Search Results

Search found 40728 results on 1630 pages for 'change favorites location'.

Page 31/1630 | < Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >

  • glsl shader to allow color change of skydome ogre3d

    - by Tim
    I'm still very new to all this but learning a lot. I'm putting together an application using Ogre3d as the rendering engine. So far I've got it running, with a simple scene, a day/night cycle system which is working okay. I'm now moving on to looking at changing the color of the skydome material based on the time of day. What I've done so far is to create a struct to hold the ColourValues for the different aspects of the scene. struct todColors { Ogre::ColourValue sky; Ogre::ColourValue ambient; Ogre::ColourValue sun; }; I created an array to store all the colours todColors sceneColours [4]; I populated the array with the colours I want to use for the various times of the day. For instance DayTime (when the sun is high in the sky) sceneColours[2].sky = Ogre::ColourValue(135/255, 206/255, 235/255, 255); sceneColours[2].ambient = Ogre::ColourValue(135/255, 206/255, 235/255, 255); sceneColours[2].sun = Ogre::ColourValue(135/255, 206/255, 235/255, 255); I've got code to work out the time of the day using a float currentHours to store the current hour of the day 10.5 = 10:30 am. This updates constantly and updates the sun as required. I am then calculating the appropriate colours for the time of day when relevant using else if( currentHour >= 4 && currentHour < 7) { // Lerp from night to morning Ogre::ColourValue lerp = Ogre::Math::lerp<Ogre::ColourValue, float>(sceneColours[GT_TOD_NIGHT].sky , sceneColours[GT_TOD_MORNING].sky, (currentHour - 4) / (7 - 4)); } My original attempt to get this to work was to dynamically generate a material with the new colour and apply that material to the skydome. This, as you can probably guess... didn't go well. I know it's possible to use shaders where you can pass information such as colour to the shader from the code but I am unsure if there is an existing simple shader to change a colour like this or if I need to create one. What is involved in creating a shader and material definition that would allow me to change the colour of a material without the overheads of dynamically generating materials all the time? EDIT : I've created a glsl vertex and fragment shaders as follows. Vertex uniform vec4 newColor; void main() { gl_FrontColor = newColor; gl_Position = ftransform(); } Fragment void main() { gl_FragColor = gl_Color; } I can pass a colour to it using ShaderDesigner and it seems to work. I now need to investigate how to use it within Ogre as a material. EDIT : I created a material file like this : vertex_program colour_vs_test glsl { source test.vert default_params { param_named newColor float4 0.0 0.0 0.0 1 } } fragment_program colour_fs_glsl glsl { source test.frag } material Test/SkyColor { technique { pass { lighting off fragment_program_ref colour_fs_glsl { } vertex_program_ref colour_vs_test { } } } } In the code I have tried : Ogre::MaterialPtr material = Ogre::MaterialManager::getSingleton().getByName("Test/SkyColor"); Ogre::GpuProgramParametersSharedPtr params = material->getTechnique(0)->getPass(0)->getVertexProgramParameters(); params->setNamedConstant("newcolor", Ogre::Vector4(0.7, 0.5, 0.3, 1)); I've set that as the Skydome material which seems to work initially. I am doing the same with the code that is attempting to lerp between colours, but when I include it there, it all goes black. Seems like there is now a problem with my colour lerping.

    Read the article

  • Tile engine Texture not updating when numbers in array change

    - by Corey
    I draw my map from a txt file. I am using java with slick2d library. When I print the array the number changes in the array, but the texture doesn't change. public class Tiles { public Image[] tiles = new Image[5]; public int[][] map = new int[64][64]; public Image grass, dirt, fence, mound; private SpriteSheet tileSheet; public int tileWidth = 32; public int tileHeight = 32; public void init() throws IOException, SlickException { tileSheet = new SpriteSheet("assets/tiles.png", tileWidth, tileHeight); grass = tileSheet.getSprite(0, 0); dirt = tileSheet.getSprite(7, 7); fence = tileSheet.getSprite(2, 0); mound = tileSheet.getSprite(2, 6); tiles[0] = grass; tiles[1] = dirt; tiles[2] = fence; tiles[3] = mound; int x=0, y=0; BufferedReader in = new BufferedReader(new FileReader("assets/map.dat")); String line; while ((line = in.readLine()) != null) { String[] values = line.split(","); x = 0; for (String str : values) { int str_int = Integer.parseInt(str); map[x][y]=str_int; //System.out.print(map[x][y] + " "); x++; } //System.out.println(""); y++; } in.close(); } public void update(GameContainer gc) { } public void render(GameContainer gc) { for(int y = 0; y < map.length; y++) { for(int x = 0; x < map[0].length; x ++) { int textureIndex = map[x][y]; Image texture = tiles[textureIndex]; texture.draw(x*tileWidth,y*tileHeight); } } } } Mouse Picking Where I change the number in the array Input input = gc.getInput(); gc.getInput().setOffset(cameraX-400, cameraY-300); float mouseX = input.getMouseX(); float mouseY = input.getMouseY(); double mousetileX = Math.floor((double)mouseX/tiles.tileWidth); double mousetileY = Math.floor((double)mouseY/tiles.tileHeight); double playertileX = Math.floor(playerX/tiles.tileWidth); double playertileY = Math.floor(playerY/tiles.tileHeight); double lengthX = Math.abs((float)playertileX - mousetileX); double lengthY = Math.abs((float)playertileY - mousetileY); double distance = Math.sqrt((lengthX*lengthX)+(lengthY*lengthY)); if(input.isMousePressed(Input.MOUSE_LEFT_BUTTON) && distance < 4) { System.out.println("Clicked"); if(tiles.map[(int)mousetileX][(int)mousetileY] == 1) { tiles.map[(int)mousetileX][(int)mousetileY] = 0; } } I never ask a question until I have tried to figure it out myself. I have been stuck with this problem for two weeks. It's not like this site is made for asking questions or anything. So if you actually try to help me instead of telling me to use a debugger thank you. You either get told you have too much or too little code. Nothing is never enough for the people on here it's as bad as something like reddit. Idk what is wrong all my textures work when I render them it just doesn't update when the number in the array changes. I am obviously debugging when I say that I was printing the array and the number is changing like it should, so it's not a problem with my mouse picking code. It is a problem with my textures, but I don't know what because they all render correctly. That is why I need help.

    Read the article

  • Why Ultra-Low Power Computing Will Change Everything

    - by Tori Wieldt
    The ARM TechCon keynote "Why Ultra-Low Power Computing Will Change Everything" was anything but low-powered. The speaker, Dr. Johnathan Koomey, knows his subject: he is a Consulting Professor at Stanford University, worked for more than two decades at Lawrence Berkeley National Laboratory, and has been a visiting professor at Stanford University, Yale University, and UC Berkeley's Energy and Resources Group. His current focus is creating a standard (computations per kilowatt hour) and measuring computer energy consumption over time. The trends are impressive: energy consumption has halved every 1.5 years for the last 60 years. Battery life has made roughly a 10x improvement each decade since 1960. It's these improvements that have made laptops and cell phones possible. What does the future hold? Dr. Koomey said that in the past, the race by chip manufacturers was to create the fastest computer, but the priorities have now changed. New computers are tiny, smart, connected and cheap. "You can't underestimate the importance of a shift in industry focus from raw performance to power efficiency for mobile devices," he said. There is also a confluence of trends in computing, communications, sensors, and controls. The challenge is how to reduce the power requirements for these tiny devices. Alternate sources of power that are being explored are light, heat, motion, and even blood sugar. The University of Michigan has produced a miniature sensor that harnesses solar energy and could last for years without needing to be replaced. Also, the University of Washington has created a sensor that scavenges power from existing radio and TV signals.Specific devices designed for a purpose are much more efficient than general purpose computers. With all these sensors, instead of big data, developers should focus on nano-data, personalized information that will adjust the lights in a room, a machine, a variable sign, etc.Dr. Koomey showed some examples:The Proteus Digital Health Feedback System, an ingestible sensor that transmits when a patient has taken their medicine and is powered by their stomach juices. (Gives "powered by you" a whole new meaning!) Streetline Parking Systems, that provide real-time data about available parking spaces. The information can be sent to your phone or update parking signs around the city to point to areas with available spaces. Less driving around looking for parking spaces!The BigBelly trash system that uses solar power, compacts trash, and sends a text message when it is full. This dramatically reduces the number of times a truck has to come to pick up trash, freeing up resources and slashing fuel costs. This is a classic example of the efficiency of moving "bits not atoms." But researchers are approaching the physical limits of sensors, Dr. Kommey explained. With the current rate of technology improvement, they'll reach the three-atom transistor by 2041. Once they hit that wall, it will force a revolution they way we do computing. But wait, researchers at Purdue University and the University of New South Wales are both working on a reliable one-atom transistors! Other researchers are working on "approximate computing" that will reduce computing requirements drastically. So it's unclear where the wall actually is. In the meantime, as Dr. Koomey promised, ultra-low power computing will change everything.

    Read the article

  • 11.10 desktop alerts (volume change and terminal bell) stopped working but all other audio still works

    - by FlabbergastedPickle
    All, My sound works just fine in 11.10 64-bit install on HP dm1-4050 Sandy Bridge notebook (e.g. audio works in Banshee, flash, games, browser, Thunderbird email notification, etc.), but the core desktop notifications (e.g. pressing a tab in a terminal where there is more than one option should trigger a terminal bell, or changing volume using volume keys should be accompanied with the supporting "quack" that the volume app makes) do not work. I've intentionally disabled login sound as explained here on ask ubuntu but even enabling it back makes no difference. These notifications did work before just fine and I am not sure when did the actually stop working but it must've been fairly recently. Only things I did were trying to install some ppa edge xorg drivers for my intel card (a separate issue) but also reverted them all with ppa-purge once I discovered they did not improve anything. Other thing I did was check volume settings with alsamixer and did alsactl store for the soundcard after I did some experimenting with volume settings for PCM (on my laptop PCM at 100% crackles so I had to lower it and make pulseaudio ignore its setting as per ask ubuntu's page). That said, neither of these should have any bearing on the said notifications since the volume is up and they clearly work everywhere else but the core desktop events. The system ready drum sound when Ubuntu boots and user reaches the login screen also does not work. The guest login behaves exactly same as mine. Audio works (including the login sound since I've not disabled it for the guest account), but no quacks when changing the volume or terminal bell sounds... I've tried copying ubuntu sounds to /usr/share/sounds/ as suggested on ask ubuntu and that did not work. I also tried using dconf-editor to check sound theme settings and tried both freedesktop (which is what it was set to) and ubuntu, as suggested on ask ubuntu. This did not work either. I tried purging the ~/.pulse folder and the /tmp/*pulse* entries, rebooting and restarting pulseaudio with -D flag. While audio came back on and behaved just fine in all aspects (e.g. one can adjust volume levels, play music, games, in-browser sound stuff, and other app alerts) except for the system ready drum sound (at the login screen), and any system event (terminal bell and volume change quack sound). It is interesting that the quack sound works inside system settings-sound when adjusting levels there, but it does not when volume is changed via top bar's volume settings... I do recall that at one point yesterday when I was restarting pulseaudio the quacks that accompany volume change did start working but I have no idea what caused that. This was also when I first realized those alerts were not working. After rebooting it was again gone. I did compile my own 3.0.14-rt31 kernel a little while ago as instructed on one of the wiki's for the 11.10 rt kernel. Everything works as before except for the said sound alerts. I am not sure if this began happening since I started using the rt kernel though and yesterday's momentary ability to hear those quacks while changing the volume make me believe that the kernel is not one responsible for this problem. One more thing I can think of is that I used alsoft-conf tool to configure buffering on the OpenAL (due to TA Spring's choppy audio) and changed in there default audio device to ALSA. I also tried reverting it to Pulseaudio as the only allowed output but the bottom part of the Backend tab always reverts to ALSA even when I select Pulseaudio. The pulseaudio does remain as the only active choice on top. This, however, once again does not make any sense in terms of preventing desktop audio alerts when everything else including OpenAL games plays sound just fine... So, there you have it, as verbose as I could make it :-). I tried all I could find on this issue and had no luck so far... Any ideas?

    Read the article

  • How change LOD in geometry?

    - by ChaosDev
    Im looking for simple algorithm of LOD, for change geometry vertexes and decrease frame time. Im created octree, but now I want model or terrain vertex modify algorithm,not for increase(looking on tessellation later) but for decrease. I want something like this Questions: Is same algorithm can apply either to model and terrain correctly? Indexes need to be modified ? I must use octree or simple check distance between camera and object for desired effect ? New value of indexcount for DrawIndexed function needed ? Code: //m_LOD == 10 in the beginning //m_RawVerts - array of 3d Vector filled with values from vertex buffer. void DecreaseLOD() { m_LOD--; if(m_LOD<1)m_LOD=1; RebuildGeometry(); } void IncreaseLOD() { m_LOD++; if(m_LOD>10)m_LOD=10; RebuildGeometry(); } void RebuildGeometry() { void* vertexRawData = new byte[m_VertexBufferSize]; void* indexRawData = new DWORD[m_IndexCount]; auto context = mp_D3D->mp_Context; D3D11_MAPPED_SUBRESOURCE data; ZeroMemory(&data,sizeof(D3D11_MAPPED_SUBRESOURCE)); context->Map(mp_VertexBuffer->mp_buffer,0,D3D11_MAP_READ,0,&data); memcpy(vertexRawData,data.pData,m_VertexBufferSize); context->Unmap(mp_VertexBuffer->mp_buffer,0); context->Map(mp_IndexBuffer->mp_buffer,0,D3D11_MAP_READ,0,&data); memcpy(indexRawData,data.pData,m_IndexBufferSize); context->Unmap(mp_IndexBuffer->mp_buffer,0); DWORD* dwI = (DWORD*)indexRawData; int sz = (m_VertexStride/sizeof(float));//size of vertex element //algorithm must be here. std::vector<Vector3d> vertices; int i = 0; for(int j = 0; j < m_VertexCount; j++) { float x1 = (((float*)vertexRawData)[0+i]); float y1 = (((float*)vertexRawData)[1+i]); float z1 = (((float*)vertexRawData)[2+i]); Vector3d lv = Vector3d(x1,y1,z1); //my useless attempts if(j+m_LOD+1<m_RawVerts.size()) { float v1 = VECTORHELPER::Distance(m_RawVerts[dwI[j]],m_RawVerts[dwI[j+m_LOD]]); float v2 = VECTORHELPER::Distance(m_RawVerts[dwI[j]],m_RawVerts[dwI[j+m_LOD+1]]); if(v1>v2) lv = m_RawVerts[dwI[j+1]]; else if(v2<v1) lv = m_RawVerts[dwI[j+2]]; } (((float*)vertexRawData)[0+i]) = lv.x; (((float*)vertexRawData)[1+i]) = lv.y; (((float*)vertexRawData)[2+i]) = lv.z; i+=sz;//pass others vertex format values without change } for(int j = 0; j < m_IndexCount; j++) { //indices ? } //set vertexes to device UpdateVertexes(vertexRawData,mp_VertexBuffer->getSize()); delete[] vertexRawData; delete[] indexRawData; }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • DNS propogation question with name server change

    - by Brian
    The registrar I have is networksolutions.com, and for quite a while, the name servers were pointing to Site5.com, where hosting is for one of my domains. I wanted to bring DNS control back to networksolutions, so I pointed the name servers back to networksolutions and added in all my A records. However, I noticed that the site soon became unreachable. I'm curious as to why this happened? If the domain was pointing to either the old name servers or the new ones, it would still have the proper A records and whatnot. Is this because when I changed name servers, a request was made to delete them completely, and then the DNS servers worldwide have to wait for network solutions to send out the new ones or something? I was hoping this would be a switch with zero downtime, such as a normal A record change.

    Read the article

  • Beginner Geek: How To Change the Boot Order in Your Computer’s BIOS

    - by Chris Hoffman
    The boot order in your computer’s BIOS controls which device it loads the operating system from. Modify your boot order to force your computer to boot from a USB drive, CD or DVD drive, or another hard drive. You may need to change this setting when booting from another device, whether you’re running an operating system from a live USB drive or installing a new operating system from a disc. Note: This process will look different on each computer. The instructions here will guide you through the process, but the screenshots won’t look exactly the same. How To Use USB Drives With the Nexus 7 and Other Android Devices Why Does 64-Bit Windows Need a Separate “Program Files (x86)” Folder? Why Your Android Phone Isn’t Getting Operating System Updates and What You Can Do About It

    Read the article

  • How to change System default language on GNOME3?

    - by Vor
    I just installed GNOME3 on my Ubuntu. Everything worked fine till I restarted computer. Then I received a message if I want to change folders name to some other (different language, don't know what is this, but looks like Chinese). I pressed, 'keep old names' but it still changed all my folder names! And also the rest of the names. (like settings, and all that staff). So if you can give me the direction on where to click (cause all English names changed to non-English) and I simply don't know what does any of them means!

    Read the article

  • UK Connected Systems User Group - Udi Dahan Event Topic change

    - by Michael Stephenson
    Hi Just wanted to get the word out about a change to the may user group event.  Udi Dahan will present a new topic which he has not presented in the UK before.  Details below. To register for this event please refer to: http://ukconnectedsystemsusergroup.org/UpcomingEvents.aspx Title: High Availability - A Contrarian View   Abstract: Many developers are aware of the importance of high availability, critically analyzing any single points of failure in the infrastructure. Those same developers rarely give a second thought to the periods of time when a system is being upgraded. Even if all the servers are running, most systems cannot function in-between versions. Yet with the increased pace of business, users are demanding ever more frequent releases. The poor maintenance programmers and system administrators are left holding the bag long after the architecture that sealed their fate was formulated. Join Udi for some different perspectives on high availability - architecture and methodology for the real world.

    Read the article

  • Change the Default Number of Rows of Tiles on the Windows 8 UI (Metro) Screen

    - by Lori Kaufman
    By default, Windows 8 automatically sets the number of rows of tiles to fit your screen, depending on your monitor size and resolution. However, you can tell Windows 8 to display a certain number of rows of tiles at all times, despite the screen resolution. To do this, we will make a change to the registry. If you are not already on the Desktop, click the Desktop tile on the Start screen. NOTE: Before making changes to the registry, be sure you back it up. We also recommend creating a restore point you can use to restore your system if something goes wrong. HTG Explains: Why Do Hard Drives Show the Wrong Capacity in Windows? Java is Insecure and Awful, It’s Time to Disable It, and Here’s How What Are the Windows A: and B: Drives Used For?

    Read the article

  • How to make my screen brightness not change when I plug my laptop in

    - by user63985
    I do not want my laptop to change brightness when my laptop power is plugged in or unplugged. I set my brightness based on how bright my surroundings are. If I am in a dark room, I set my brightness very low and when I plug my laptop in the brightness gets set to maximum which feels like sticking my eyes in boiling lava. In System Settings ? Brightness and Lock the Dim screen to save power checkbox is unchecked. My laptop is an HP Mini 110 In case it is an acpi issue I have put my acpi-support file here http://paste.ubuntu.com/1008244/

    Read the article

  • How can I change my cursor behavior?

    - by Doug Clement
    When I am typing, my mouse cursor, if left on the text, will eventually auto-click in whatever space in the the text box I happen to be, causing me to type in the middle of a sentence. Also, the cursor in the text box will frequently stop mid-word and the screen will scroll down all of a sudden when pressing the space bar while typing. My question is, how do I change this behavior because it is driving me absolutely bat crap crazy. I have an Acer Aspire One D257 Netbook. I am not sure if it's a Xubuntu problem because it does this while I am using Windows 7 too. Any help would be nice, thanks!

    Read the article

  • Change language encoding for file uploading

    - by jc.yin
    Previously we were running a Wordpress site on a Mac OS Server machine. We had several hundred images with Chinese characters for the image names. Now we're trying to migrate to a Ubuntu system and everything is fine except the images. Every time I try to upload an image with a Chinese name via FTP, I get the following message: "MyImage contains illegal characters. Please choose an appropriate text encoding" I have no idea how to solve this issue, do I need to somehow change the system language encoding in Ubuntu to allow for image uploading? Thanks

    Read the article

  • Eclipse Juno, need root access everytime I change the configuration

    - by veepsk
    I am trying to install eclipse Juno on 12.04. I did all the things instructed in this link. But whenever I install any new software (Say CDT or Pydev) on Eclipse, the new softwares are gone upon opening the Eclipse app again. I then have to open Eclipse again with root privileges to install all the software. I also ran into many problems with linking the include library for Eclipse CDT. Can anyone help me with installing Juno in a way that I do not need root access every time I change configurations in Eclipse?

    Read the article

  • How to Change Your Default Applications on Ubuntu: 4 Ways

    - by Chris Hoffman
    There are several ways to change your default applications on Ubuntu. Whether you’re changing the default application for a particular task, file type, or a system-level application like your default text editor, there’s a different place to go. Unlike on Windows, applications won’t take over existing file extensions during the installation process — they’ll just appear as an option after you install them. How to Banish Duplicate Photos with VisiPic How to Make Your Laptop Choose a Wired Connection Instead of Wireless HTG Explains: What Is Two-Factor Authentication and Should I Be Using It?

    Read the article

  • Change permission for ALL folders and files

    - by Xweque
    I've been around Ubuntu for not too long now and I'm getting tired of a thing I used to accept. When I installed Apache and PHP on Ubuntu it was done with root meaning it got permission. So I changed that to me. Now I've just copied a big number of files, (PHP), to be viewed and edited in these directories. Now my problem: I can not view the files from var/www/ because it requires, for some reason, everyone to have access to the files. Not only me, or my group but everyone. No one else is using the computer but me, so I'm cool with it. Though I need a command to change ALL files permission recursively. When I've browsed the questions already been answered I find for example chown -R viktor:viktor /var/www/, or using sudo as well. This worked on the single var/www and the folders inside but not the files inside the folders and very odd I notice I can't do the same thing on example /var/www/dev/.

    Read the article

  • How to change default boot with two Ubuntus?

    - by d3vid
    I currently have 11.10 and 12.04 Beta running side-by-side. Since installing the beta, I am presented with a GRUB2 menu every time I boot up, which selects 12.04 by default. (Aside: when the 11.10 kernel updated from 3.0.0-16 to 3.0.0-17 this option did not appear in the GRUB2 menu.) When I open Grub Customizer in 11.10, it shows 11.10 kernel 3.0.0-17 as the default, when I open Grub Customizer in 12.04, it shows 12.04 as the default. How can I change GRUB2 to pick the latest 11.10 kernel as the default? (Latest means that if 3.0.0-18 is released it will become the default, and so on.) And also stop displaying the menu (I only boot into the beta when I have something specific to test). Generic answers that apply to any two Ubuntus running side-by-side are preferred.

    Read the article

  • How to change tooltip background color in Unity?

    - by kayahr
    In a lot of applications the tooltips are just plain ugly (White text on black background, way too much contrast) or even unreadable (black or dark blue text (Hyperlinks) on black background). I want to change the background color of the tooltips to some medium gray or even some yellow or something like that, maybe even something semi-transparent. Here is a screenshot of Eclipse which displays some source code in a tool tip with black text on black background: Switching to a different theme (Something other than Ambiance or Radiance) helps but I like Ambiance and I want to keep it. It's just this darn tooltip color which is absolutely unacceptable. I found several solutions for older Ubuntu versions but they no longer work with Unity in Ubuntu 11.10 because I can't find any function to customize the Ambiance or Radiance theme. So how do I do that in the current Ubuntu version?

    Read the article

  • How to change the sprite colors

    - by Mr_Qqn
    In my rhythm game, I have a note object which can be of different colors depending on the note chart. I could use a sprite sheet with all the different color variations I use, but I would prefer to parametrize this. (For information, a note sprite is compound with one main color, for example a red note has only red, light red and dark red.) So, how to change the colors of a sprite basing on a new color ? I'm working with opengl, but any algorithm or math explanation will do. :) Thanks

    Read the article

  • Change resolution in Waking Mars

    - by Wes
    I purchased and installed the humble bundle game "Waking Mars" via the Ubuntu Software Center and it works really well except for some issues with changing settings, namely with the resolution. The in-game settings for changing resolution and entering/exiting fullscreen were easy enough to find and toggle, and when you do it asks to restart the application. When you restart it, all other settings you updated are reflected except for the changes to the resolution. (I'm trying to get it to play in windowed mode that fits onto one monitor, but it will only default to windowed mode with the full dual monitor resolution). I noticed that it writes these values to ~/.local/share/WakingMars/UserSettings.ini. When I change the resolution, it is properly written to in this settings file...but it never is reflected when you restart the application. Any ideas what's wrong?

    Read the article

< Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >