Search Results

Search found 25093 results on 1004 pages for 'console output'.

Page 301/1004 | < Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308  | Next Page >

  • add two float values in java

    - by user1845286
    acually i try to add two float values in java like this import java.text.DecimalFormat; class ExactDecimalValue { final strictfp static public void main(String... arg) { float f1=123.00000f; float f2=124.00000f; float f3=f1+f2; System.out.println(f1+f2); System.out.println("sum of two floats:"+f3); /*my expected output is:247.00000 but comming output is:247.0 and 247*/ } } Now what i can do to get the value in this format:247.00000. please any one help me. Thanks & Regards venkatesh

    Read the article

  • HTML block nested in PHP if statement - is this considered bad practice?

    - by JYelton
    Consider the following example: <table> <tr> <td>Row One</td> </tr> <?php if ($rowtwo) { ?> <tr> <td>Row Two</td> </tr> <?php } ?> </table> If $rowtwo is true, the second row is output, otherwise it is skipped. The code works as desired, however I am evaluating Netbeans (7 beta) as a PHP IDE (instead of just using a text editor). Netbeans flags the code with an error: Misplaced non-space characters insided [sic] a table. Should I consider an alternate way of writing this code, or is Netbeans incapable of understanding this flow control wrapper for HTML output?

    Read the article

  • Retrieving data from simplexml_load_file

    - by Kole Odd
    Working with the simplexml_load_file() function, I get a side effect. To understand what I mean, see this code: $result = simplexml_load_file($xml_link); $arr = array(); foreach ($result->element as $elem) { $arr[] = $elem->number[0]; } print_r($arr); Output: Array ( [0] => SimpleXMLElement Object ( [0] => 330411879136 ) [1] => SimpleXMLElement Object ( [0] => 370346266228 ) [2] => SimpleXMLElement Object ( [0] => 370346266223 ) ) How would I store data into the array so that output would look like so: Array ( [0] => 330411879136 [1] => 370346266228 [2] => 370346266223 )

    Read the article

  • calling java class file through windows service in .net

    - by Kaumadee Wijewantha
    i have creared windows service from C# for calling java class file. i have used bat file to call this java file in C#. the task of the java class is create output file. but the when stated the service output file wasnt created. java class is worked perfeclty with out servise when it invoke from bat file. (but may task manger shows instantiates of command prompt.) is it possible to call java class through bat file in windws servise?

    Read the article

  • How to access controls collection of dynamically loaded aspx page?

    - by Naasir
    Let's say I have two webforms, A.aspx and B.aspx, where B.aspx contains some simple web controls such as a textbox and a button. I'm trying to do the following: When A.aspx is requested, I want to dynamically call and load B.aspx into memory and output details of all the controls contained in B.aspx. Here is what I tried in the codebehind for A.aspx: var compiledType = BuildManager.GetCompiledType("~/b.aspx"); if (compiledType != null) { var pageB = (Page)Activator.CreateInstance(compiledType); } foreach (var control in pageB.Controls) { //output some details for each control, like it's name and type... } When I try the code above, the controls collection for pageB is always empty. Any ideas on how I can get this to work? Some other important details: both webforms utilize a master page (so the web controls in b.aspx are actually placed within a "content" tag) I've also tried using BuildManager.CreateInstanceFromVirtualPath. No luck.

    Read the article

  • Map wont show rigth in Joomla

    - by user1653126
    I have the following code of a map using api google, I have tested the code in several html editor and its work perfectly, but when i upload in my web page doesn’t work. The map appears all zoomed in some random point in the ocean. I create an article in Joomla 1.5.20, paste the code. Its shows right in the preview but not in the web page. I disable filtering and use none editor and still won’t work. Thanks for the help. <!DOCTYPE html> <html> <head> <meta name="viewport" content="initial-scale=1.0, user-scalable=no" /> <style type="text/css"> html { height: 100% } body { height: 100%; margin: 0; padding: 0 } #map_canvas { height: 100% } </style> <script type="text/javascript" src="http://maps.googleapis.com/maps/api/js?key=AIzaSyBInlv7FuwtKGhzBP0oISDoB2Iu79HNrPU&sensor=false"> </script> <script type="text/javascript"> var map; // lets define some vars to make things easier later var kml = { a: { name: "Productor", url: "https://maps.google.hn/maps/ms?authuser=0&vps=2&hl=es&ie=UTF8&msa=0&output=kml&msid=200984447026903306654.0004c934a224eca7c3ad4" }, b: { name: "A&S", url: "https://maps.google.hn/maps/ms?ie=UTF8&authuser=0&msa=0&output=kml&msid=200984447026903306654.0004c94bac74cf2304c71" } // keep adding more if ye like }; // initialize our goo function initializeMap() { var options = { center: new google.maps.LatLng(13.324182,-87.080071), zoom: 9, mapTypeId: google.maps.MapTypeId.TERRAIN } map = new google.maps.Map(document.getElementById("map_canvas"), options); var ctaLayer = new google.maps.KmlLayer('https://maps.google.hn/maps/ms?authuser=0&vps=5&hl=es&ie=UTF8&oe=UTF8&msa=0&output=kml&msid=200984447026903306654.0004c94bc3bce6f638aa1'); ctaLayer.setMap(map); var ctaLayer = new google.maps.KmlLayer('https://maps.google.hn/maps/ms?authuser=0&vps=2&ie=UTF8&msa=0&output=kml&msid=200984447026903306654.0004c94ec7e838242b67d'); ctaLayer.setMap(map); createTogglers(); }; google.maps.event.addDomListener(window, 'load', initializeMap); // the important function... kml[id].xxxxx refers back to the top function toggleKML(checked, id) { if (checked) { var layer = new google.maps.KmlLayer(kml[id].url, { preserveViewport: true, suppressInfoWindows: true }); google.maps.event.addListener(layer, 'click', function(kmlEvent) { var text = kmlEvent.featureData.description; showInContentWindow(text); }); function showInContentWindow(text) { var sidediv = document.getElementById('content_window'); sidediv.innerHTML = text; } // store kml as obj kml[id].obj = layer; kml[id].obj.setMap(map); } else { kml[id].obj.setMap(null); delete kml[id].obj; } }; // create the controls dynamically because it's easier, really function createTogglers() { var html = "<form><ul>"; for (var prop in kml) { html += "<li id=\"selector-" + prop + "\"><input type='checkbox' id='" + prop + "'" + " onclick='highlight(this,\"selector-" + prop + "\"); toggleKML(this.checked, this.id)' \/>" + kml[prop].name + "<\/li>"; } html += "<li class='control'><a href='#' onclick='removeAll();return false;'>" + "Limpiar el Mapa<\/a><\/li>" + "<\/ul><\/form>"; document.getElementById("toggle_box").innerHTML = html; }; // easy way to remove all objects function removeAll() { for (var prop in kml) { if (kml[prop].obj) { kml[prop].obj.setMap(null); delete kml[prop].obj; } } }; // Append Class on Select function highlight(box, listitem) { var selected = 'selected'; var normal = 'normal'; document.getElementById(listitem).className = (box.checked ? selected: normal); }; </script> <style type="text/css"> .selected { font-weight: bold; } </style> </head> <body> <div id="map_canvas" style="width: 80%; height: 400px; float:left"></div> <div id="toggle_box" style="position: absolute; top: 100px; right: 640px; padding: 10px; background: #fff; z-index: 5; "></div> <div id="content_window" style="width:10%; height:10%; float:left"></div> </body> </html>

    Read the article

  • Find -type d with no subfolders

    - by titatom
    Good morning ! This is a simple one I believe, but I am still a noob :) I am trying to find all folders with a certain name. I am able to do this with the command find /path/to/look/in/ -type d | grep .texturedata The output gives me lots of folders like this : /path/to/look/in/.texturedata/v037/animBMP But I would like it to stop at .texturedata : /path/to/look/in/.texturedata/ I have hundreds of these paths and would like to lock them down by piping the output of grep into chmod 000 I was given a command with the argument -dpe once, but I have no idea what it does and the Internet has not be able to help me determine it's usage Thanks you very much for your help !

    Read the article

  • PHPMailer echo's from successful sent email

    - by Chris
    Hello I finally got PHPMailer to work with Google but now I am finding out that I am getting this output to the screen after the message has been sent. SMTP -> FROM SERVER:220 mx.google.com ESMTP f34sm21891943qco.35 SMTP -> FROM SERVER: 250-mx.google.com at your service, [76.28.109.170] 250-SIZE 35651584 250-8BITMIME 250-AUTH LOGIN PLAIN XOAUTH 250 ENHANCEDSTATUSCODES SMTP -> FROM SERVER:250 2.1.0 OK f34sm21891943qco.35 SMTP -> FROM SERVER:250 2.1.5 OK f34sm21891943qco.35 SMTP -> FROM SERVER:354 Go ahead f34sm21891943qco.35 SMTP -> FROM SERVER:250 2.0.0 OK 1276700936 f34sm21891943qco.35 I was wondering if there was any way to remove this output so the users don't see it?

    Read the article

  • ruby confusing -- local variable or instance_method ?

    - by boblu
    I have the following program. module C def self.included(base) base.extend(ClassMethods) end module ClassMethods def test_for class_eval <<-DEFINECLASSMETHODS def self.my_method(param_a) puts "SELF is: #{self.inspect}" puts param_a puts "#{param_a}" end DEFINECLASSMETHODS end end end class A include C end class B < A test_for end when I run B.new.my_method("aaa"), I got this error NameError: undefined local variable or method `param_a' for B:Class I am quite confused. I define param_a as a local variable in class method my_method, puts param_a runs good, and will output the "aaa". however, puts "#{param_a}" output that error. why? Can anyone explain this?

    Read the article

  • My rewrite rule is not working

    - by DijkeMark
    I need to make a rewrite rule for a page, but it does not work. I do have mod_rewrite for apache enabled This is my .htacces file: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^gameofthrones/(full|house|characters)\.(all|Stark|Lannister)\.(html|xml|json)$ index.php?output=$3&house=$2&info=$1 </IfModule> But when I enter this url: localhost/school/str-webservices/eindopdracht/index.php?output=html&house=all&info=full It stays that way, but it should be something like: localhost/school/str-webservices/eindopdracht/gameofthrones/full/all/html What am I doing wrong? Thanks in advance, Mark

    Read the article

  • CakePHP Form Helper - Show error class, but not error message

    - by Jeremy Penrod
    I'm attempting to customize the error output on the CakePHP 2.0 form helper. Currently, the form renders error messages below the input and applies an 'error' class to the input's label. I have found that I can either disable error reporting altogether for an input, or output the error class and message. I would like the error class to be applied to the label of the offending inputs WITHOUT any message below. How do you turn off the error message outputting for a form, BUT still apply error classes to offending labels?

    Read the article

  • Firing events in script task

    - by Anonymouslemming
    I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

    Read the article

  • t-sql getting leaf nodes

    - by stackoverflowuser
    Based on following table (I have kept spaces between the rows for clarity) Path ----------- \node1\node2\node3 \node1\node2\node3\node5 \node1\node6\node3 \node1\node4\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9 \node1\node4\node3\node9\node10 I want to get all the paths containing leaf node. So for instance, following will be considered leaf nodes for path \node1\node4\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9\node10 The following will be the output: Output --------------------------- \node1\node2\node3\node5 \node1\node6\node3 \node1\node4\node3\node7 \node1\node4\node3\node8 \node1\node4\node3\node9\node10 Pls. suggest. Thanks.

    Read the article

  • how to find and add a string to a file in linux

    - by user2951644
    How can I check a file for a string if missing the string automatically add it for example Input Input file test.txt this is a test text for testing purpose this is a test for testing purpose this is a test for testing purpose this is a test text for testing purpose I would like to add "text" to all the lines Desired Output this is a test text for testing purpose this is a test text for testing purpose this is a test text for testing purpose this is a test text for testing purpose Is it possible? many thanks in advance Hi guys thanks for all the help, for my case is not that simple. I wont know which line will be different and in the middle string it will not only have a single string. i will give a clearer case Input file test.txt Group: IT_DEPT,VIP Role: Viewer Dept: IT Group: IT_DEPT,VIP Dept: IT Group: FINANCE LOAN VIEWER Role: Viewer Dept: FINANCE Group: FINANCE LOAN VIEWER Dept: FINANCE Desired output file test2.txt Group: IT_DEPT,VIP Role: Viewer Dept: IT Group: IT_DEPT,VIP Role: - Dept: IT Group: FINANCE LOAN VIEWER Role: Viewer Dept: FINANCE Group: FINANCE LOAN VIEWER Role: - Dept: FINANCE So those that are missing "Role:" will be added "Role: - ", hope this clear things out, thanks in advance again

    Read the article

  • Concatinate integer arrays iteratively

    - by Ojtwist
    I have a methode in2.getImagesOneDim() which gives me an array of integers, to be more precise the pixel values of an image. Now i want to create one big array with all the pixel values of all the images. Therefore I have to call this method several times. Now I would like to concatenate the previous output to the current output until all images are read. In some kind of pseudo code, where the + is a concatination ... : for (int i = 1; i < 25; i++) { ConArray = ConArray + in2.getImagesOneDim("../images/"+i); } How would I do this in java ?

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • How can I get the JSON array data from nsstring or byte in xcode 4.2?

    - by user1471568
    I'm trying to get values from nsdata class and doesn't work. here is my JSON data. { "count": 3, "item": [{ "id": "1", "latitude": "37.556811", "longitude": "126.922015", "imgUrl": "http://175.211.62.15/sample_res/1.jpg", "found": false }, { "id": "3", "latitude": "37.556203", "longitude": "126.922629", "imgUrl": "http://175.211.62.15/sample_res/3.jpg", "found": false }, { "id": "2", "latitude": "37.556985", "longitude": "126.92286", "imgUrl": "http://175.211.62.15/sample_res/2.jpg", "found": false }] } and here is my code -(NSDictionary *)getDataFromItemList { NSData *dataBody = [[NSData alloc] initWithBytes:buffer length:sizeof(buffer)]; NSDictionary *iTem = [[NSDictionary alloc]init]; iTem = [NSJSONSerialization JSONObjectWithData:dataBody options:NSJSONReadingMutableContainers error:nil]; NSLog(@"id = %@",[iTem objectForKey:@"id"]); //for Test output = [[NSString alloc] initWithBytes:buffer length:rangeHeader.length encoding:NSUTF8StringEncoding]; NSLog(@"%@",output); return iTem; } how can I access every value in the JSON? Please help me.

    Read the article

  • Detecting when a process has finished (but not exited)

    - by Egwor
    I have a program that's run in unix (that I have no control over) that when finished prints 'Completed successfully' but does not exit. I want to automatically detect when the process finishes (by checking the output of the command), so that I can kill the process and so that I can proceed do other activities. The complexity comes because I want to be able to run multiples of these scripts concurrently. (One activity I need to do requires the script to be called with various inputs, but each time the script runs it takes a while to return, and so I want to do them in parallel) Has anyone done something similar to this? I could redirect the stderr and stdout output of the command to a temporary file which has a random file name, then tail the file and pipe to grep for the end conditions (I.e. the certain log lines). The problem is, surely tail -f would keep running, and so it would never exit. Should I poll? If so, what's the best approach?

    Read the article

  • Using template specialization in C++

    - by user550413
    How can I write a function using template specialization that has 2 different input types and an output type: template <class input1, class input2, class output> and return the sum of the 2 numbers (integers/doubles). However, if I get 2 integers I want to return an integer type but for any other combinations of integer and double I'll always return double. I am trying to do that without using directly the '+' operator but having the next functions instead: double add_double_double(double a, double b) {return (a+b);} double add_int_double(int a, double b) {return ((double)(a)+b);} int add_int_int(int a, int b) {return (a+b);}

    Read the article

  • Increment number in string

    - by iform
    Hi, I am stumped... I am trying to get the following output until a certain condition is met. test_1.jpg test_2.jpg .. test_50.jpg The solution (if you could remotely call it that) that I have is fileCount = 0 while (os.path.exists(dstPath)): fileCount += 1 parts = os.path.splitext(dstPath) dstPath = "%s_%d%s" % (parts[0], fileCount, parts[1]) however...this produces the following output. test_1.jpg test_1_2.jpg test_1_2_3.jpg .....etc The Question: How do I get change the number in its current place (without appending numbers to the end)? Ps. I'm using this for a file renaming tool.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • How does the stream manipulators work?

    - by Narek
    It is well known that the user can define stream manipulators like this: ostream& tab(ostream & output) { return output<< '\t'; } And this can be used in main() like this: cout<<'a'<<tab<<'b'<<'c'<<endl; Please explain me how does this all work? If operator<< assumes as a second parameter a pointer to the function that takes and returns ostream &, then please explain my why it is necessary? What would be wrong if the function does not take and return ostream & but it was void instead of ostream &? Also it is interesting why “dec”, “hex” manipulators take effect until I don’t change between them, but user defined manipulators should be always used in order to take effect for each streaming?

    Read the article

  • Mysql query problem

    - by Lost_in_code
    Below is a sample table: fruits +-------+---------+ | id | type | +-------+---------+ | 1 | apple | | 2 | orange | | 3 | banana | | 4 | apple | | 5 | apple | | 6 | apple | | 7 | orange | | 8 | apple | | 9 | apple | | 10 | banana | +-------+---------+ Following are the two queries of interest: SELECT * FROM fruits WHERE type='apple' LIMIT 2; SELECT COUNT(*) AS total FROM fruits WHERE type='apple'; // output 6 I want to combine these two queries so that the results looks like this: +-------+---------+---------+ | id | type | total | +-------+---------+---------+ | 1 | apple | 6 | | 4 | apple | 6 | +-------+---------+---------+ The output has to be limited to 2 records but it should also contain the total number of records of the type apple. How can this be done with 1 query?

    Read the article

  • Getting Null value with JSON from MySQL, how to retrive data from MySQL to JSON correctly?

    - by sky
    I'm using following code but cannot return data from MySQL. This is the output: <script type="text/javascript"> var somethings= [null,null,null]; </script> It does have three post, but I couldn't get the title(message) output. EDIT: this is the code I'm using: <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT * FROM posts', $session); $somethings= array(); while ($row= mysql_fetch_assoc($result)) { $somethings[]= $row['something']; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> This is the table: message Try iPhone post! Welcome to Yo~ :) ??!

    Read the article

  • EF Stored Procedure Complex Type

    - by Web Dev
    I am using EF4. I am somewhat confused on on the Entity Framework Complex name. When I go to Functional Import of a Stored Procedure name and it ask me to type in the Complex name, is that supposed to be the name of of a class that can handle that output. For examle, say if my stored procedure returns FirstName, LastName. Is the Complex name supposed to be a class that can handle that output in this case PersonName? public class PersonName { public string FirstName {get; set;} public string LastName {get;set} }

    Read the article

< Previous Page | 297 298 299 300 301 302 303 304 305 306 307 308  | Next Page >