Search Results

Search found 22263 results on 891 pages for 'desktop background'.

Page 304/891 | < Previous Page | 300 301 302 303 304 305 306 307 308 309 310 311  | Next Page >

  • How to create StackedBarSeries with custom tooltip without losing standard colors

    - by Simon_Weaver
    I have a StackedBarSeries in Silverlight 4 charting (latest release). I have created a DataPointStyle called MyDataPointStyle for a custom tooltip. By itself this breaks the standard palette used for the different bars. I've applied a custom palette - as described in David Anson's blog to the chart. However when I have the DataPointStyle set for my SeriesDefinition objects it does not use this palette. I'm not sure what I'm missing - but David specifically says : ... it enables the use of DynamicResource (currently only supported by the WPF platform) to let users customize their DataPointStyle without inadvertently losing the default/custom Palette colors. (Note: A very popular request!) Unfortunately I'm inadvertently losing these colors - and I can't see why? <chartingToolkit:Chart.Palette> <dataviz:ResourceDictionaryCollection> <ResourceDictionary> <Style x:Key="DataPointStyle" TargetType="Control"> <Setter Property="Background" Value="Blue"/> </Style> </ResourceDictionary> <ResourceDictionary> <Style x:Key="DataPointStyle" TargetType="Control"> <Setter Property="Background" Value="Green"/> </Style> </ResourceDictionary> <ResourceDictionary> <Style x:Key="DataPointStyle" TargetType="Control"> <Setter Property="Background" Value="Red"/> </Style> </ResourceDictionary> </dataviz:ResourceDictionaryCollection> </chartingToolkit:Chart.Palette> <chartingToolkit:Chart.Series> <chartingToolkit:StackedBarSeries> <chartingToolkit:SeriesDefinition IndependentValueBinding="{Binding SKU}" DependentValueBinding="{Binding Qty}" DataPointStyle="{StaticResource MyDataPointStyle}" Title="Regular"/> <chartingToolkit:SeriesDefinition IndependentValueBinding="{Binding SKU}" DependentValueBinding="{Binding Qty}" DataPointStyle="{StaticResource MyDataPointStyle}" Title="FSP Orders"/> <chartingToolkit:StackedBarSeries.IndependentAxis> <chartingToolkit:CategoryAxis Title="SKU" Orientation="Y" FontStyle="Italic" AxisLabelStyle="{StaticResource LeftAxisStyle}"/> </chartingToolkit:StackedBarSeries.IndependentAxis> <chartingToolkit:StackedBarSeries.DependentAxis> <chartingToolkit:LinearAxis Orientation="X" ExtendRangeToOrigin="True" Minimum="0" ShowGridLines="True" /> </chartingToolkit:StackedBarSeries.DependentAxis> </chartingToolkit:StackedBarSeries > </chartingToolkit:Chart.Series> </chartingToolkit:Chart>

    Read the article

  • css nth-child(2n+1) repaint css after filtering out list items

    - by Michael
    I have a list of 20+ items. The background-color changes using the :nth-child(2n+1) selector. (ie. even item black, odd item white). When I click a button to filter out specific items using the jQuery Isotope plugin it adds a .isotope-hidden class to the items I want to filter out, which changes the position of the list item to 0,0 and opacity to 0. When this happens the remaining items are left with the original black/white background-colors, which are now no longer in order. Does anyone know a way to "repaint' the css using the :nth-child(2n+1) selector on the items that do not contain the .isotope-hidden class. I tried #element tr:not(.isotope-hidden):nth-child(2n+1) with no avail. Any help would be appreciated. Thank you.

    Read the article

  • C# connecting with RDP

    - by user311130
    |????| Hey, I want to connect to a remote desktop connection to a specified server/username from c#. I have found: _http://www.databaseforum.info/2/22/0a0e1d2da27798df.html a AxMSTSCLib dll should be referenced to the solution. I don't want to download this dll from anywhere as I'm not sure if I can trust it. However it also says: "After research on the web I found that I have to create new AxMSTSCLib and MSTSCLib DLLs. So I did" How do I "create" this new AxMSTSCLib ? Other link, doesn't use this dll but run an script instead. _http://bytes.com/topic/c-sharp/answers/517024-remote-desktop-connection-c but that code throws Security Exception. So I cannot use it. Thanks for any help |????|

    Read the article

  • Installing flex on Mac Parallels

    - by Ali Syed
    Hello folks, I am trying to install Flex 3 on my Windows 7 Virtual machine (parallels desktop) on my Mac Pro. The problem seems to be some sort of conflict between the copy of Flex 3 Builder installed on Mac OS X. The installer tries to install Flex in x:/Program Files/Adobe/Flex Builder 3/ but since Parallels Desktop connects all directories, there resides the Flex Builder 3 installation of MAC. I get this error Log: !SESSION 2010-04-22 16:09:23.031 ----------------------------------------------- eclipse.buildId=unknown java.version=1.5.0_11 java.vendor=Sun Microsystems Inc. BootLoader constants: OS=win32, ARCH=x86, WS=win32, NL=de_DE Framework arguments: -application org.eclipse.update.core.standaloneUpdate -command install -from file:\C:\Program Files\Adobe\Flex Builder 3 Windose\com.adobe.flexbuilder.update.site/ -featureId com.adobe.flexbuilder.feature.standalone -version 3.0.214193 Command-line arguments: -application org.eclipse.update.core.standaloneUpdate -command install -from file:\C:\Program Files\Adobe\Flex Builder 3 Windose\com.adobe.flexbuilder.update.site/ -featureId com.adobe.flexbuilder.feature.standalone -version 3.0.214193 !ENTRY org.eclipse.update.core 4 0 2010-04-22 16:09:29.187 !MESSAGE Cannot install featurecom.adobe.flexbuilder.feature.standalone 3.0.214193

    Read the article

  • Video/audio streaming does not stop even if UIWebView is closed - iPad

    - by lostInTransit
    Hi I see this issue only on the iPad. The same things works as expected on the iPhone. I am opening the URL from my application in a UIWebView. If the URL is a normal web page, it works fine as expected. But if the URL is that of a remote video/audio file, the UIWebView opens the default player which is again good. Now when I dismiss the UIWebView (by clicking on the Done button on the player), the streaming doesn't stop and the audio/video keeps playing in the background (I cannot see it but it does keep playing in the background, can hear it). The UIViewController in which the webview was created is also dealloced (I put in a log statement in the dealloc method) but the streaming doesn't stop. Can someone please help me out on why this could be happening? And how can I stop the audio/video streaming when the UIWebView is closed? Thanks.

    Read the article

  • Injection of banners in my webbrowsers possible malware

    - by Skadlig
    Recently I have started to suspect that I have some kind of virus on my computer. There are 3 symptoms: Banners are being displayed on pages that doesn't use commercials, for instance when viewing screen-shots on Steam. It is only displayed after the rest of the page has been loaded and seems to be injected into it. The whole page is replaced with a commercial with the option to skip the commercial. The page is replaced with a search window claiming that the page could not be found. I have tried to scan my computer with Antivir and Adaware but only found a couple of tracking cookies. I have run HijackThis but since this isn't really my area I haven't been able to discern what shouldn't be there except the line about zonealarm since I have uninstalled it. Is there anyone out there who is able to see if there is anything suspicious in the log-file at the end or has suggestions regarding programs that might be better to find the virus than Antivir and Adaware? Here is the whole (long) log: Logfile of Trend Micro HijackThis v2.0.2 Scan saved at 21:44:07, on 2010-04-15 Platform: Unknown Windows (WinNT 6.01.3504) MSIE: Internet Explorer v8.00 (8.00.7600.16385) Boot mode: Normal Running processes: C:\Windows\SysWOW64\HsMgr.exe C:\Program Files (x86)\Personal\bin\Personal.exe F:\Program Files (x86)\Apache Software Foundation\Apache2.2\bin\ApacheMonitor.exe C:\Program Files (x86)\Avira\AntiVir Desktop\avgnt.exe F:\Program Files (x86)\PowerISO\PWRISOVM.EXE C:\Program Files (x86)\Java\jre6\bin\jusched.exe C:\Program Files\ASUS Xonar DX Audio\Customapp\ASUSAUDIOCENTER.EXE F:\Program Files (x86)\Voddler\service\VNetManager.exe C:\Program Files (x86)\Emotum\Mobile Broadband\Mobile.exe F:\Program Files\Logitech\SetPoint\x86\SetPoint32.exe C:\Program Files (x86)\Lavasoft\Ad-Aware\AAWTray.exe F:\Program Files (x86)\Mozilla Firefox\firefox.exe F:\Program Files (x86)\Trend Micro\HijackThis\HijackThis.exe R1 - HKCU\Software\Microsoft\Internet Explorer\Main,Search Page = http://go.microsoft.com/fwlink/?LinkId=54896 R0 - HKCU\Software\Microsoft\Internet Explorer\Main,Start Page = http://go.microsoft.com/fwlink/?LinkId=69157 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Default_Page_URL = http://go.microsoft.com/fwlink/?LinkId=69157 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Default_Search_URL = http://go.microsoft.com/fwlink/?LinkId=54896 R1 - HKLM\Software\Microsoft\Internet Explorer\Main,Search Page = http://go.microsoft.com/fwlink/?LinkId=54896 R0 - HKLM\Software\Microsoft\Internet Explorer\Main,Start Page = http://go.microsoft.com/fwlink/?LinkId=69157 R0 - HKLM\Software\Microsoft\Internet Explorer\Search,SearchAssistant = R0 - HKLM\Software\Microsoft\Internet Explorer\Search,CustomizeSearch = R0 - HKLM\Software\Microsoft\Internet Explorer\Main,Local Page = C:\Windows\SysWOW64\blank.htm R0 - HKCU\Software\Microsoft\Internet Explorer\Toolbar,LinksFolderName = F2 - REG:system.ini: UserInit=userinit.exe O2 - BHO: AcroIEHelperStub - {18DF081C-E8AD-4283-A596-FA578C2EBDC3} - C:\Program Files (x86)\Common Files\Adobe\Acrobat\ActiveX\AcroIEHelperShim.dll O2 - BHO: gwprimawega - {83bb5261-81ec-25ae-4adf-e88936738525} - C:\Windows\SysWow64\aZfJupUw.dll O2 - BHO: ZoneAlarm Toolbar Registrar - {8A4A36C2-0535-4D2C-BD3D-496CB7EED6E3} - C:\Program Files\CheckPoint\ZAForceField\WOW64\TrustChecker\bin\TrustCheckerIEPlugin.dll (file missing) O2 - BHO: Windows Live inloggningshjälpen - {9030D464-4C02-4ABF-8ECC-5164760863C6} - C:\Program Files (x86)\Common Files\Microsoft Shared\Windows Live\WindowsLiveLogin.dll O2 - BHO: Java(tm) Plug-In 2 SSV Helper - {DBC80044-A445-435b-BC74-9C25C1C588A9} - C:\Program Files (x86)\Java\jre6\bin\jp2ssv.dll O3 - Toolbar: ZoneAlarm Toolbar - {EE2AC4E5-B0B0-4EC6-88A9-BCA1A32AB107} - C:\Program Files\CheckPoint\ZAForceField\WOW64\TrustChecker\bin\TrustCheckerIEPlugin.dll (file missing) O4 - HKLM..\Run: [avgnt] "C:\Program Files (x86)\Avira\AntiVir Desktop\avgnt.exe" /min O4 - HKLM..\Run: [PWRISOVM.EXE] f:\Program Files (x86)\PowerISO\PWRISOVM.EXE O4 - HKLM..\Run: [SunJavaUpdateSched] "C:\Program Files (x86)\Java\jre6\bin\jusched.exe" O4 - HKLM..\Run: [QuickTime Task] "F:\Program Files (x86)\QuickTime\QTTask.exe" -atboottime O4 - HKLM..\Run: [Adobe Reader Speed Launcher] "C:\Program Files (x86)\Adobe\Reader 9.0\Reader\Reader_sl.exe" O4 - HKLM..\Run: [VoddlerNet Manager] f:\Program Files (x86)\Voddler\service\VNetManager.exe O4 - HKCU..\Run: [Steam] "f:\program files (x86)\steam\steam.exe" -silent O4 - HKCU..\Run: [msnmsgr] "C:\Program Files (x86)\Windows Live\Messenger\msnmsgr.exe" /background O4 - Global Startup: BankID Security Application.lnk = C:\Program Files (x86)\Personal\bin\Personal.exe O4 - Global Startup: Logitech SetPoint.lnk = ? O4 - Global Startup: Monitor Apache Servers.lnk = F:\Program Files (x86)\Apache Software Foundation\Apache2.2\bin\ApacheMonitor.exe O13 - Gopher Prefix: O16 - DPF: {1E54D648-B804-468d-BC78-4AFFED8E262F} (System Requirements Lab) - http://www.nvidia.com/content/DriverDownload/srl/3.0.0.4/srl_bin/sysreqlab_nvd.cab O16 - DPF: {4871A87A-BFDD-4106-8153-FFDE2BAC2967} (DLM Control) - http://dlcdnet.asus.com/pub/ASUS/misc/dlm-activex-2.2.5.0.cab O16 - DPF: {D27CDB6E-AE6D-11CF-96B8-444553540000} (Shockwave Flash Object) - http://fpdownload2.macromedia.com/get/shockwave/cabs/flash/swflash.cab O17 - HKLM\System\CCS\Services\Tcpip..{5F7DB2E1-29C4-4299-A483-B68B19E9F015}: NameServer = 195.54.122.221 195.54.122.211 O17 - HKLM\System\CS1\Services\Tcpip..{5F7DB2E1-29C4-4299-A483-B68B19E9F015}: NameServer = 195.54.122.221 195.54.122.211 O17 - HKLM\System\CS2\Services\Tcpip..{5F7DB2E1-29C4-4299-A483-B68B19E9F015}: NameServer = 195.54.122.221 195.54.122.211 O23 - Service: @%SystemRoot%\system32\Alg.exe,-112 (ALG) - Unknown owner - C:\Windows\System32\alg.exe (file missing) O23 - Service: Avira AntiVir Scheduler (AntiVirSchedulerService) - Avira GmbH - C:\Program Files (x86)\Avira\AntiVir Desktop\sched.exe O23 - Service: Avira AntiVir Guard (AntiVirService) - Avira GmbH - C:\Program Files (x86)\Avira\AntiVir Desktop\avguard.exe O23 - Service: Apache2.2 - Apache Software Foundation - F:\Program Files (x86)\Apache Software Foundation\Apache2.2\bin\httpd.exe O23 - Service: Dragon Age: Origins - Content Updater (DAUpdaterSvc) - BioWare - F:\Program Files (x86)\Dragon Age\bin_ship\DAUpdaterSvc.Service.exe O23 - Service: Device Error Recovery Service (dgdersvc) - Devguru Co., Ltd. - C:\Windows\system32\dgdersvc.exe O23 - Service: @%SystemRoot%\system32\efssvc.dll,-100 (EFS) - Unknown owner - C:\Windows\System32\lsass.exe (file missing) O23 - Service: @%systemroot%\system32\fxsresm.dll,-118 (Fax) - Unknown owner - C:\Windows\system32\fxssvc.exe (file missing) O23 - Service: @keyiso.dll,-100 (KeyIso) - Unknown owner - C:\Windows\system32\lsass.exe (file missing) O23 - Service: SAMSUNG KiesAllShare Service (KiesAllShare) - Unknown owner - F:\Program Files (x86)\Samsung\Kies\WiselinkPro\WiselinkPro.exe O23 - Service: Lavasoft Ad-Aware Service - Lavasoft - C:\Program Files (x86)\Lavasoft\Ad-Aware\AAWService.exe O23 - Service: Logitech Bluetooth Service (LBTServ) - Logitech, Inc. - C:\Program Files\Common Files\Logishrd\Bluetooth\LBTServ.exe O23 - Service: @comres.dll,-2797 (MSDTC) - Unknown owner - C:\Windows\System32\msdtc.exe (file missing) O23 - Service: MySQL - Unknown owner - F:\Program.exe (file missing) O23 - Service: @%SystemRoot%\System32\netlogon.dll,-102 (Netlogon) - Unknown owner - C:\Windows\system32\lsass.exe (file missing) O23 - Service: NVIDIA Display Driver Service (nvsvc) - Unknown owner - C:\Windows\system32\nvvsvc.exe (file missing) O23 - Service: Sony Ericsson OMSI download service (OMSI download service) - Unknown owner - f:\Program Files (x86)\Sony Ericsson\Sony Ericsson PC Suite\SupServ.exe O23 - Service: @%systemroot%\system32\psbase.dll,-300 (ProtectedStorage) - Unknown owner - C:\Windows\system32\lsass.exe (file missing) O23 - Service: @%systemroot%\system32\Locator.exe,-2 (RpcLocator) - Unknown owner - C:\Windows\system32\locator.exe (file missing) O23 - Service: @%SystemRoot%\system32\samsrv.dll,-1 (SamSs) - Unknown owner - C:\Windows\system32\lsass.exe (file missing) O23 - Service: ServiceLayer - Nokia. - C:\Program Files (x86)\PC Connectivity Solution\ServiceLayer.exe O23 - Service: @%SystemRoot%\system32\snmptrap.exe,-3 (SNMPTRAP) - Unknown owner - C:\Windows\System32\snmptrap.exe (file missing) O23 - Service: @%systemroot%\system32\spoolsv.exe,-1 (Spooler) - Unknown owner - C:\Windows\System32\spoolsv.exe (file missing) O23 - Service: @%SystemRoot%\system32\sppsvc.exe,-101 (sppsvc) - Unknown owner - C:\Windows\system32\sppsvc.exe (file missing) O23 - Service: Steam Client Service - Valve Corporation - C:\Program Files (x86)\Common Files\Steam\SteamService.exe O23 - Service: @%SystemRoot%\system32\ui0detect.exe,-101 (UI0Detect) - Unknown owner - C:\Windows\system32\UI0Detect.exe (file missing) O23 - Service: @%SystemRoot%\system32\vaultsvc.dll,-1003 (VaultSvc) - Unknown owner - C:\Windows\system32\lsass.exe (file missing) O23 - Service: @%SystemRoot%\system32\vds.exe,-100 (vds) - Unknown owner - C:\Windows\System32\vds.exe (file missing) O23 - Service: VoddlerNet - Voddler - f:\Program Files (x86)\Voddler\service\voddler.exe O23 - Service: @%systemroot%\system32\vssvc.exe,-102 (VSS) - Unknown owner - C:\Windows\system32\vssvc.exe (file missing) O23 - Service: @%systemroot%\system32\wbengine.exe,-104 (wbengine) - Unknown owner - C:\Windows\system32\wbengine.exe (file missing) O23 - Service: @%Systemroot%\system32\wbem\wmiapsrv.exe,-110 (wmiApSrv) - Unknown owner - C:\Windows\system32\wbem\WmiApSrv.exe (file missing) O23 - Service: @%PROGRAMFILES%\Windows Media Player\wmpnetwk.exe,-101 (WMPNetworkSvc) - Unknown owner - C:\Program Files (x86)\Windows Media Player\wmpnetwk.exe (file missing) -- End of file - 8958 bytes

    Read the article

  • Embedded Linux or eCos ?

    - by mawg
    One way to look at it - embedded Linux starts with desktop Linux & ditches the parts not needed for embedded systems (is this actually true?), whereas eCos is designed from the ground up for embedded systems. Now, assume an ARM processor, probably ARM 7 - does performance make a difference? Actually, we talking a very low load system, max 500 transactions a day. Any advantages of one over the other (or FreeRTOS, etc)? Stability, maturity, performance, development tools, anything else? All that I can think of is that if I am certain that I will never port to another o/s, then if I go with embedded Linux, I don't need an o/s abstraction layer to allow me to do unit testing on host (desktop Linux box). Any thoughts or comments? Thanks.

    Read the article

  • SIlverlight 4RC threading - can a new Thread return the UI Thread

    - by Darko Z
    Hi all, Let's say I have a situation in Silverlight where there is a background thread (guaranteed to NOT be the UI thread) doing some work and it needs to create a new thread. Something like this: //running in a background thread Thread t = new Thread(new ThreadStart(delegate{}); t.Start(); Lets also say that the UI thread at this particular time is just hanging around doing nothing. Keeping in mind that I am not that knowledgeable about the Silverlight threading model, is there any danger of the new Thread() call giving me the UI thread? The motivation or what I am trying to achieve is not important - I do not want modification to the existing code. I just want to know if there is a possibility of getting the UI thread back unexpectedly. Cheers

    Read the article

  • Are PackageMaker installations with preinstall scripts broken on Snow Leopard?

    - by Stu Thompson
    Everything worked on 10.5, but now my PackageMaker installation project is broken. I've been fighting a problem for a few days now, and either Snow Leopard (OS X 10.6.1) has broken PackageMaker installations I am lacking a very, very basic tidbit of knowledge To narrow down the problem, I've gotten to this point: Create a new PackageMaker installation Have it install a jpeg image into my home directoy Define a preinstall script that does nothing #/bin/sh exit 0 Run the above...and watch it fail with the below error message like clock work Sep 14 15:09:45 manoa installd[5620]: PackageKit: ----- Begin install ----- Sep 14 15:09:45 manoa installd[5620]: PackageKit: request=PKInstallRequest <1 packages, destination=/> Sep 14 15:09:45 manoa installd[5620]: PackageKit: packages=(\n "PKLeopardPackage <file://localhost/Users/stu/Desktop/asdf.pkg>"\n) Sep 14 15:09:46 manoa installd[5620]: PackageKit: Extracting /Users/stu/Desktop/asdf.pkg (destination=/var/folders/Hb/HbXJFyEpFaupt5QyLN-pTk+++TI/-Tmp-/PKInstallSandbox-tmp/Root/~, uid=501) Sep 14 15:09:46 manoa installd[5620]: PackageKit: Executing script "./preinstall" in /private/tmp/PKInstallSandbox.cmlS2H/Scripts/test.test.5year_header.pkg.PFrHNB Sep 14 15:09:46 manoa installd[5620]: PackageKit: *** launch path not accessible Sep 14 15:09:46 manoa installd[5620]: PackageKit: Install Failed: PKG: pre-install scripts for "test.test.5year_header.pkg"\nError Domain=PKInstallErrorDomain Code=112 UserInfo=0x100149430 "An error occurred while running scripts from the package “asdf”." {\n NSFilePath = "./preinstall";\n NSLocalizedDescription = "An error occurred while running scripts from the package \U201casdf\U201d.";\n NSURL = "file://localhost/Users/stu/Desktop/asdf.pkg";\n PKInstallPackageIdentifier = "test.test.5year_header.pkg";\n} Sep 14 15:09:46 manoa Installer[5614]: install:didFailWithError:Error Domain=PKInstallErrorDomain Code=112 UserInfo=0x1195917c0 "An error occurred while running scripts from the package “asdf”." Sep 14 15:09:46 manoa Installer[5614]: Install failed: The Installer encountered an error that caused the installation to fail. Contact the software manufacturer for assistance. Sep 14 15:09:47 manoa Installer[5614]: IFDInstallController 144040 state = 7 Sep 14 15:09:47 manoa Installer[5614]: Displaying 'Install Failed' UI. Sep 14 15:09:47 manoa Installer[5614]: 'Install Failed' UI displayed message:'The Installer encountered an error that caused the installation to fail. Contact the software manufacturer for assistance.'. There is no file in /private/tmp/PKInstallSandbox.cmlS2H/Scripts/test.test.5year_header.pkg.PFrHNB/, which makes me think the problem is with PackageMaker, and not me. But I'm new to the world of OS X software installation, so doubts remain. So, the question: Is PackageMaker with a preinstall script broken on OS X 10.6? Or is there some requirement regarding preinstall scripts that I do not understand?

    Read the article

  • willRotateToInterfaceOrientation:duration: not called for iOS5 after dismissing from modal

    - by Jean-Denis Muys
    My main UIViewController overrides willRotateToInterfaceOrientation:duration: to adapt the background view for the correct orientation. This works fine when staying within the view. But in my app, the result of some user actions can lead to presenting another "daughter" UIViewController. When the user is done with that daughter UIViewController, she normally returns to the main view controller. My code calls dismissModalViewControllerAnimated: to do so. The issue occurs when the user changes the iPad orientation while the daughter UIViewController is on screen. Then, the main UIViewController will never see any call to willRotateToInterfaceOrientation:duration: and its background view will be incorrect. This setup works fine in iOS 4: the iOS 4 implementation of dismissModalViewControllerAnimated: calls UIWindow's _setRotatableClient:toOrientation:updateStatusBar:duration:force: which calls willRotateToInterfaceOrientation:duration: for the switched in UIViewController. Apparently , this behavior changed for iOS 5. How am I expected to implemented orientation changes while my view is off screen under iOS5? Am I supposed to query the current orientation in viewWillAppear: for example?

    Read the article

  • How can I use a custom TabItem control when databinding a TabControl in WPF?

    - by Russ
    I have a custom control that is derived from TabItem, and I want to databind that custom TabItem to a stock TabControl. I would rather avoid creating a new TabControl just for this rare case. This is what I have and I'm not having any luck getting the correct control to be loaded. In this case I want to use my ClosableTabItem control instead of the stock TabItem control. <TabControl x:Name="tabCases" IsSynchronizedWithCurrentItem="True" Controls:ClosableTabItem.TabClose="TabClosed" > <TabControl.ItemTemplate> <DataTemplate DataType="{x:Type Controls:ClosableTabItem}" > <TextBlock Text="{Binding Path=Id}" /> </DataTemplate> </TabControl.ItemTemplate> <TabControl.ContentTemplate> <DataTemplate DataType="{x:Type Entities:Case}"> <CallLog:CaseReadOnlyDisplay DataContext="{Binding}" /> </DataTemplate> </TabControl.ContentTemplate> </TabControl> EDIT: This is what I ended up with, rather than trying to bind a custom control. The "CloseCommand" im getting from a previous question. <Style TargetType="{x:Type TabItem}" BasedOn="{StaticResource {x:Type TabItem}}" > <Setter Property="Template"> <Setter.Value> <ControlTemplate TargetType="{x:Type TabItem}"> <Border Name="Border" Background="LightGray" BorderBrush="Black" BorderThickness="1" CornerRadius="25,0,0,0" SnapsToDevicePixels="True"> <StackPanel Orientation="Horizontal"> <ContentPresenter x:Name="ContentSite" VerticalAlignment="Center" HorizontalAlignment="Center" ContentSource="Header" Margin="20,1,5,1"/> <Button Command="{Binding Path=CloseCommand}" Cursor="Hand" DockPanel.Dock="Right" Focusable="False" Margin="1,1,5,1" Background="Transparent" BorderThickness="0"> <Image Source="/Russound.Windows;component/Resources/Delete.png" Height="10" /> </Button> </StackPanel> </Border> <ControlTemplate.Triggers> <Trigger Property="IsSelected" Value="True"> <Setter Property="FontWeight" Value="Bold" /> <Setter TargetName="Border" Property="Background" Value="LightBlue" /> <Setter TargetName="Border" Property="BorderThickness" Value="1,1,1,0" /> <Setter TargetName="Border" Property="BorderBrush" Value="DarkBlue" /> </Trigger> </ControlTemplate.Triggers> </ControlTemplate> </Setter.Value> </Setter> </Style>

    Read the article

  • C# Winforms vs WPF

    - by m0s
    Hi pros, I am a student and I do freelance here and there when I have opportunity. I believe my strongest language is C#. I don't really know what is going on in real programming world, so I was wondering if WPF did take over WinForms? I know the differences between two and how two can be used simultaneously but, I just don't want to invest my time in learning dying technologies, I hope you understand. So, for windows desktop programming what would you recommend to master WinForms, WPF or maybe both? I also get a lot that desktop programming is dead already and one should only care about learning web programming. Thanks for attention, any comments are greatly appreciated.

    Read the article

  • Change parent class of dom object via css selectors

    - by Le_Coeur
    Can i change parent class of some dom object on hover event via CSS selectors? For example I have such block: <span class="wBlock" > <span class="wText">Text</span> <span class="wLink"/> <\/span> and if i move mouse to span "wLink" span "wBlock" must be changed, and if i move out than it must be the same as at the begining .wLink{ padding-right:15px; background:url(/img/addlink.png) center right no-repeat; cursor:pointer; } .wText{ background-color: #1BE968; } It's something like this and if i move my cursor to plus text highlight must be changed to yellow

    Read the article

  • TTImageView not working

    - by Ajay Sawant
    Guys, I am new to IPhone and using following code to render the image from remote server using TTImageView from Three20 framework with the help of following code TTImageView* imageView = [[[TTImageView alloc] initWithFrame:CGRectMake(30, 30, 0, 0)] autorelease]; //Working OK //imageView.urlPath = @"http://prosares.co.cc/Images/background.jpg"; //No Working imageView.urlPath = @"http://prosares.co.cc/Images/backgroundTest.jpg"; [self.view addSubview:imageView]; As shown above if I am trying to load background.jpg it's getting loaded correctly but for some reason backgroundTest.jpg is not loading at all. the only diffrance in these images are the size, is there any restriction on the image size that I can load in TTImageView ? Can someone please help me to debug this issue? Thanks Ajay Sawant

    Read the article

  • Difference between performSelectorInBackground and NSOperation Subclass

    - by AmitSri
    I have created one testing app for running deep counter loop. I run the loop fuction in background thread using performSelectorInBackground and also NSOperation subclass separately. I am also using performSelectorOnMainThread to notify main thread within backgroundthread method and [NSNotificationCenter defaultCenter] postNotificationName within NSOperation subclass to notify main thread for updating UI. Initially both the implementation giving me same result and i am able to update UI without having any problem. The only difference i found is the Thread count between two implementations. The performSelectorInBackground implementation created one thread and got terminated after loop finished and my app thread count again goes to 1. The NSOperation subclass implementation created two new threads and keep exists in the application and i can see 3 threads after loop got finished in main() function. So, my question is why two threads created by NSOperation and why it didn't get terminated just like the first background thread implementation? I am little bit confuse and unable to decide which implementation is best in-terms of performance and memory management. Thanks

    Read the article

  • click events issue in jquery.

    - by alex
    I don't know if the title explain this situation well. Below is a code i wrote to create div elements when the button is pressed. Then By clicking on any of the created divs, we can change the div background by choosing a color from the drop down box. However if i click on another div and tried to change the color by selecting another color from the drop down, the previously clicked divs also gets affected by the new color. Why is this happening. I only want the selected div to change color, without affecting the previously clicked divs. I read allot of threads on this site, some of which talks about unbinding clicks, but I'm unable to solve the problem. Thanks for the help. <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.4/jquery.min.js" type="text/javascript"></script> <style> .aaa { width:100px; height:100px;background-color:#ccc;margin-bottom:5px;} p{widht:500px; height:500px; margin:0px; padding:0px;border:2px solid red;color:#000;} </style> <select id="item_select" name="item"> <option value="1">red</option> <option value="2">blue</option> <option value="3">green</option> </select> <button>Click to create divs</button> <p id="ptest"></p> <script type="text/javascript"> var dividcount = 1; $("button").click(run); function run(){ var myDiv = $('<div id=lar'+dividcount+' class=aaa></div>'); $(myDiv).clone().appendTo('#ptest'); $(dividcount++); $("div").bind('click',(function() { var box = $("div").index(this); var idd = (this.id); $("#"+idd).text("div #"+idd); $("select").change(function(){ var str= $("select option:selected").text(); $("#"+idd).css("background-color",str); }); })); }; </script>

    Read the article

  • How to fix a Sticky Footer that works, but after a browser window is resized, the footer overlaps.

    - by UXdesigner
    Good day, I've been trying to build a perfect footer who sticks at the bottom of the browser window after it's content. And I got help here @ Stack Overflow previously. But after a while, and doing a few tests, found out that after the browser window is resized, and then I scroll down , the footer overlaps...it is causing me a big headache right now and I'd like to fix this so I can move on. I'm going to post the display.css right here: @charset "utf-8"; body, html { margin: 0; padding: 0; text-align: center; position: relative; min-height:100%; /* needed for footer positioning*/ height:100%; /* needed for footer positioning*/ } .spacer { clear: both; height: 0; margin: 0; padding: 0; font-size: 0.1em; } .spacer_left { clear: left; margin: 0 0 10px 0; padding: 0; font-size: 0.1em; } hr { height: 1px; margin: 20px 0 20px 0; border: 0; color: #ccc; background: #ccc; } #container { position:relative; /* needed for footer positioning*/ min-height: 100%;/* needed for footer positioning*/ height: auto !important;/* needed for footer positioning*/ height: 100%;/* needed for footer positioning*/ margin: 0 auto -30px;/* needed for footer positioning*/ width: 1160px; padding: 0; border: 1px solid #333; text-align: left; } #header { margin: 0; padding: 5px; height:70px; } #login { font-family: Arial; font-size: 15px; color:#FFF; text-align: right; width: 440px; margin: 2px; } #login .theInput { font-family: Arial; font-size: 14px; width: 110px; margin-right: 5px; } #login .theSubmit { font-family: Arial; font-size: 10px; background-color: #333333; color: #FFFFFF; margin-right: 5px; } h1#lineainvisible { width:1160px; height:4px; position:relative; margin-top:4px; visibility: inherit; font-family:Arial, Helvetica, sans-serif; font-size:12px; } ul#nav { width:100%; height:36px; display:block; background-color:#000; background-repeat:repeat-x; } #wrapthatbanner { display:block; float:left; width:100%; height:524px; margin-bottom:20px; } #content { margin: 0px 20px 30px 20px; /* needed for footer positioning*/ } .panelsreadmore { margin-right: 10px; text-align:right; } div#content.columns { margin-left: 100px; } #content abbr, #content acronym { cursor: help; border-bottom: 1px dotted; } #content ul { list-style-type: square; margin-left: 75px; } #content ul li, #content ol li { margin: 0 0 0.4em 0; padding: 0; } #content blockquote { width: 75%; margin: 0 auto; padding: 20px; } #contentLeft { float: left; width:580px; } #contentRight { float: right; width:580px; } .sitenote { display:block; padding:6px; border:1px solid #bae2f0; background:#e3f4f9; line-height:130%; font-size:13px; margin-top: 0; margin-right: 0; margin-bottom: 0.5em; margin-left: 0; } #footer, .push /* needed for footer positioning*/ { padding: 5px; clear: both; position:absolute;/* needed for footer positioning*/ bottom:0;/* needed for footer positioning*/ height: -30px;/* needed for footer positioning*/ width:1150px; } And this is the HTML Template File. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <!-- TemplateBeginEditable name="doctitle" --> <title>Title of Page</title> <!-- TemplateEndEditable --> <!-- TemplateParam name="categoria" type="text" value="home" --> <!-- Meta Tags --> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <!-- Meta Tags - Close --> <!-- CSS Loader - StartsS --> <link href="../css/main-client.css" rel="stylesheet" type="text/css" media="all" /> <!-- CSS Loader - Ends --> <!-- Drop Down Menu --> <link href="../css/dropdown.css" media="screen" rel="stylesheet" type="text/css" /> <link href="../css/default.advanced.css" media="screen" rel="stylesheet" type="text/css" /> <!-- Drop Down Menu - Ends --> <!-- Font Replacement Starts --> <script src="../cufon-yui.js" type="text/javascript"></script> <script src="../AFB_400.font.js" type="text/javascript"></script> <script type="text/javascript"> Cufon.replace('h2'); </script> <script type="text/javascript"> Cufon.replace('h3'); </script> <script type="text/javascript"> Cufon.replace('h4'); </script> <!-- Font Replacement = END --> <!-- Start VisualLightBox.com HEAD section --> <link rel="stylesheet" href="engine/css/vlightbox.css" type="text/css" /> <style type="text/css">#vlightbox a#vlb{display:none}</style> <link rel="stylesheet" href="engine/css/visuallightbox.css" type="text/css" media="screen" /> <script src="engine/js/jquery.min.js" type="text/javascript"></script> <!-- End VisualLightBox.com HEAD section --> <!-- TemplateBeginEditable name="head" --> <!-- TemplateEndEditable --> </head> <body id="@@(categoria)@@"> <div id="container"> <div id="header"> <table width="100%" border="0"> <tr> <td width="67%" height="77px;"><a href="index.html"><img src="../images/Titulos/5.png" alt="" width="257" hspace="10" vspace="10" border="0" id="screen_logo" title=""/></a></td> <td width="33%" valign="top"><form id="login">Log in: <input type="text" class="theInput" name="user" /> <input type="submit" name="Submit" value="Submit" /> </form> </td> </tr> </table> </div> <!-- Aqui es donde empieza fisicamente el menu drop down --> <ul id="nav" class="dropdown dropdown-horizontal"> <li><a href="../index.html">Home</a></li> <li><a href="#" class="dir">Service 1</a></li> <li><a href="#" class="dir">Service 2</a></li> <li><a href="#" class="dir">Service 3</a></li> <li><a href="#" class="dir">Service 4</a></li> <li><a href="#" class="dir">Service 5</a></li> <li><a href="#" class="dir">Service 6</a></li> </ul> <!-- Aqui termina el menu CSS--> <!-- Reset --> <div id="wmfg"> </div> <!-- Reset --> <!-- TemplateBeginEditable name="banner-grande" --> <!-- TemplateEndEditable --> <div id="content"><!-- TemplateBeginEditable name="content" --> <p>&nbsp;</p> <!-- TemplateEndEditable --></div> <div id="footer"><a href="../terms.html">Terms and Conditions</a> |<a href="privacy.html"> Privacy Policy</a><br/> Copyright 2010. .</div> </div> </div> </body> </html> Can somebody take a look at this, and tell me what am I doing wrong ? Thanks in advance.

    Read the article

  • MySQL died during the night on a 12.04.1 Ubuntu

    - by Olivier
    I can't explain why, but somehow during the night, one of my MySQL running on an Ubuntu 12.04.1 box broke. The service is running but I can't login anymore (to SQL), the previous password is not working anymore. It does not looks like the server has been compromised (nothing in /var/auth.log) It looks like some automatic security upgrade (server is configured to perform those) has occured and broke something. The MySQL server has restarted a couple of times in the logs at the time errors started to happen (I get email when CRON task fail). In the logs it complains about an unset root password (I do have cron job running all day using SQL so the password was set & working for months). Anyway I can't login without password either! Do you have any idea of what could have happened? How do I get my databases back? This line looks strange : Nov 6 06:36:12 ns398758 mysqld_safe[6676]: ERROR: 1064 You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'ALTER TABLE user ADD column Show_view_priv enum('N','Y') CHARACTER SET utf8 NOT ' at line 1 Here is the full log below : Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: PLEASE REMEMBER TO SET A PASSWORD FOR THE MySQL root USER ! Nov 6 06:36:06 ns398758 mysqld_safe[6586]: To do so, start the server, then issue the following commands: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: /usr/bin/mysqladmin -u root password 'new-password' Nov 6 06:36:06 ns398758 mysqld_safe[6586]: /usr/bin/mysqladmin -u root -h ns398758.ovh.net password 'new-password' Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Alternatively you can run: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: /usr/bin/mysql_secure_installation Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: which will also give you the option of removing the test Nov 6 06:36:06 ns398758 mysqld_safe[6586]: databases and anonymous user created by default. This is Nov 6 06:36:06 ns398758 mysqld_safe[6586]: strongly recommended for production servers. Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: See the manual for more instructions. Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Please report any problems with the /usr/scripts/mysqlbug script! Nov 6 06:36:06 ns398758 mysqld_safe[6586]: Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 [Note] Plugin 'FEDERATED' is disabled. Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 InnoDB: The InnoDB memory heap is disabled Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 InnoDB: Mutexes and rw_locks use GCC atomic builtins Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 InnoDB: Compressed tables use zlib 1.2.3.4 Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 InnoDB: Initializing buffer pool, size = 128.0M Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 InnoDB: Completed initialization of buffer pool Nov 6 06:36:06 ns398758 mysqld_safe[6632]: 121106 6:36:06 InnoDB: highest supported file format is Barracuda. Nov 6 06:36:07 ns398758 mysqld_safe[6632]: 121106 6:36:07 InnoDB: Waiting for the background threads to start Nov 6 06:36:08 ns398758 mysqld_safe[6632]: 121106 6:36:08 InnoDB: 1.1.8 started; log sequence number 29276459701 Nov 6 06:36:08 ns398758 mysqld_safe[6632]: 121106 6:36:08 InnoDB: Starting shutdown... Nov 6 06:36:09 ns398758 mysqld_safe[6632]: 121106 6:36:09 InnoDB: Shutdown completed; log sequence number 29276459701 Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 [Note] Plugin 'FEDERATED' is disabled. Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: The InnoDB memory heap is disabled Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: Mutexes and rw_locks use GCC atomic builtins Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: Compressed tables use zlib 1.2.3.4 Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: Initializing buffer pool, size = 128.0M Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: Completed initialization of buffer pool Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: highest supported file format is Barracuda. Nov 6 06:36:11 ns398758 mysqld_safe[6676]: 121106 6:36:11 InnoDB: Waiting for the background threads to start Nov 6 06:36:12 ns398758 mysqld_safe[6676]: 121106 6:36:12 InnoDB: 1.1.8 started; log sequence number 29276459701 Nov 6 06:36:12 ns398758 mysqld_safe[6676]: ERROR: 1064 You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'ALTER TABLE user ADD column Show_view_priv enum('N','Y') CHARACTER SET utf8 NOT ' at line 1 Nov 6 06:36:12 ns398758 mysqld_safe[6676]: 121106 6:36:12 [ERROR] Aborting Nov 6 06:36:12 ns398758 mysqld_safe[6676]: Nov 6 06:36:12 ns398758 mysqld_safe[6676]: 121106 6:36:12 InnoDB: Starting shutdown... Nov 6 06:36:13 ns398758 mysqld_safe[6676]: 121106 6:36:13 InnoDB: Shutdown completed; log sequence number 29276459701 Nov 6 06:36:13 ns398758 mysqld_safe[6676]: 121106 6:36:13 [Note] /usr/sbin/mysqld: Shutdown complete Nov 6 06:36:13 ns398758 mysqld_safe[6676]: Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 [Note] Plugin 'FEDERATED' is disabled. Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: The InnoDB memory heap is disabled Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: Mutexes and rw_locks use GCC atomic builtins Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: Compressed tables use zlib 1.2.3.4 Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: Initializing buffer pool, size = 128.0M Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: Completed initialization of buffer pool Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: highest supported file format is Barracuda. Nov 6 06:36:13 ns398758 mysqld_safe[6697]: 121106 6:36:13 InnoDB: Waiting for the background threads to start Nov 6 06:36:14 ns398758 mysqld_safe[6697]: 121106 6:36:14 InnoDB: 1.1.8 started; log sequence number 29276459701 Nov 6 06:36:14 ns398758 mysqld_safe[6697]: 121106 6:36:14 InnoDB: Starting shutdown... Nov 6 06:36:15 ns398758 mysqld_safe[6697]: 121106 6:36:15 InnoDB: Shutdown completed; log sequence number 29276459701 Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 [Note] Plugin 'FEDERATED' is disabled. Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: The InnoDB memory heap is disabled Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: Mutexes and rw_locks use GCC atomic builtins Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: Compressed tables use zlib 1.2.3.4 Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: Initializing buffer pool, size = 128.0M Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: Completed initialization of buffer pool Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: highest supported file format is Barracuda. Nov 6 06:36:15 ns398758 mysqld_safe[6718]: 121106 6:36:15 InnoDB: Waiting for the background threads to start Nov 6 06:36:16 ns398758 mysqld_safe[6718]: 121106 6:36:16 InnoDB: 1.1.8 started; log sequence number 29276459701 Nov 6 06:36:16 ns398758 mysqld_safe[6718]: ERROR: 1050 Table 'plugin' already exists Nov 6 06:36:16 ns398758 mysqld_safe[6718]: 121106 6:36:16 [ERROR] Aborting Nov 6 06:36:16 ns398758 mysqld_safe[6718]: Nov 6 06:36:16 ns398758 mysqld_safe[6718]: 121106 6:36:16 InnoDB: Starting shutdown... Nov 6 06:36:17 ns398758 mysqld_safe[6718]: 121106 6:36:17 InnoDB: Shutdown completed; log sequence number 29276459701 Nov 6 06:36:17 ns398758 mysqld_safe[6718]: 121106 6:36:17 [Note] /usr/sbin/mysqld: Shutdown complete Nov 6 06:36:17 ns398758 mysqld_safe[6718]: Nov 6 06:36:19 ns398758 /etc/mysql/debian-start[6816]: Upgrading MySQL tables if necessary. Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: /usr/bin/mysql_upgrade: the '--basedir' option is always ignored Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: Looking for 'mysql' as: /usr/bin/mysql Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: Looking for 'mysqlcheck' as: /usr/bin/mysqlcheck Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: Running 'mysqlcheck' with connection arguments: '--port=3306' '--socket=/var/run/mysqld/mysqld.sock' '--host=localhost' '--socket=/var/run/mysqld/mysqld.sock' '--host=localhost' '--socket=/var/run/mysqld/mysqld.sock' Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: Running 'mysqlcheck' with connection arguments: '--port=3306' '--socket=/var/run/mysqld/mysqld.sock' '--host=localhost' '--socket=/var/run/mysqld/mysqld.sock' '--host=localhost' '--socket=/var/run/mysqld/mysqld.sock' Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: col_digitas.acos OK Nov 6 06:36:20 ns398758 /etc/mysql/debian-start[6819]: col_digitas.aros OK ...

    Read the article

  • Android: Changing LinearLayout in a widget.

    - by Profete162
    Hello all, I have this really annoying problem: In my widget, i would like to change the background by code. I noticed on the Google doc than I can easily change the background of an Imageview: remoteViews.setImageViewResource(R.id.my_iv, R.drawable.my_bg); Ok, too easy, i want to change now the Linear layout.. What I read about the remoteview id that I can change a Bitmap, Int, Bool, String, etc... but not a drawable. So i guess i cannot use: remoteViews.setBitmap(R.id.my_ll,"setBackgroundDrawable",BitmapFactory.decodeResource(context.getResources(), R.drawablemy_bg)); I am totally disapointed and tried a last idea: views.setInt(R.id.my_ll,"setBackgroundResource",R.drawable.my_bg); But The logcat told me: android.widget.RemoteViews$ActionException:view: android.widget.LinearLayout can't use method with RemoteViews: setBackgroundResource(int) I am totally lost and I really don't know what to do... I would really appreciate any help. Thank a lot!

    Read the article

  • LVDiff not working in Git

    - by Tanner
    I'm trying to get lvdiff from meta-diff suite to work with Git. My .gitconfig looks like this: [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabVIEW 3-Way Merge driver = 'C:/Program Files/National Instruments/Shared/LabVIEW Merge/LVMerge.exe' 'C:/Program Files/National Instruments/LabVIEW 8.6/LabVIEW.exe' %O %B %A %A recursive = binary [diff "lvdiff"] #command = 'C:/Program Files/meta-diff suite/lvdiff.exe' external = C:/Users/Tanner/Desktop/FIRST 2010 Beta/lvdiff.sh [core] autocrlf = true lvdiff.sh looks like this: #!/bin/sh "C:/Program Files/meta-diff suite/lvdiff.exe" "$2" "%5" | cat And my .gitattributes file looks like this: #Use a cusstom driver to merge LabVIEW files *.vi merge=labview #Use lvdiff as the externel diff program for LabVIEW files *.vi diff=lvdiff But everytime I do a diff, all Git returns is: diff --git a/Build DashBoard Data.vi b/Build DashBoard Data.vi index fd50547..662237f 100644 Binary files a/Build DashBoard Data.vi and b/Build DeashBoard Data.vi differ It is like it is not using it or even recognizing my changes. Any ideas?

    Read the article

  • CSS Rollover button bug

    - by Nick
    Hi Everyone, I'm trying to create a drop down button and its almost working except one little bug. I have several big buttons that change background color when the user hovers over them and one of them, the language button, displays several suboptions inside itself when the user hovers over it. That all works fine except the language button doesn't change its background color when the user hovers over it. It does change its color if the cursor is just inside the button but not if it touches the 3 sub options. What i need is a technique or a rule that states that the button will change background color if user hovers over it or if the user hovers over one of its children elements. How do I achieve this? Here's the markup: <ul> <li><a href="/home/" title="Go to the Home page" class="current"><span>Home</span></a></li> <li><a href="/about-us/" title="Go to the About Us page" class="link"><span>About us</span></a></li> <li><a href="/products/" title="Go to the Products page" class="link"><span>Products</span></a></li> <li><a href="/services/" title="Go to the Services page" class="link"><span>Services</span></a></li> <li><a href="/news/" title="Go to the News page" class="link"><span>News</span></a></li> <li><a href="/dealers/" title="Go to the Dealers page" class="link"><span>Dealers</span></a></li> <li id="Rollover"><a href="" title="select language" class="link"><span>Language</span></a> <ul> <li><a href="/english/">English</a></li> <li><a href="/french/">French</a></li> <li><a href="/spanish/">Spanish</a></li> </ul> </li> <li><a href="/contact-us/" title="Go to the contacts page" class="link"><span>Contact us</span></a></li> </ul> Thanks in advance!

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • composite colors : CALayer and blend mode on iPhone

    - by Ali
    I'm trying to use core image on the iphone. I'm able to composite my colors using quartz to draw an uiview, but i want to separate each component into CALayer (UIview consume more resources). So i have a white mask i want to use to filter a background bitmap, and i want to try diffrent blending mode. UNfortunately, the layers are only "adding" their colors. Here is my code : @implementation WhiteLayerHelper - (void)drawLayer:(CALayer *)theLayer inContext:(CGContextRef)myContext { // draw a white overlay, with special blending and alpha values, so that the saturation can be animated CGContextSetBlendMode(myContext,kCGBlendModeSaturation); CGContextSetRGBFillColor(myContext,1.0,1.0,1.0,0.9); CGContextFillRect(myContext,[UIScreen mainScreen].bounds); } @end And here is the main view drawrect code, where i use my CALayer : - (void)drawRect:(CGRect)rect { //get the drawing context CGContextRef myContext = UIGraphicsGetCurrentContext(); // draw the background [self fillContext:myContext withBounds:m_overlayRect withImage:m_currentImage]; [whiteLayer renderInContext:myContext]; } Is there something wrong ?

    Read the article

< Previous Page | 300 301 302 303 304 305 306 307 308 309 310 311  | Next Page >