Search Results

Search found 6177 results on 248 pages for 'reputation points'.

Page 31/248 | < Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >

  • Characteristics, what's the inverse of (x*(x+1))/2? [closed]

    - by Valmond
    In my game you can spend points to upgrade characteristics. Each characteristic has a formula like: A) out = in : for one point spent, one pont gained (you spend 1 point on Force so your force goes from 5 to 6) B) out = last level (starting at 1) : so the first point spent earns you 1 point, the next point spent earns you an additional 2 and so on (+3,+4,+5...) C) The inverse of B) : You need to spend 1 point to earn one, then you need to spend 2 to earn another one and so on. I have already found the formula for calculating the actual level of B when points spent = x : charac = (x*(x+1))/2 But I'd like to know what the "reverse" version of B) (usable for C) is, ie. if I have spent x points, how many have I earned if 1 spent gives 1, 1+2=3 gives 2, 1+2+3=6 gives 3 and so on. I know I can just calculate the numbers but I'd like to have the formula because its neater and so that I can stick it in an excel sheet for example... Thanks! ps. I think I have nailed it down to something like charac = sqrt( x*m +k) but then I'm stuck doing number guessing for k and m and I feel I might be wrong anyway as I get close but never hits the spot.

    Read the article

  • Using Optical Flow in EmguCV

    - by Meko
    HI. I am trying to create simple touch game using EmguCV.Should I use optical flow to determine for interaction between images on screen and with my hand ,if changes of points somewhere on screen more than 100 where the image, it means my hand is over image? But how can I track this new points? I can draw on screen here the previous points and new points but It shows on my head more points then my hand and I can not track my hands movements. void Optical_Flow_Worker(object sender, EventArgs e) { { Input_Capture.SetCaptureProperty(Emgu.CV.CvEnum.CAP_PROP.CV_CAP_PROP_POS_FRAMES, ActualFrameNumber); ActualFrame = Input_Capture.QueryFrame(); ActualGrayFrame = ActualFrame.Convert<Gray, Byte>(); NextFrame = Input_Capture.QueryFrame(); NextGrayFrame = NextFrame.Convert<Gray, Byte>(); ActualFeature = ActualGrayFrame.GoodFeaturesToTrack(500, 0.01d, 0.01, 5); ActualGrayFrame.FindCornerSubPix(ActualFeature, new System.Drawing.Size(10, 10), new System.Drawing.Size(-1, -1), new MCvTermCriteria(20, 0.3d)); OpticalFlow.PyrLK(ActualGrayFrame, NextGrayFrame, ActualFeature[0], new System.Drawing.Size(10, 10), 3, new MCvTermCriteria(20, 0.03d), out NextFeature, out Status, out TrackError); OpticalFlowFrame = new Image<Bgr, Byte>(ActualFrame.Width, ActualFrame.Height); OpticalFlowFrame = NextFrame.Copy(); for (int i = 0; i < ActualFeature[0].Length; i++) DrawFlowVectors(i); ActualFrameNumber++; pictureBox1.Image = ActualFrame.Resize(320, 400).ToBitmap() ; pictureBox3.Image = OpticalFlowFrame.Resize(320, 400).ToBitmap(); } } private void DrawFlowVectors(int i) { System.Drawing.Point p = new Point(); System.Drawing.Point q = new Point(); p.X = (int)ActualFeature[0][i].X; p.Y = (int)ActualFeature[0][i].Y; q.X = (int)NextFeature[i].X; q.Y = (int)NextFeature[i].Y; p.X = (int)(q.X + 6 * Math.Cos(angle + Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle + Math.PI / 4)); p.X = (int)(q.X + 6 * Math.Cos(angle - Math.PI / 4)); p.Y = (int)(q.Y + 6 * Math.Sin(angle - Math.PI / 4)); OpticalFlowFrame.Draw(new Rectangle(q.X,q.Y,1,1), new Bgr(Color.Red), 1); OpticalFlowFrame.Draw(new Rectangle(p.X, p.Y, 1, 1), new Bgr(Color.Blue), 1); }

    Read the article

  • Neural Networks in C# using NeuronDotNet

    - by kingrichard2005
    Hello, I'm testing the NeuronDotNet library for a class assignment using C#. I have a very simple console application that I'm using to test some of the code snippets provided in the manual fro the library, the goal of the assignment is to teach the program how to distinguish between random points in a square which may or may not be within a circle that is also inside the square. So basically, which points inside the square are also inside the circle. Here is what I have so far: namespace _469_A7 { class Program { static void Main(string[] args) { //Initlaize the backpropogation network LinearLayer inputLayer = new LinearLayer(2); SigmoidLayer hiddenLayer = new SigmoidLayer(8); SigmoidLayer outputLayer = new SigmoidLayer(2); new BackpropagationConnector(inputLayer, hiddenLayer); new BackpropagationConnector(hiddenLayer, outputLayer); BackpropagationNetwork network = new BackpropagationNetwork(inputLayer, outputLayer); //Generate a training set for the ANN TrainingSet trainingSet = new TrainingSet(2, 2); //TEST: Generate random set of points and add to training set, //for testing purposes start with 10 samples; Point p; Program program = new Program(); //Used to access randdouble function Random rand = new Random(); for(int i = 0; i < 10; i++) { //These points will be within the circle radius Type A if(rand.NextDouble() > 0.5) { p = new Point(rand.NextDouble(), rand.NextDouble()); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 1, 0 })); continue; } //These points will either be on the border or outside the circle Type B p = new Point(program.randdouble(1.0, 4.0), program.randdouble(1.0, 4.0)); trainingSet.Add(new TrainingSample(new double[2] { p.getX(), p.getY() }, new double[2] { 0, 1 })); } //Start network learning network.Learn(trainingSet, 100); //Stop network learning //network.StopLearning(); } //generates a psuedo-random double between min and max public double randdouble(double min, double max) { Random rand = new Random(); if (min > max) { return rand.NextDouble() * (min - max) + max; } else { return rand.NextDouble() * (max - min) + min; } } } //Class defines a point in X/Y coordinates public class Point { private double X; private double Y; public Point(double xVal, double yVal) { this.X = xVal; this.Y = yVal; } public double getX() { return X; } public double getY() { return Y; } } } This is basically all that I need, the only question I have is how to handle output?? More specifically, I need to output the value of the "step size" and the momentum, although it would be nice to output other information as well. Anyone with experience using NeuronDotNet, your input is appreciated.

    Read the article

  • Vector math, finding coördinates on a planar between 2 vectors

    - by Will Kru
    I am trying to generate a 3d tube along a spline. I have the coördinates of the spline (x1,y1,z1 - x2,y2,z2 - etc) which you can see in the illustration in yellow. At those points I need to generate circles, whose vertices are to be connected at a later stadium. The circles need to be perpendicular to the 'corners' of two line segments of the spline to form a correct tube. Note that the segments are kept low for illustration purpose. [apparently I'm not allowed to post images so please view the image at this link] http://img191.imageshack.us/img191/6863/18720019.jpg I am as far as being able to calculate the vertices of each ring at each point of the spline, but they are all on the same planar ie same angled. I need them to be rotated according to their 'legs' (which A & B are to C for instance). I've been thinking this over and thought of the following: two line segments can be seen as 2 vectors (in illustration A & B) the corner (in illustraton C) is where a ring of vertices need to be calculated I need to find the planar on which all of the vertices will reside I then can use this planar (=vector?) to calculate new vectors from the center point, which is C and find their x,y,z using radius * sin and cos However, I'm really confused on the math part of this. I read about the dot product but that returns a scalar which I don't know how to apply in this case. Can someone point me into the right direction? [edit] To give a bit more info on the situation: I need to construct a buffer of floats, which -in groups of 3- describe vertex positions and will be connected by OpenGL ES, given another buffer with indices to form polygons. To give shape to the tube, I first created an array of floats, which -in groups of 3- describe control points in 3d space. Then along with a variable for segment density, I pass these control points to a function that uses these control points to create a CatmullRom spline and returns this in the form of another array of floats which -again in groups of 3- describe vertices of the catmull rom spline. On each of these vertices, I want to create a ring of vertices which also can differ in density (amount of smoothness / vertices per ring). All former vertices (control points and those that describe the catmull rom spline) are discarded. Only the vertices that form the tube rings will be passed to OpenGL, which in turn will connect those to form the final tube. I am as far as being able to create the catmullrom spline, and create rings at the position of its vertices, however, they are all on a planars that are in the same angle, instead of following the splines path. [/edit] Thanks!

    Read the article

  • Rotation Matrix calculates by column not by row

    - by pinnacler
    I have a class called forest and a property called fixedPositions that stores 100 points (x,y) and they are stored 250x2 (rows x columns) in MatLab. When I select 'fixedPositions', I can click scatter and it will plot the points. Now, I want to rotate the plotted points and I have a rotation matrix that will allow me to do that. The below code should work: theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; But it wont. I get this error. ??? Error using == mtimes Inner matrix dimensions must agree. Error in == landmarkslandmarks.get.apparentPositions at 22 apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; When I alter forest.fixedPositions to store the variables 2x250 instead of 250x2, the above code will work, but it wont plot. I'm going to be plotting fixedPositions constantly in a simulation, so I'd prefer to leave it as it, and make the rotation work instead. Any ideas? Also, fixed positions, is the position of the xy points as if you were looking straight ahead. i.e. heading = 0. heading is set to 45, meaning I want to rotate points clockwise 45 degrees. Here is my code: classdef landmarks properties fixedPositions %# positions in a fixed coordinate system. [x, y] heading = 45; %# direction in which the robot is facing end properties (Dependent) apparentPositions end methods function obj = landmarks(numberOfTrees) %# randomly generates numberOfTrees amount of x,y coordinates and set %the array or matrix (not sure which) to fixedPositions obj.fixedPositions = 100 * rand([numberOfTrees,2]) .* sign(rand([numberOfTrees,2]) - 0.5); end function obj = set.apparentPositions(obj,~) theta = obj.heading * pi/180; [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end function apparent = get.apparentPositions(obj) %# rotate obj.positions using obj.facing to generate the output theta = obj.heading * pi/180; apparent = [cos(theta) -sin(theta) ; sin(theta) cos(theta)] * obj.fixedPositions; end end end P.S. If you change one line to this: obj.fixedPositions = 100 * rand([2,numberOfTrees]) .* sign(rand([2,numberOfTrees]) - 0.5); Everything will work fine... it just wont plot.

    Read the article

  • open layers LineString not working

    - by AlexS
    Sorry to bother you guys, but I'm stuck with his problem for half a day. I want to draw poly line in OpenLayers using LineString object, so I've copied the example from documentation. It runs ok but i can't see the line on the screen Code looks like this <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> var map; var lineLayer ; var points; var style; var polygonFeature function test() { lineLayer = new OpenLayers.Layer.Vector("Line Layer"); style = { strokeColor: '#0000ff', strokeOpacity: 1, strokeWidth: 10 }; map.addLayer(lineLayer); points = new Array(); points[0] =new OpenLayers.LonLat(-2.460181,27.333984 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; points[1] = new OpenLayers.LonLat(-3.864255,-22.5 ).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject());; var linear_ring = new OpenLayers.Geometry.LinearRing(points); polygonFeature = new OpenLayers.Feature.Vector( new OpenLayers.Geometry.Polygon([linear_ring]), null, style); lineLayer.addFeatures([polygonFeature]); alert("1"); } function initialize() { map = new OpenLayers.Map ("map_canvas", { controls:[ new OpenLayers.Control.Navigation(), new OpenLayers.Control.PanZoomBar(), new OpenLayers.Control.LayerSwitcher(), new OpenLayers.Control.Attribution()], maxExtent: new OpenLayers.Bounds(-20037508.34,-20037508.34,20037508.34,20037508.34), maxResolution: 156543.0399, numZoomLevels: 19, units: 'm', projection: new OpenLayers.Projection("EPSG:900913"), displayProjection: new OpenLayers.Projection("EPSG:4326") }); // Define the map layer // Here we use a predefined layer that will be kept up to date with URL changes layerMapnik = new OpenLayers.Layer.OSM.Mapnik("Mapnik"); map.addLayer(layerMapnik); var lonLat = new OpenLayers.LonLat(0, 0).transform(new OpenLayers.Projection("EPSG:4326"), map.getProjectionObject()); map.zoomTo(3); map.setCenter(lonLat, 19); test(); } </head> <body onload="initialize()" > <div id="map_canvas" style="width: 828px; height: 698px"></div> I'm sure I'm missing some parameter in creation of map or something but I really can't figure which one.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Oracle WebCenter - Well Connected

    - by Brian Dirking
    800x600 Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif"; mso-bidi-font-family:"Times New Roman";} An good post from Dan Elam on the state of the ECM industry (http://www.aiim.org/community/blogs/community/ECM-Vendors-go-to-War) . For those of you who don’t know Dan, he is one of the major forces in the content management industry. He founded eVisory and IMERGE Consulting, he is an AIIM Fellow and a former US Technical Expert to the International Standards Organization (ISO), and has been a driving force behind EmTag, AIIM’s Emerging Technologies Group. His post is interesting – it starts out talking about our Moveoff Documentum campaign, but then it becomes a much deeper insight into the ECM industry. Dan points out that Oracle has been making quiet strides in the ECM industry. In fact, analysts share this view Oracle, pointing out Oracle is growing greater than 20% annually while many of the big vendors are shrinking. And as Dan points out, this cements Oracle as one of the big five in the ECM space – the same week that Autonomy was removed from the Gartner Magic Quadrant for ECM. One of the key things points out is that Oracle WebCenter is well connected. WebCenter has out-of-the-box connections to key enterprise applications such as E-Business Suite, PeopleSoft, Siebel and JD Edwards. Those out-of-the-box integrations make it easy for organizations to drive content right into the places where it is needed, in the midst of business processes. At the same time, WebCenter provides composite interface capabilities to bring together two or more of these enterprise applications onto the same screen. Combine that with the capabilities of Oracle Social Network, you start to see how Oracle is providing a full platform for user engagement. But beyond those connections, WebCenter can also connect to other content management systems. It can index and search those systems from a single point of search, bringing back results in a single combined hitlist. WebCenter can also extend records management capabilities into Documentum, SharePoint, and email archiving systems. From a single console, records managers can define a series, set a retention schedule, and place holds – without having to go to each system to make these updates. Dan points out that there are some new competitive dynamics – to be sure. And it is interesting when a system can interact with another system, enforce dispositions and holds, and enable users to search and retrieve content. Oracle WebCenter is providing the infrastructure to build on, and the interfaces to drive user engagement. It’s an interesting time.

    Read the article

  • On contract work, obligations to said contract, and looking out for yourself…

    - by jlnorsworthy
    Without boring you all with details, my last two contract assignments were cut short; I was given 3 days notice on one, and 4 weeks notice on the other. Neither of these were due to performance – they both basically came down budget issues. On my second contract, I got the feeling that I may not have been a great place to stay for the duration of my contract. Because of money/time spent getting me in the door, and the possible negative effect of my employer/recruiter, I decided to stay at least for a few months (and start looking several weeks before the end of my supposedly “extendable” contract). These experiences have left me a little wary of contract work. It seems that if I land a bad contract, that my recruiter would take a hit (reputation or otherwise) if I quickly found another job. But on the other hand, the client company won’t think twice of ending the contract early for any reason. I know that the counter argument to this is “maybe your recruiter shouldn’t have put you into a crappy assignment”… either way, it seems that since I am relying on him to provide me with work, that I should try to not damage his reputation with client companies. I’m basically brand new to contracting (these were my first two contracts) so these concerns are new to me. TLDR: Is contract work, by its very nature, largely unstable? Am I worried too much about my recruiter? Should I be quicker to start looking for a new job even after just weeks at a new company (when the environment seems unstable)? If so, do I look through my recruiter or just find another position by any means necessary?

    Read the article

  • Is Movable Type among the most secure PHP blogs? How secure are the various PHP blog applications?

    - by user6025
    Basically I'm trying to find a blog for a website, and security is the highest priority in our case. We don't need any features that I would imagine are special. Wordpress was our first idea, but its reputation precedes it, and though it may have cleaned up its act lately, I'm not seeing much solid evidence. I get the impression that Movable Type (at least the Perl version) has a much better reputation for security than Wordpress (historically at least). I'm not sure I want to take a chance with Wordpress at this point, but is there some objective source I can got to to back up (or counter) the notion that MT is at least among the best? Secunia doesn't recommend using their stats for comparisons, and securityfocus.com doesn't have stats at all that I can see. Searching here http://web.nvd.nist.gov makes MT look way better than WP (at least in 2007), but this site was referenced by MT's own page boasting about their security, so I don't know how relevant it is or how seriously people take it. Any suggestions on sites where I could/should make a somewhat objective comparison?

    Read the article

  • MOSC Bits - Personalized Profile

    - by Irina Donaldson - Moderator -Oracle
    It is a good idea to have a unique profile in MOSC. Your activities there are better recognized and might even become a well known brand! This leads to recognition and trust. My Oracle Support Communities (MOSC)  is a well established platform where experiences are shared. Reputation and trust are the basis for the quality of all communication there. A personalized  profile can help to build up a good reputation. Besides the experience counter, a good name, details about your location and business experience are valuable details. Although a little bit hidden, the profile's avatar can be customized, too. The profile's avatar is an eye catcher and can act as an unique visual representation for  you.  How to add / modify MOSC profile avatar (picture, icon)  ?    Don't look in Edit Profile section. After login, click on  your profile's name on top right.   This lists all public information as part of the Bio section. Select the Activity tab. The Change Avatar link is on same level at far right. A list of predefined symbolic pictures is populated. Choose from the list of existing pictures or try Add Another to upload an image file from your local computer (JPG, PNG, GIF, or BMP only, maximum file size of 2.0 MB). Note: New added images can be used only after running through a review process. Usually after one business day they can be selected for your personal avatar.

    Read the article

  • POLL: How do you build your interfaces in xcode for iphone/coco-touch applications?

    - by LolaRun
    Hi all, It's been 2 months i'm using xcode and building iphone apps, and i'm finding it really hard to grasp the good design for the applications. I always face problems like you can't put your tabbarcontroller in another custom viewcontroller sort of a thing? or other problems... That 'sometimes' - of course - would work if you did the creation of the views/viewcontrollers programmatically. so I don't know if i should start writing the creation of my objects or use interface builder. This is why i'm asking this poll question, to see what's the most accepted way among other developers. I'm not going to answer my question, so the votes would not increase my reputation and risk my poll being closed soon. I prefer that the first two readers of this question should answer by 'using IB' and the second one 'programmatically' and the rest would vote up or down for these two answers. And don't vote my question either, i just need to know, and maybe someone else wants to know. so the longer this question lives the better. and gaining nothing from it concerning reputation would help that cause. thank you all for your cooperation. and go ahead and answer Peace

    Read the article

  • Choosing a VS project type (C++)

    - by typoknig
    Hi all, I do not use C++ much (I try to stick to the easier stuff like Java and VB.NET), but the lately I have not had a choice. When I am picking a project type in VS for some C++ source I download, what project type should I pick? I had just been sticking with Win32 Console Applications, but I just downloaded some code (below) that will not work right even when it compiles with out errors. I have tried to use a CLR Console Application and an empty project too, and have changed many variables along the way, but I cannot get this code to work. I noticed that this code does not have "int main()" at its beginning, does that have something to do with it? Anyways, here is the code, got it from here: /* Demo of modified Lucas-Kanade optical flow algorithm. See the printf below */ #ifdef _CH_ #pragma package <opencv> #endif #ifndef _EiC #include "cv.h" #include "highgui.h" #include <stdio.h> #include <ctype.h> #endif #include <windows.h> #define FULL_IMAGE_AS_OUTPUT_FILE #define cvMirror cvFlip //IplImage *image = 0, *grey = 0, *prev_grey = 0, *pyramid = 0, *prev_pyramid = 0, *swap_temp; IplImage **buf = 0; IplImage *image1 = 0; IplImage *imageCopy=0; IplImage *image = 0; int win_size = 10; const int MAX_COUNT = 500; CvPoint2D32f* points[2] = {0,0}, *swap_points; char* status = 0; //int count = 0; //int need_to_init = 0; //int night_mode = 0; int flags = 0; //int add_remove_pt = 0; bool bLButtonDown = false; //bool bstopLoop = false; CvPoint pt, pt1,pt2; //IplImage* img1; FILE* FileDest; char* strImageDir = "E:\\Projects\\TSCreator\\Images"; char* strItemName = "b"; int imageCount=0; int bFirstFace = 1; // flag for first face int mode = 1; // Mode 1 - Haar Traing Sample Creation, 2 - HMM sample creation, Mode = 3 - Both Harr and HMM. //int startImgeNo = 1; bool isEqualRation = false; //Weidth to height ratio is equal //Selected Image data IplImage *selectedImage = 0; int selectedX = 0, selectedY = 0, currentImageNo = 0, selectedWidth = 0, selectedHeight= 0; CvRect selectedROI; void saveFroHarrTraining(IplImage *src, int x, int y, int width, int height, int imageCount); void saveForHMMTraining(IplImage *src, CvRect roi,int imageCount); // Code for draw ROI Cropping Image void on_mouse( int event, int x, int y, int flags, void* param ) { char f[200]; CvRect reg; if( !image ) return; if( event == CV_EVENT_LBUTTONDOWN ) { bLButtonDown = true; pt1.x = x; pt1.y = y; } else if ( event == CV_EVENT_MOUSEMOVE ) //Draw the selected area rectangle { pt2.x = x; pt2.y = y; if(bLButtonDown) { if( !image1 ) { /* allocate all the buffers */ image1 = cvCreateImage( cvGetSize(image), 8, 3 ); image1->origin = image->origin; points[0] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); points[1] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); status = (char*)cvAlloc(MAX_COUNT); flags = 0; } cvCopy( image, image1, 0 ); //Equal Weight-Height Ratio if(isEqualRation) { pt2.y = pt1.y + (pt2.x-pt1.x); } //Max Height and Width is the image width and height if(pt2.x>image->width) { pt2.x = image->width; } if(pt2.y>image->height) { pt2.y = image->height; } CvPoint InnerPt1 = pt1; CvPoint InnerPt2 = pt2; if ( InnerPt1.x > InnerPt2.x) { int tempX = InnerPt1.x; InnerPt1.x = InnerPt2.x; InnerPt2.x = tempX; } if ( pt2.y < InnerPt1.y ) { int tempY = InnerPt1.y; InnerPt1.y = InnerPt2.y; InnerPt2.y = tempY; } InnerPt1.y = image->height - InnerPt1.y; InnerPt2.y = image->height - InnerPt2.y; CvFont font; double hScale=1.0; double vScale=1.0; int lineWidth=1; cvInitFont(&font,CV_FONT_HERSHEY_SIMPLEX|CV_FONT_ITALIC, hScale,vScale,0,lineWidth); char size [200]; reg.x = pt1.x; reg.y = image->height - pt2.y; reg.height = abs (pt2.y - pt1.y); reg.width = InnerPt2.x -InnerPt1.x; //print width and heght of the selected reagion sprintf(size, "(%dx%d)",reg.width, reg.height); cvPutText (image1,size,cvPoint(10,10), &font, cvScalar(255,255,0)); cvRectangle(image1, InnerPt1, InnerPt2, CV_RGB(255,0,0), 1); //Mark Selected Reagion selectedImage = image; selectedX = pt1.x; selectedY = pt1.y; selectedWidth = reg.width; selectedHeight = reg.height; selectedROI = reg; //Show the modified image cvShowImage("HMM-Harr Positive Image Creator",image1); } } else if ( event == CV_EVENT_LBUTTONUP ) { bLButtonDown = false; // pt2.x = x; // pt2.y = y; // // if ( pt1.x > pt2.x) // { // int tempX = pt1.x; // pt1.x = pt2.x; // pt2.x = tempX; // } // // if ( pt2.y < pt1.y ) // { // int tempY = pt1.y; // pt1.y = pt2.y; // pt2.y = tempY; // // } // //reg.x = pt1.x; //reg.y = image->height - pt2.y; // //reg.height = abs (pt2.y - pt1.y); ////reg.width = reg.height/3; //reg.width = pt2.x -pt1.x; ////reg.height = (2 * reg.width)/3; #ifdef FULL_IMAGE_AS_OUTPUT_FILE CvRect FullImageRect; FullImageRect.x = 0; FullImageRect.y = 0; FullImageRect.width = image->width; FullImageRect.height = image->height; IplImage *regionFullImage =0; regionFullImage = cvCreateImage(cvSize (FullImageRect.width, FullImageRect.height), image->depth, image->nChannels); image->roi = NULL; //cvSetImageROI (image, FullImageRect); //cvCopy (image, regionFullImage, 0); #else IplImage *region =0; region = cvCreateImage(cvSize (reg.width, reg.height), image1->depth, image1->nChannels); image->roi = NULL; cvSetImageROI (image1, reg); cvCopy (image1, region, 0); #endif //cvNamedWindow("Result", CV_WINDOW_AUTOSIZE); //selectedImage = image; //selectedX = pt1.x; //selectedY = pt1.y; //selectedWidth = reg.width; //selectedHeight = reg.height; ////currentImageNo = startImgeNo; //selectedROI = reg; /*if(mode == 1) { saveFroHarrTraining(image,pt1.x,pt1.y,reg.width,reg.height,startImgeNo); } else if(mode == 2) { saveForHMMTraining(image,reg,startImgeNo); } else if(mode ==3) { saveFroHarrTraining(image,pt1.x,pt1.y,reg.width,reg.height,startImgeNo); saveForHMMTraining(image,reg,startImgeNo); } else { printf("Invalid mode."); } startImgeNo++;*/ } } /* Save popsitive samples for Harr Training. Also add an entry to the PositiveSample.txt with the location of the item of interest. */ void saveFroHarrTraining(IplImage *src, int x, int y, int width, int height, int imageCount) { char f[255] ; sprintf(f,"%s\\%s\\harr_%s%d%d.jpg",strImageDir,strItemName,strItemName,imageCount/10, imageCount%10); cvNamedWindow("Harr", CV_WINDOW_AUTOSIZE); cvShowImage("Harr", src); cvSaveImage(f, src); printf("output%d%d \t ", imageCount/10, imageCount%10); printf("width %d \t", width); printf("height %d \t", height); printf("x1 %d \t", x); printf("y1 %d \t\n", y); char f1[255]; sprintf(f1,"%s\\PositiveSample.txt",strImageDir); FileDest = fopen(f1, "a"); fprintf(FileDest, "%s\\harr_%s%d.jpg 1 %d %d %d %d \n",strItemName,strItemName, imageCount, x, y, width, height); fclose(FileDest); } /* Create Sample Images for HMM recognition algorythm trai ning. */ void saveForHMMTraining(IplImage *src, CvRect roi,int imageCount) { char f[255] ; printf("x=%d, y=%d, w= %d, h= %d\n",roi.x,roi.y,roi.width,roi.height); //Create the file name sprintf(f,"%s\\%s\\hmm_%s%d.pgm",strImageDir,strItemName,strItemName, imageCount); //Create storage for grayscale image IplImage* gray = cvCreateImage(cvSize(roi.width,roi.height), 8, 1); //Create storage for croped reagon IplImage* regionFullImage = cvCreateImage(cvSize(roi.width,roi.height),8,3); //Croped marked region cvSetImageROI(src,roi); cvCopy(src,regionFullImage); cvResetImageROI(src); //Flip croped image - otherwise it will saved upside down cvConvertImage(regionFullImage, regionFullImage, CV_CVTIMG_FLIP); //Convert croped image to gray scale cvCvtColor(regionFullImage,gray, CV_BGR2GRAY); //Show final grayscale image cvNamedWindow("HMM", CV_WINDOW_AUTOSIZE); cvShowImage("HMM", gray); //Save final grayscale image cvSaveImage(f, gray); } int maina( int argc, char** argv ) { CvCapture* capture = 0; //if( argc == 1 || (argc == 2 && strlen(argv[1]) == 1 && isdigit(argv[1][0]))) // capture = cvCaptureFromCAM( argc == 2 ? argv[1][0] - '0' : 0 ); //else if( argc == 2 ) // capture = cvCaptureFromAVI( argv[1] ); char* video; if(argc ==7) { mode = atoi(argv[1]); strImageDir = argv[2]; strItemName = argv[3]; video = argv[4]; currentImageNo = atoi(argv[5]); int a = atoi(argv[6]); if(a==1) { isEqualRation = true; } else { isEqualRation = false; } } else { printf("\nUsage: TSCreator.exe <Mode> <Sample Image Save Path> <Sample Image Save Directory> <Video File Location> <Start Image No> <Is Equal Ratio>\n"); printf("Mode = 1 - Haar Traing Sample Creation. \nMode = 2 - HMM sample creation.\nMode = 3 - Both Harr and HMM\n"); printf("Is Equal Ratio = 0 or 1. 1 - Equal weidth and height, 0 - custom."); printf("Note: You have to create the image save directory in correct path first.\n"); printf("Eg: TSCreator.exe 1 E:\Projects\TSCreator\Images A 11.avi 1 1\n\n"); return 0; } capture = cvCaptureFromAVI(video); if( !capture ) { fprintf(stderr,"Could not initialize capturing...\n"); return -1; } cvNamedWindow("HMM-Harr Positive Image Creator", CV_WINDOW_AUTOSIZE); cvSetMouseCallback("HMM-Harr Positive Image Creator", on_mouse, 0); //cvShowImage("Test", image1); for(;;) { IplImage* frame = 0; int i, k, c; frame = cvQueryFrame( capture ); if( !frame ) break; if( !image ) { /* allocate all the buffers */ image = cvCreateImage( cvGetSize(frame), 8, 3 ); image->origin = frame->origin; //grey = cvCreateImage( cvGetSize(frame), 8, 1 ); //prev_grey = cvCreateImage( cvGetSize(frame), 8, 1 ); //pyramid = cvCreateImage( cvGetSize(frame), 8, 1 ); // prev_pyramid = cvCreateImage( cvGetSize(frame), 8, 1 ); points[0] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); points[1] = (CvPoint2D32f*)cvAlloc(MAX_COUNT*sizeof(points[0][0])); status = (char*)cvAlloc(MAX_COUNT); flags = 0; } cvCopy( frame, image, 0 ); // cvCvtColor( image, grey, CV_BGR2GRAY ); cvShowImage("HMM-Harr Positive Image Creator", image); cvSetMouseCallback("HMM-Harr Positive Image Creator", on_mouse, 0); c = cvWaitKey(0); if((char)c == 's') { //Save selected reagion as training data if(selectedImage) { printf("Selected Reagion Saved\n"); if(mode == 1) { saveFroHarrTraining(selectedImage,selectedX,selectedY,selectedWidth,selectedHeight,currentImageNo); } else if(mode == 2) { saveForHMMTraining(selectedImage,selectedROI,currentImageNo); } else if(mode ==3) { saveFroHarrTraining(selectedImage,selectedX,selectedY,selectedWidth,selectedHeight,currentImageNo); saveForHMMTraining(selectedImage,selectedROI,currentImageNo); } else { printf("Invalid mode."); } currentImageNo++; } } } cvReleaseCapture( &capture ); //cvDestroyWindow("HMM-Harr Positive Image Creator"); cvDestroyAllWindows(); return 0; } #ifdef _EiC main(1,"lkdemo.c"); #endif If I put... #include "stdafx.h" int _tmain(int argc, _TCHAR* argv[]) { return 0; } ... before the previous code (and link it to the correct OpenCV .lib files) it compiles without errors, but does nothing at the command line. How do I make it work?

    Read the article

  • Sphinx PHP Geodist problems

    - by James
    Below is my PHP function to call nearby points using Sphinx for MySQL. There are hundreds of thousands of nearby points which to what I can tell, are being indexed by Sphinx, but simply fails silently when searching with Sphinx. Other Sphinx queries I run against other indexes work completely fine. function nearby($latitude, $longitude, $radius) { global $sphinx; $sphinx->SetMatchMode(SPH_MATCH_ALL); $sphinx->SetArrayResult(true); $sphinx->SetLimits(0, 1000); $sphinx->SetGeoAnchor('latitude', 'longitude', (float) deg2rad($latitude), (float) deg2rad($longitude)); $circle = (float) $radius * 1.609344; $sphinx->SetFilterFloatRange('@geodist', 0.0, $circle); $matches = $sphinx->Query('', 'geo'); return $matches; } $nearby = nearby($latitude, $longitude, 10000); var_dump($nearby); This, when called with valid latitude and longitude co-ords and a very large radius for debugging produces: bool(false) Below is my sphinx.conf covering the geo part: source geo { type = mysql sql_host = 127.0.0.1 sql_user = user sql_pass = pass sql_db = db sql_port = 3306 sql_query_pre = set names utf8 sql_query_pre = set session query_cache_type=OFF sql_query = SELECT id,city,region,country,radians(longitude) AS longitude, radians(latitude) AS latitude FROM points; sql_attr_float = longitude sql_attr_float = latitude sql_ranged_throttle = 0 sql_query_info = SELECT * FROM points WHERE id = $id } index geo { source = geo path = /var/data/geo docinfo = extern #mlock = 0 #morphology = none min_word_len = 1 charset_type = utf-8 #charset_table = 0..9, A..Z->a..z, _, a..z, U+410..U+42F->U+430..U+44F, U+430..U+44F ignore_chars = U+00AD html_strip = 0 enable_star = 0 } indexer { mem_limit = 1024M } searchd { port = 3312 log = /var/log/searchd.log query_log = /var/log/query.log read_timeout = 5 max_children = 5 pid_file = /var/log/searchd.pid max_matches = 10000 seamless_rotate = 1 preopen_indexes = 0 unlink_old = 1 }

    Read the article

  • Calculating skew of text OpenCV

    - by Nick
    I am trying to calculate the skew of text in an image so I can correct it for the best OCR results. Currently this is the function I am using: double compute_skew(Mat &img) { // Binarize cv::threshold(img, img, 225, 255, cv::THRESH_BINARY); // Invert colors cv::bitwise_not(img, img); cv::Mat element = cv::getStructuringElement(cv::MORPH_RECT, cv::Size(5, 3)); cv::erode(img, img, element); std::vector<cv::Point> points; cv::Mat_<uchar>::iterator it = img.begin<uchar>(); cv::Mat_<uchar>::iterator end = img.end<uchar>(); for (; it != end; ++it) if (*it) points.push_back(it.pos()); cv::RotatedRect box = cv::minAreaRect(cv::Mat(points)); double angle = box.angle; if (angle < -45.) angle += 90.; cv::Point2f vertices[4]; box.points(vertices); for(int i = 0; i < 4; ++i) cv::line(img, vertices[i], vertices[(i + 1) % 4], cv::Scalar(255, 0, 0), 1, CV_AA); return angle; } When I look at then angle in debug I get 0.000000 However when I give it this image I get proper results of a skew of about 16 degrees: How can I properly detect the skew in the first image?

    Read the article

  • MsChart : Partial view error

    - by Poomjai
    Hi I have a problem when i using Mschart on my MVC project, when i use the first index page of project to render for the partial view name index2 the code is <% Html.RenderPartial("Index2"); %> But when i run it the error is occur which the message is CS0029: Cannot implicitly convert type 'ASP.views_home_index2_ascx' to 'System.Web.UI.Page' -it said that the problem line of code is : // Render chart control Line 52: Chart2.Page = this; << At here Line 53: HtmlTextWriter writer = new HtmlTextWriter(Page.Response.Output); Line 54: Chart2.RenderControl(writer); But when i put all of code in Index2.ascx to the index.aspx and not to render the partial view it work fine Code of Index2.ascx is <% System.Web.UI.DataVisualization.Charting.Chart Chart2 = new System.Web.UI.DataVisualization.Charting.Chart(); Chart2.Width = 412; Chart2.Height = 296; Chart2.RenderType = RenderType.ImageTag; Chart2.Palette = ChartColorPalette.BrightPastel; Title t = new Title("No Code Behind Page", Docking.Top, new System.Drawing.Font("Trebuchet MS", 14, System.Drawing.FontStyle.Bold), System.Drawing.Color.FromArgb(26, 59, 105)); Chart2.Titles.Add(t); Chart2.ChartAreas.Add("Series 1"); Chart2.Series.Add("Series 1"); // add points to series 1 Chart2.Series["Series 1"].Points.AddY(3); Chart2.Series["Series 1"].Points.AddY(4); Chart2.Series["Series 1"].Points.AddY(5); Chart2.BorderSkin.SkinStyle = BorderSkinStyle.Emboss; Chart2.BorderColor = System.Drawing.Color.FromArgb(26, 59, 105); Chart2.BorderlineDashStyle = ChartDashStyle.Solid; Chart2.BorderWidth = 2; Chart2.Legends.Add("Legend1"); // Render chart control Chart2.Page = this; HtmlTextWriter writer = new HtmlTextWriter(Page.Response.Output); Chart2.RenderControl(writer); %

    Read the article

  • Trend analysis using iterative value increments

    - by Dave Jarvis
    We have configured iReport to generate the following graph: The real data points are in blue, the trend line is green. The problems include: Too many data points for the trend line Trend line does not follow a Bezier curve (spline) The source of the problem is with the incrementer class. The incrementer is provided with the data points iteratively. There does not appear to be a way to get the set of data. The code that calculates the trend line looks as follows: import java.math.BigDecimal; import net.sf.jasperreports.engine.fill.*; /** * Used by an iReport variable to increment its average. */ public class MovingAverageIncrementer implements JRIncrementer { private BigDecimal average; private int incr = 0; /** * Instantiated by the MovingAverageIncrementerFactory class. */ public MovingAverageIncrementer() { } /** * Returns the newly incremented value, which is calculated by averaging * the previous value from the previous call to this method. * * @param jrFillVariable Unused. * @param object New data point to average. * @param abstractValueProvider Unused. * @return The newly incremented value. */ public Object increment( JRFillVariable jrFillVariable, Object object, AbstractValueProvider abstractValueProvider ) { BigDecimal value = new BigDecimal( ( ( Number )object ).doubleValue() ); // Average every 10 data points // if( incr % 10 == 0 ) { setAverage( ( value.add( getAverage() ).doubleValue() / 2.0 ) ); } incr++; return getAverage(); } /** * Changes the value that is the moving average. * @param average The new moving average value. */ private void setAverage( BigDecimal average ) { this.average = average; } /** * Returns the current moving average average. * @return Value used for plotting on a report. */ protected BigDecimal getAverage() { if( this.average == null ) { this.average = new BigDecimal( 0 ); } return this.average; } /** Helper method. */ private void setAverage( double d ) { setAverage( new BigDecimal( d ) ); } } How would you create a smoother and more accurate representation of the trend line?

    Read the article

  • What Qt container class to use for a sorted list?

    - by Dave
    Part of my application involves rendering audio waveforms. The user will be able to zoom in/out of the waveform. Starting at fully zoomed-out, I only want to sample the audio at the necessary internals to draw the waveform at the given resolution. Then, when they zoom in, asynchronously resample the "missing points" and provide a clearer waveform. (Think Google Maps.) I'm not sure the best data structure to use in Qt world. Ideally, I would like to store data samples sorted by time, but with the ability to fill-in points as needed. So, for example, the data points might initially look like: data[0 ms] = 10 data[10 ms] = 32 data[20 ms] = 21 ... But when they zoom in, I would get more points as necessary, perhaps: data[0 ms] = 10 data[2 ms] = 11 data[4 ms] = 18 data[6 ms] = 30 data[10 ms] = 32 data[20 ms] = 21 ... Note that the values in brackets are lookup values (milliseconds), not array indices. In .Net I might have used a SortedList<int, int>. What would be the best class to use in Qt? Or should I use a STL container?

    Read the article

  • What is the best way to save a list of objects to an XML file and load that list back using C#?

    - by Siracuse
    I have a list of "Gesture" classes in my application: List<Gesture> gestures = new List<Gesture>(); These gesture classes are pretty simple: public class Gesture { public String Name { get; set; } public List<Point> Points { get; set; } public List<Point> TransformedPoints { get; set; } public Gesture(List<Point> Points, String Name) { this.Points = new List<Point>(Points); this.Name = Name; } } I would like to allow the user to both save the current state of "gestures" to a file and also be able to load a file that contains the data of the gestures. What is the standard way to do this in C#? Should I use Serialization? Should I write a class to handle writing/reading this XML file by hand myself? Are there any other ways?

    Read the article

  • django: grouping in an order_by query?

    - by AP257
    Hi all, I want to allocate rankings to users, based on a points field. Easy enough you'd think with an order_by query. But how do I deal with the situation where two users have the same number of points and need to share the same ranking? Should I use annotate to find users with the same number of points? My current code, and a pseudocode description of what I'd like to do, are below. top_users = User.objects.filter(problem_user=False).order_by('-points_total') # Wrong - in pseudocode, this should be # Get the highest points_total, find all the users with that points_total, # if there is more than one user, set status to 'Joint first prize', # otherwise set status to 'First prize' top_users[0].status = "First prize" if (top_users[1]): top_users[1].status = "Second prize" if (top_users[2]): top_users[2].status = "Third prize" if (top_users[3]): top_users[3:].status = "Highly commended" The code above doesn't deal with the situation where two users have the same number of points and need to share second prize. I guess I need to create a query that looks for unique values of points_total, and does some kind of nested ranking? It also doesn't cope with the fact that sometimes there are fewer than 4 users - does anyone know how I can do (in pseudocode) 'if top_users[1] is not null...' in Python?

    Read the article

  • Good hash function for a 2d index

    - by rlbond
    I have a struct called Point. Point is pretty simple: struct Point { Row row; Column column; // some other code for addition and subtraction of points is there too } Row and Column are basically glorified ints, but I got sick of accidentally transposing the input arguments to functions and gave them each a wrapper class. Right now I use a set of points, but repeated lookups are really slowing things down. I want to switch to an unordered_set. So, I want to have an unordered_set of Points. Typically this set might contain, for example, every point on a 80x24 terminal = 1920 points. I need a good hash function. I just came up with the following: struct PointHash : public std::unary_function<Point, std::size_t> { result_type operator()(const argument_type& val) const { return val.row.value() * 1000 + val.col.value(); } }; However, I'm not sure that this is really a good hash function. I wanted something fast, since I need to do many lookups very quickly. Is there a better hash function I can use, or is this OK?

    Read the article

  • deepcopy and python - tips to avoid using it?

    - by blackkettle
    Hi, I have a very simple python routine that involves cycling through a list of roughly 20,000 latitude,longitude coordinates and calculating the distance of each point to a reference point. def compute_nearest_points( lat, lon, nPoints=5 ): """Find the nearest N points, given the input coordinates.""" points = session.query(PointIndex).all() oldNearest = [] newNearest = [] for n in xrange(nPoints): oldNearest.append(PointDistance(None,None,None,99999.0,99999.0)) newNearest.append(obj2) #This is almost certainly an inappropriate use of deepcopy # but how SHOULD I be doing this?!?! for point in points: distance = compute_spherical_law_of_cosines( lat, lon, point.avg_lat, point.avg_lon ) k = 0 for p in oldNearest: if distance < p.distance: newNearest[k] = PointDistance( point.point, point.kana, point.english, point.avg_lat, point.avg_lon, distance=distance ) break else: newNearest[k] = deepcopy(oldNearest[k]) k += 1 for j in range(k,nPoints-1): newNearest[j+1] = deepcopy(oldNearest[j]) oldNearest = deepcopy(newNearest) #We're done, now print the result for point in oldNearest: print point.station, point.english, point.distance return I initially wrote this in C, using the exact same approach, and it works fine there, and is basically instantaneous for nPoints<=100. So I decided to port it to python because I wanted to use SqlAlchemy to do some other stuff. I first ported it without the deepcopy statements that now pepper the method, and this caused the results to be 'odd', or partially incorrect, because some of the points were just getting copied as references(I guess? I think?) -- but it was still pretty nearly as fast as the C version. Now with the deepcopy calls added, the routine does it's job correctly, but it has incurred an extreme performance penalty, and now takes several seconds to do the same job. This seems like a pretty common job, but I'm clearly not doing it the pythonic way. How should I be doing this so that I still get the correct results but don't have to include deepcopy everywhere?

    Read the article

  • What am I doing wrong with my Shoes program?

    - by dmonroe4919
    #Shoes.app(:title => "Collinear Points", :width => 450, :height => 350) do def calculate math.sqrt(((@[email protected]_f)**2)+((@[email protected]_f)**2)+((@[email protected]_f)**2)) end def compute math.sqrt(((@[email protected]_f)**2)+((@[email protected]_f)**2)+((@[email protected]_f)**2)) end def capture math.sqrt(((@[email protected]_f)**2)+((@[email protected]_f)**2)+((@[email protected]_f)**2)) end stack(:width => '100%', :margin => 20) do para('Calculate Collinear Points') para(' x y z') end flow(:width => '100%' ) do para('Point A: ') @alphax = edit_line(:width => 100, height => 35) {@collinear.text = calculate} @alphay = edit_line(:width => 100, height => 35) {@collinear.text = calculate} @alphaz = edit_line(:width => 100, height => 35) {@collinear.text = calculate} end flow(:width => '100%' ) do para('Point B: ') @betax = edit_line(:width => 100, height => 35) {@collinear.text = compute} @betay = edit_line(:width => 100, height => 35) {@collinear.text = compute} @betaz = edit_line(:width => 100, height => 35) {@collinear.text = compute} end flow(:width => '100%' ) do para('Point C: ') @gammax = edit_line(:width => 100, height => 35) {@collinear.text = capture} @gammay = edit_line(:width => 100, height => 35) {@collinear.text = capture} @gammaz = edit_line(:width => 100, height => 35) {@collinear.text = capture} end button("Configure") @button.click do c = calculate+compute=capture case c when c=true alert("Points are collinear, equation is ") when c=false alert("Points are non-collinear") end end

    Read the article

  • Calculating distance from latitude, longitude and height using a geocentric co-ordinate system

    - by Sarge
    I've implemented this method in Javascript and I'm roughly 2.5% out and I'd like to understand why. My input data is an array of points represented as latitude, longitude and the height above the WGS84 ellipsoid. These points are taken from data collected from a wrist-mounted GPS device during a marathon race. My algorithm was to convert each point to cartesian geocentric co-ordinates and then compute the Euclidean distance (c.f Pythagoras). Cartesian geocentric is also known as Earth Centred Earth Fixed. i.e. it's an X, Y, Z co-ordinate system which rotates with the earth. My test data was the data from a marathon and so the distance should be very close to 42.26km. However, the distance comes to about 43.4km. I've tried various approaches and nothing changes the result by more than a metre. e.g. I replaced the height data with data from the NASA SRTM mission, I've set the height to zero, etc. Using Google, I found two points in the literature where lat, lon, height had been transformed and my transformation algorithm is matching. What could explain this? Am I expecting too much from Javascript's double representation? (The X, Y, Z numbers are very big but the differences between two points is very small). My alternative is to move to computing the geodesic across the WGS84 ellipsoid using Vincenty's algorithm (or similar) and then calculating the Euclidean distance with the two heights but this seems inaccurate. Thanks in advance for your help!

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

< Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >