **pipefd,int count,int type, int last){ int child_pid,i,i2; if ((child_pid = fork()) == 0) { if(count == 1){ dup2(pipefd[count-1][1],1); /*first command*/ } else if(last!=0){ dup2(pipefd[count - 2][0],0); /*middle commands*/ dup2(pipefd[count - 1][1],1); } else if(last == 1){ dup2(pipefd[count - 1][0],0); /*last command*/ } for(i = 0; i < count;i++){/*close pipes*/ for(i2 = 0; i2 < 2;i2++){ close(pipefd[i][i2]); }} if(type == 0){ execlp("ls","ls","-al",NULL); } else if(type == 1){ execlp("grep","grep",".bak",NULL); } else if(type==2){ execl("/usr/bin/wc","wc",NULL); } else if(type ==3){ execl("/usr/bin/wc","wc","-l",NULL); } perror("exec"); exit(EXIT_FAILURE); } else if (child_pid < 0) { perror("fork"); exit(EXIT_FAILURE); } } I checked the file descriptors and it is opening the right ones, not sure what the problem could be..

Read the article
Wysiwyg with image copy/paste

- by jW

First, I understand that an image cannot be "copied" from a local machine into a website. I understand that it must be uploaded. I am a web programmer, and am familiar with common web wysiwyg tools such as TinyMCE and FCKEditor. My question is if there exists a program or web module or something of the sort that works will perform an automatic upload of images for a wysiwyg. I have a client that is constantly complaining about not being able to copy/paste documents with images from MS Word into a wysiwyg to create content on their website. I have looked into TX Text Control (http://labs.textcontrol.com/) and was looking into a possibly flash wysiwyg that could upload the file automatically behind the scenes. I don't know if this exists, and google did not much help me in my search, so I thought I would ask other coders. I am open to any sort of server technology, or browser requirements. I am looking for some browser based tool instead of an application tool such as Dreamweaver or otherwise. If no good solution to the problem exists, I am willing to accept that at this point. Note: This was a request from a client, and to me it seemed rather unreasonable. I decided to gather community advice instead of just tell the client 'No' and the options here have been extremely helpful and informative in presenting possible solutions.

Read the article
How to unencode escaped XML with xQuery

- by mbrevoort

I have a variable in xQuery of type xs:string with the value of an encoded HTML snippet (the content of a twitter tweet). It looks like this: Headlines-Today • AP sources: <b>Obama</b> pick for Justice post withdraws : News - Rest Of World - <a href="http://shar.es/mqMAG">http://shar.es/mqMAG</a> When I try to write this out in an HTML block, I need the string to be unescaped so that the HTML snippet will be interpreted by the browser. Instead the string is getting written out as is and the browser is rendering it as just text (so you see <a href="blah.... ). Here's how I'm writing out this string: {$entry/atom:content/text()} How can I have the escaped characters unencoded so it writes < rather tha < ? I've tried to do a replacelike this but it always replaces the < with < ! fn:replace($s, "<", "<")

Read the article
GZIP Java vs .NET

- by Jim Jones

Using the following Java code to compress/decompress bytes[] to/from GZIP. First text bytes to gzip bytes: public static byte[] fromByteToGByte(byte[] bytes) { ByteArrayOutputStream baos = null; try { ByteArrayInputStream bais = new ByteArrayInputStream(bytes); baos = new ByteArrayOutputStream(); GZIPOutputStream gzos = new GZIPOutputStream(baos); byte[] buffer = new byte[1024]; int len; while((len = bais.read(buffer)) >= 0) { gzos.write(buffer, 0, len); } gzos.close(); baos.close(); } catch (IOException e) { e.printStackTrace(); } return(baos.toByteArray()); } Then the method that goes the other way compressed bytes to uncompressed bytes: public static byte[] fromGByteToByte(byte[] gbytes) { ByteArrayOutputStream baos = null; ByteArrayInputStream bais = new ByteArrayInputStream(gbytes); try { baos = new ByteArrayOutputStream(); GZIPInputStream gzis = new GZIPInputStream(bais); byte[] bytes = new byte[1024]; int len; while((len = gzis.read(bytes)) > 0) { baos.write(bytes, 0, len); } } catch (IOException e) { e.printStackTrace(); } return(baos.toByteArray()); } Think there is any effect since I'm not writing out to a gzip file? Also I noticed that in the standard C# function that BitConverter reads the first four bytes and then the MemoryStream Write function is called with a start point of 4 and a length of input buffer length - 4. So is that effect the validity of the header? Jim

Read the article
javascript addEventListener onStateChange not working in IE

- by user347456

Hi, I have two colorbox popup boxes which show a youtube video in each. When they're finished playing, I'm trying to have them automatically close the colorbox window. This code below works perfect in firefox, but in IE I can't get addEventListener to work. I've tried attachEvent with no success. Can anybody offer any suggestions as to how to solve this? It seems simple but I'm exhausted trying to find a solution. By the way, this is my first time as stackoverflow and it's very impressive. var params = { allowScriptAccess: "always" }; var atts = { id: "ytplayer1" }; swfobject.embedSWF("http://www.youtube.com/v/VIDEO1&rel=0&hl=en_US&fs=0&autoplay=1&enablejsapi=1&playerapiid=ytvideo1", "popupVideoContainer1", "640", "385", "8", null, null, params, atts); var params2 = { allowScriptAccess: "always" }; var atts2 = { id: "ytplayer2" }; swfobject.embedSWF("http://www.youtube.com/v/VIDEO2&rel=0&hl=en_US&fs=0&autoplay=1&enablejsapi=1&playerapiid=ytvideo2", "popupVideoContainer2", "640", "385", "8", null, null, params2, atts2); function onYouTubePlayerReady(playerId) { if(playerId == 'ytvideo1'){ var ytplayer = document.getElementById('ytplayer1'); ytplayer.addEventListener("onStateChange", "onytplayerStateChange", false); } else if(playerId == 'ytvideo2'){ var ytplayer = document.getElementById("ytplayer2"); //ytplayer.addEventListener("onStateChange", "onytplayerStateChange", false); if (ytplayer.addEventListener) { ytplayer.addEventListener("onStateChange", "onytplayerStateChange", false); } else if (ytplayer.attachEvent) { ytplayer.attachEvent("onStateChange", onytplayerStateChange); } } } function onytplayerStateChange(newState) { if(newState == 0){ $.fn.colorbox.close(); } }

Read the article
x-dom-event-stream in Opera 10 Only Working on First Event

- by Brad

I have a python script (in the CherryPy framework) that sends Event: and data: text as this Opera blog post describes to a client browser. The javascript that recieves the x-dom-event-stream content is almost identical to what they show in the blog post. However, the browser displays only the first event sent. Anyone know what I'm missing? I tried a few older versions of Opera and found that it works in Opera 9.52 but not in any newer versions. What did they change? Here is the python code: class dumpData(object): def index(self): cherrypy.response.headers['Content-Type'] = "application/x-dom-event-stream" def yieldData(): i = 0 while 1: yield "Event: count\n" yield "data: " yield i yield "\n\n" i = i + 1 time.sleep(3); return yieldData() index._cp_config = {'response.stream': True} index.exposed = True And here is the javascript/html. Making a request to /data/ runs the python function above. <head> <script> onload = function() { document.getElementById("count").addEventListener("cout", cout, false); } function count(e) { document.getElementById("stream").firstChild.nodeValue = e.data; } </script> <event-source id="count" src="/data/"> </head> <body> <div id="stream"></div> </body> Opening the direct /data/ url in Firefox saves the stream to a file. So I know the output is in the correct format and that the stream works at all.

Read the article
How should bug tracking and help tickets integrate?

- by Max Schmeling

I have a little experience with bug tracking systems such as FogBugz where help tickets are issues are (or can be) bugs, and I have some experience using a bug tracking system internally completely separate from a help center system. My question is, in a company with an existing (home-grown) help center system where replacing it is not an option, how should a bug tracking system (probably Mantis) be integrated into the process? Right now help tickets get put in for issues, questions, etc and they get assigned to the appropriate person (PC Tech, Help Desk staff, or if it's an application issue they can't solve in the help desk it gets assigned to a developer). A user can put a request for small modifications or fixes to an application in a help ticket and the developer it gets assigned to will make the change at some point, apply their time to that ticket, and then close the ticket when it goes to production. We don't currently have a bug tracking system, so I'm looking into the best way to integrate one. Should we just take the help tickets and put it into the bug tracking system if it's a bug (or issue or feature request) and then close the ticket if it's not an emergency fix? We probably don't want to expose the bug tracking system to anyone else as they wouldn't know what to put in the help center system and what to put in the bug tracker... right? Any thoughts? Suggestions? Tips? Advice? To-dos? Not to-dos? etc...

Read the article
Payapl sandbox a/c in Dotnet..IPN Response Invaild

- by Sam

Hi, I am Integrating paypal to mysite.. i use sandbox account,One Buyer a/c and one more for seller a/c...and downloaded the below code from paypal site string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } and when add this snippets in pageload event of success page i get the ipn response as INVALID but amount paid successfully but i am getting invalid..any help..Paypal Docs in not Clear. thanks in advance

Read the article
How can I improve my real-time behavior in multi-threaded app using pthreads and condition variables

- by WilliamKF

I have a multi-threaded application that is using pthreads. I have a mutex() lock and condition variables(). There are two threads, one thread is producing data for the second thread, a worker, which is trying to process the produced data in a real time fashion such that one chuck is processed as close to the elapsing of a fixed time period as possible. This works pretty well, however, occasionally when the producer thread releases the condition upon which the worker is waiting, a delay of up to almost a whole second is seen before the worker thread gets control and executes again. I know this because right before the producer releases the condition upon which the worker is waiting, it does a chuck of processing for the worker if it is time to process another chuck, then immediately upon receiving the condition in the worker thread, it also does a chuck of processing if it is time to process another chuck. In this later case, I am seeing that I am late processing the chuck many times. I'd like to eliminate this lost efficiency and do what I can to keep the chucks ticking away as close to possible to the desired frequency. Is there anything I can do to reduce the delay between the release condition from the producer and the detection that that condition is released such that the worker resumes processing? For example, would it help for the producer to call something to force itself to be context switched out? Bottom line is the worker has to wait each time it asks the producer to create work for itself so that the producer can muck with the worker's data structures before telling the worker it is ready to run in parallel again. This period of exclusive access by the producer is meant to be short, but during this period, I am also checking for real-time work to be done by the producer on behalf of the worker while the producer has exclusive access. Somehow my hand off back to running in parallel again results in significant delay occasionally that I would like to avoid. Please suggest how this might be best accomplished.

Read the article
Large Reports for MSRS

- by Greg Lorenz

I have a report that needs to be able to render a very large amount of pages (about 4500 in this instance) in a web browser. The total time needed to finish on the report server from start time to end time is about 30 mins for the instance that I am looking at. Does anyone know what options exist for handling the rendering of such a large report in a web browser? In terms of looking into how this can be resolved I have already performed the following tasks. The report gets its data off of a database table that already has the data flattened to the point that the TimeDataRetrieval on the report server is 17812 or about 18 secs. The report itself has been reformatted to include the least expensive report objects that it can in order to render the data in the correct format. I basically consists of a table with about 4 nested tables and thats it. We were trying to accomplish this on a 2005 report server but continued to run into memory issues that were not feasible for our clients. In response to that we moved this onto a 2008 report server to take advantage of the fact that it uses the file system instead of memory and finally were able to get this to work without running out of the available memory but of course it takes much longer.

Read the article
Find the flaws in the concept...

- by Trindaz

A web based web browser. Sounds silly right? Here's a use case. All comments about what could go wrong, and if anyone has tried and failed at this, very much wanted User goes to www.theBrowser.com and logs in with credentials specific to theBrowser.com. User tells theBrowser what their username and password for various sites are User goes to theBrowser.com/?uri=somesite.com theBrowser sends off the http request with User's log in details, then sends the http response back to User. This lets theBrowser do weird and wonderful functions like change colours / style sheets / etc. to every site that gets passed through it. From a technical stand point, storing username and password and passing them along is not a challenge for one user, but if there were a few, I'd have to use some kind of server based browser software to store a session per user logged in at theBrowser.com. How could I do that? Will I have to start from scratch? Obviously privacy and security are issues. Would theBrowser.com be too great a risk, even if users are fully warned? Cheers, Dave

Read the article
Jquery getJSON() doesn't work when trying to get data from java server on localhost

- by bellesebastien

The whole day yesterday I've been trying to solve this but it's proven to be very challenging for me. I'm trying to use this JS to get information from a java application I wrote. $(document).ready(function() { $.getJSON('http://localhost/custest?callback=?', function(json) { alert('OK'); $('.result').html(json.description); }); }); The Java application uses httpServer and is very basic. When I access the page 'http://localhost/custest?callback=?' with Firefox, the browser shows me the server is sending me json data and asks with what to open it with, but when I try it from a webpage using the JS above it doesn't work. The getJSON call is not successful, the alert("ok") doesn't popup at all. If it replace "http://localhost/custest?callback=?" in the JS with "http://twitter.com/users/usejquery.json?callback=?" everything works fine. An interesting thing is that if I send malformed JSON from my java server Firebug gives an error and tells me what is missing from the JSON so that mean the browser is receiving the JSON data, but when I send it correct a JSON string nothing happens, no errors, not even the alert() opens. I'm adding the headers in case you think these could be relevant. http://localhost/custest?callback=jsonp1274691110349 GET /custest?callback=jsonp1274691110349 HTTP/1.1 Host: localhost User-Agent: Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3 Accept: */* Accept-Language: en-us,en;q=0.5 Accept-Encoding: gzip,deflate Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive: 115 Connection: keep-alive HTTP/1.1 200 OK Transfer-Encoding: chunked Content-Type: application/json Thanks for your help

Read the article
How can I enable PHP5 for a site? Having problems with every single method.

- by user347662

I'm working on a client site that is hosted on someone's DIY Debian Linux server [Apache/1.3.33 (Debian GNU/Linux)], and I'm trying to install a script that requires PHP5. By default, the server parses .php files with PHP 4.3.10-22, which is configured at /etc/php4/apache/php.ini, according to phpinfo(). On the server I can see a config directory for PHP5 adjacent to the PHP4 directory: /etc/php5.0/apache2/php.ini. I have tried multiple methods to enable PHP5 for the document root where the site's files are hosted, including all available methods mentioned here. By far, the most common suggestion I've found is to add one or both of the following lines to the site's .htaccess file: AddHandler application/x-httpd-php5 .php AddType application/x-httpd-php5 .php Trouble is, when either or both of those lines are present, the site forces my browser to download any .php files requested, without parsing the PHP at all. All of the other methods mentioned in the above article cause a 500 Internal Server Error. There is no hosting control panel I can access in a browser to enable PHP5 for the site, but I do have shell access. When I asked the server administrator about this issue, he encouraged me to search for the answer on Google. Where could I begin to troubleshoot this issue? Are there ways to test or verify the server's specific PHP5 installation and configuration, using the command line or some other method? Do you have other suggestions to enable PHP5?

Read the article
destroy cfwindow in javascript 'is not a function'

- by Ryan French

Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

Read the article
MS-Access: What could cause one form with a join query to load right and another not?

- by Daniel Straight

Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

Read the article
how to fix gateway timeout error in php???

- by developer

Iam having a php file that sends text messages on mobile to all the users that i have in my database's particular table. Now the entries are like 2000 or so in number and this number will keep on increasing. On my page there is a small form that selects a list of the users to whom message is to be sent from a drop down and then user writes the text to be sent in a textarea and then on clicking the submit button php script stars sending the messages to mobile numbers. Now while trying to send messages my browser has shown gateway timeout error but the script kept on running and messages are sent to the mobiles but not once but 6 times. I checked my script my query and all the code is correct.This all happened coz of that gateway timeout. Now does this gateway timeout kepts the script running again and again till the browser is not closed?? is this was the reason that a single message was sent 6 times to mobile numbers?? I mean how can i escape my file from getting this gateway error so that one message is sent only one time to a number??

Read the article
How can I terminate a system command with alarm in Perl?

- by rockyurock

I am running the below code snippet on Windows. The server starts listening continuously after reading from client. I want to terminate this command after a time period. If I use alarm() function call within main.pl, then it terminates the whole Perl program (here main.pl), so I called this system command by placing it in a separate Perl file and calling this Perl file (alarm.pl) in the original Perl File using the system command. But in this way I was unable to take the output of this system() call neither in the original Perl File nor in called one Perl File. Could anybody please let me know the way to terminate a system() call or take the output in that way I used above? main.pl my @output = system("alarm.pl"); print"one iperf completed\n"; open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; alarm.pl alarm 30; my @output_1 = readpipe("adb shell cd /data/app; ./iperf -u -s -p 5001"); open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; In both ways display.txt is always empty.

Read the article
Search for string allowing for one mismatches in any location of the string, Python

- by Vincent

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

Read the article

< Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308 | Next Page >