Search Results

Search found 28919 results on 1157 pages for 'open'.

Page 310/1157 | < Previous Page | 306 307 308 309 310 311 312 313 314 315 316 317  | Next Page >

  • complicated graphviz tree structure

    - by thomas
    Hello. I am trying to create a tree structure with graphviz. I am open to either writing the graphviz code by hand or using the ruby-graphviz gem for ruby. Given the below picture can anyone provide any insight on the necessary code? Ignore that the lines are not straight...they should be when graphviz builds the graph. I am open to having dots/points when lines intersect as well. I have played with ruby-graphviz and the family tree class...this is getting me part of the way there but I really need all lines to be straight and intersect at right angles and the out-of-the-box code doesn't seem to do that.

    Read the article

  • Downloading file from server (asp.net) to IE8 Content-Disposition problem with file name

    - by David
    I am downloading a file from the server/database via aspx page. When using the content-disposition inline the document opens in correct application but the file name is the same as the web page. I want the document to open in say MS Word but with the correct file name. Here is the code that I am using Response.Buffer = true; Response.ClearContent(); Response.ClearHeaders(); Response.Clear(); Response.ContentType = MimeType(fileName); //function to return the correct MIME TYPE Response.AddHeader("Content-Disposition", @"inline;filename=" + fileName); Response.AddHeader("Content-Length", image.Length.ToString()); Response.BinaryWrite(image); Response.Flush(); Response.Close(); So again, I want the file to open in MS Word with the correct document file name so that the user can properly save/view. Ideas? thanks

    Read the article

  • How do I use a datetime variable with createparameter in classic ASP?

    - by Frank Schmitt
    I'm having a heck of a time trying to create a parameterized query that binds a date variable into a stored procedure call: twoyearsago = dateadd("yyyy", -2, date()) DataConn.ConnectionString = myConnectionString DataConn.Open Set rs = Server.CreateObject("ADODB.Recordset") Set DataCmd = Server.CreateObject("ADODB.Command") DataCmd.ActiveConnection = DataConn DataCmd.CommandText = "exec myStoredProc ?, ?" DataCmd.Parameters.Append DataCmd.CreateParameter("@start", adDate, , 10, date()) DataCmd.Parameters.Append DataCmd.CreateParameter("@end", adDate, , 10, twoyearsago) rs.Open DataCmd The stored proc returns nothing (indicating the dates aren't making it through). If I hard code dates in the query, e.g.: DataCmd.CommandText = "exec myStoredProc '01/01/2008', '01/01/2010'" I get the results I would expect. Calling CStr on my dates (if that makes a difference) returns them in the above format.

    Read the article

  • Possible reasons for tellg() failing?

    - by Andreas Bonini
    ifstream::tellg() is returning -13 for a certain file. Basically, I wrote a utility that analyzes some source code; I open all files alphabetically, I start with "Apple.cpp" and it works perfectly.. But when it gets to "Conversion.cpp", always on the same file, after reading one line successfully tellg() returns -13. The code in question is: for (int i = 0; i < files.size(); ++i) { /* For each .cpp and .h file */ TextIFile f(files[i]); while (!f.AtEof()) // When it gets to conversion.cpp (not on the others) // first is always successful, second always fails lines.push_back(f.ReadLine()); The code for AtEof is: bool AtEof() { if (mFile.tellg() < 0) FATAL(format("DEBUG - tellg(): %d") % mFile.tellg()); if (mFile.tellg() >= GetSize()) return true; return false; } After it reads successfully the first line of Conversion.cpp, it always crashes with DEBUG - tellg(): -13. This is the whole TextIFile class (wrote by me, the error may be there): class TextIFile { public: TextIFile(const string& path) : mPath(path), mSize(0) { mFile.open(path.c_str(), std::ios::in); if (!mFile.is_open()) FATAL(format("Cannot open %s: %s") % path.c_str() % strerror(errno)); } string GetPath() const { return mPath; } size_t GetSize() { if (mSize) return mSize; const size_t current_position = mFile.tellg(); mFile.seekg(0, std::ios::end); mSize = mFile.tellg(); mFile.seekg(current_position); return mSize; } bool AtEof() { if (mFile.tellg() < 0) FATAL(format("DEBUG - tellg(): %d") % mFile.tellg()); if (mFile.tellg() >= GetSize()) return true; return false; } string ReadLine() { string ret; getline(mFile, ret); CheckErrors(); return ret; } string ReadWhole() { string ret((std::istreambuf_iterator<char>(mFile)), std::istreambuf_iterator<char>()); CheckErrors(); return ret; } private: void CheckErrors() { if (!mFile.good()) FATAL(format("An error has occured while performing an I/O operation on %s") % mPath); } const string mPath; ifstream mFile; size_t mSize; }; Platform is Visual Studio, 32 bit, Windows. Edit: Works on Linux. Edit: I found the cause: line endings. Both Conversion and Guid and others had \n instead of \r\n. I saved them with \r\n instead and it worked. Still, this is not supposed to happen is it?

    Read the article

  • want to "saveas" openoffice word document into text by perl program..

    - by siva prasad
    hi all... i need a way to "saveas" .doc file in open office to .txt .i need a program in Perl which can do that automatically.that means i don't want to open that word document and go to saveas and do it...what i need is i will just give word document name and that script should give the corresponding txt file as output. one important thing is my system is Linux based one.i saw the same program for windows system here only. but i need this program in Linux. that to "antiword" ,"catdoc","wv ware" commends are not working in my Linux.. please help me regarding this. thank u in advance.

    Read the article

  • Debugging ASP.NET Strings Downloaded to Browser (Montréal instead of Montréal)

    - by jdk
    I'm downloading a vCard to the browser using Response.Write to output .NET strings with special accented characters. Mime type is text/x-vcard and French characters are appearing wrong in Outlook, for example Montréal;Québec .NET string shows as Montréal Québec in browser. I'm using this vCard generator code from CodeProject.com I've played with the System.Encoding sample code at the bottom of this linked MSDN page to convert the unicode string into bytes and then write the ascii bytes but then I get Montr?al Qu?bec (progress but not a win). Also I've tried setting content type to both us-ascii and utf-8 of the response. If I open the downloaded vCard in Windows Notepad and save it as ANSI text (instead of default unicode format) and open in Outlook it's okay. So my assumption is I need to cause download of ANSI charset but am unsure if I'm doing it wrong or have a misunderstanding of where to start. Update: Looking at the raw HTTP, it appears my French characters are being downloaded in the unexpected format so it looks like I need to do some work on the server side... (full size)

    Read the article

  • Reuse another ASP.NET session (set Session ID)

    - by queen3
    My problem is that when I open web application from Outlook in a separate IE window, the ASP.NET session is lost. This is (as described in several places) because in-memory cookie is lost. So it goes like this: User works with ASP.NET web application in Outlook, and this stores some info in ASP.NET session User clicks Print to open new IE window with print-ready data The new window has different ASP.NET session ID and can't access old data. I think, maybe, if I pass ASP.NET session ID to new IE window, I can somehow "attach" to that session? Tell ASP.NET that this is the one that I need to be current?

    Read the article

  • Problem in Rail Casts Episode 190

    - by Gautam
    Hello, This is the code I have written require 'rubygems' require 'nokogiri' require 'open-uri' url = "http://timesofindia.indiatimes.com/rssfeeds/-2128838597.cms" doc = Nokogiri::HTML(open(url)) puts doc.at_css("title").text and I am getting this output. I have installed Nokogiri. I use Windows 7 C:\Ruby>ruby hello.rb C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/nokogiri.rb:1:in `require': 127: The specified procedure could not be found. - Init_nokogiri (LoadError) C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/1.9/nokogiri.so from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/nokogiri.rb:1:in `<top (required)>' from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri.rb:13:in `require' from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri.rb:13:in `<top (required)>' from hello.rb:2:in `require' from hello.rb:2:in `<main>'

    Read the article

  • Firefox-Addon: Restart and save all current tabs and windows

    - by nokturnal
    Hello guys / gals, First off, this is my first attempt at writing an add-on. That being said, I am attempting to write an add-on that makes some configuration changes and needs to restart Firefox in order to have the changes take effect. I am currently restarting Firefox using the following code: var boot = Components.classes["@mozilla.org/toolkit/app-startup;1"].getService(Components.interfaces.nsIAppStartup); boot.quit(Components.interfaces.nsIAppStartup.eForceQuit|Components.interfaces.nsIAppStartup.eRestart); The problem is, it restarts and opens the browser window(s) to whatever the users homepage is currently set to. I want it to re-open all windows / tabs that were previously open before the restart (similar to what happens when you install a new add-on). Anyone ever messed with this type of functionality before?

    Read the article

  • glassfish v3.0 hangs no app is ever deployed and no error is ever shown

    - by Samuel Lopez
    I have a web app that uses JSF 2.0 with richFaces and primeFaces, hibernate and java and I use NetBeans 7.1.2 as the IDE when I run the app the glassfish server is started and the log shows this: Launching GlassFish on Felix platform Información: Running GlassFish Version: GlassFish Server Open Source Edition 3.1.2 (build 23) Información: Grizzly Framework 1.9.46 started in: 20ms - bound to [0.0.0.0:4848] Información: Grizzly Framework 1.9.46 started in: 32ms - bound to [0.0.0.0:8181] Información: Grizzly Framework 1.9.46 started in: 59ms - bound to [0.0.0.0:8080] Información: Grizzly Framework 1.9.46 started in: 32ms - bound to [0.0.0.0:3700] Información: Grizzly Framework 1.9.46 started in: 21ms - bound to [0.0.0.0:7676] Información: Registered org.glassfish.ha.store.adapter.cache.ShoalBackingStoreProxy for persistence-type = replicated in BackingStoreFactoryRegistry Información: SEC1002: Security Manager is OFF. Información: SEC1010: Entering Security Startup Service Información: SEC1143: Loading policy provider com.sun.enterprise.security.provider.PolicyWrapper. Información: SEC1115: Realm [admin-realm] of classtype [com.sun.enterprise.security.auth.realm.file.FileRealm] successfully created. Información: SEC1115: Realm [file] of classtype [com.sun.enterprise.security.auth.realm.file.FileRealm] successfully created. Información: SEC1115: Realm [certificate] of classtype [com.sun.enterprise.security.auth.realm.certificate.CertificateRealm] successfully created. Información: SEC1011: Security Service(s) Started Successfully Información: WEB0169: Created HTTP listener [http-listener-1] on host/port [0.0.0.0:8080] Información: WEB0169: Created HTTP listener [http-listener-2] on host/port [0.0.0.0:8181] Información: WEB0169: Created HTTP listener [admin-listener] on host/port [0.0.0.0:4848] Información: WEB0171: Created virtual server [server] Información: WEB0171: Created virtual server [__asadmin] Información: WEB0172: Virtual server [server] loaded default web module [] Información: Inicializando Mojarra 2.1.6 (SNAPSHOT 20111206) para el contexto '/test' Información: Hibernate Validator 4.2.0.Final Información: WEB0671: Loading application [test] at [/test] Información: CORE10010: Loading application test done in 4,885 ms Información: GlassFish Server Open Source Edition 3.1.2 (23) startup time : Felix (1,848ms), startup services(5,600ms), total(7,448ms) Información: JMX005: JMXStartupService had Started JMXConnector on JMXService URL service:jmx:rmi://SJ007:8686/jndi/rmi://SJ007:8686/jmxrmi Información: WEB0169: Created HTTP listener [http-listener-1] on host/port [0.0.0.0:8080] Información: Grizzly Framework 1.9.46 started in: 14ms - bound to [0.0.0.0:8080] Información: WEB0169: Created HTTP listener [http-listener-2] on host/port [0.0.0.0:8181] Información: Grizzly Framework 1.9.46 started in: 12ms - bound to [0.0.0.0:8181] but right there it hangs and the deploy bar keeps running but no more actions are shown, nothing else is logged either it just stays there until I stop the deploy Is there any other error log to debug glassfish server? Any thoughts? I have re installed glassfish and NetBeans but it all seems the same. I think this started happening after I had to force-restart my computer with NetBeans stil open and the app deployed, but it's hard to know for sure if this was the real catalyst. Any thoughts or help is appreciated thanks. Is it an app error? if so why no errors in the log are shown?

    Read the article

  • sqlite - any improvements for this attach code (running multiple sql commands transactionally in sql

    - by Greg
    Hi, Is this code solid? I've tried to use "using" etc. Basically a method to pass as sequenced list of SQL commands to be run against a Sqlite database. I assume it is true that in sqlite by default all commands run in a single connection are handled transactionally? Is this true? i.e. I should not have to (and haven't got in the code at the moment) a BeginTransaction, or CommitTransaction. It's using http://sqlite.phxsoftware.com/ as the sqlite ADO.net database provider. private int ExecuteNonQueryTransactionally(List<string> sqlList) { int totalRowsUpdated = 0; using (var conn = new SQLiteConnection(_connectionString)) { // Open connection (one connection so should be transactional - confirm) conn.Open(); // Apply each SQL statement passed in to sqlList foreach (string s in sqlList) { using (var cmd = new SQLiteCommand(conn)) { cmd.CommandText = s; totalRowsUpdated = totalRowsUpdated + cmd.ExecuteNonQuery(); } } } return totalRowsUpdated; }

    Read the article

  • Python (Twisted) - reading from fifo and sending read data to multiple protocols

    - by SpankMe
    Hi, Im trying to write some kind of multi protocol bot (jabber/irc) that would read messages from fifo file (one liners mostly) and then send them to irc channel and jabber contacts. So far, I managed to create two factories to connect to jabber and irc, and they seem to be working. However, I've problem with reading the fifo file - I have no idea how to read it in a loop (open file, read line, close file, jump to open file and so on) outside of reactor loop to get the data I need to send, and then get that data to reactor loop for sending in both protocols. I've been looking for information on how to do it in best way, but Im totally lost in the dark. Any suggestion/help would be highly appreciated. Thanks in advance!

    Read the article

  • Have Button re-appear immediately after clicking button in ListView row

    - by Soeren
    I have 4 buttons on a page. Each button opens a modal window and let’s the user input data in a form. When the user hits the save button in the modal, a ListView appears on the page with the submitted data. The button the user clicked to open the modal window is set to visible=false, so it’s gone when the row is added to the ListView. Now there are 3 buttons and the same goes for those; when the user hits a button, a modal appears, and when the modal form is submitted, the button disappears and a row is added to the ListView. In the ListView row, there is a delete button. When this button is clicked, the row is deleted and the button that was initially clicked to add this row (and open the modal), SHOULD reappear, but it doesn’t. The row disappears, but I have to refresh the page before the button comes back. There is a ScriptManager on the masterpage, so I guess this is an AJAX partial refresh issue. I tried adding different events, but I can’t find the one that fires at the right time. I use an ObjectDataSource to fill the ListView, and the data comes from a database, wrapped in a business object. This code loads a business object in a List< and checks if the user inserted an item of a specific type. If he did, the button he used to open the modal is hidden. This works fine (maybe not the most elegant) _goals = GoalManager.GetGoalsByUser(UserID); if (_goals != null) { foreach (Goal _goalinlist in _goals) { if (_goalinlist.GoalType == 1) { Button1.Visible = false; goalid1 = true; } if (_goalinlist.GoalType == 2) { Button2.Visible = false; goalid2 = true; } if (_goalinlist.GoalType == 3) { Button3.Visible = false; goalid3 = true; } if (_goalinlist.GoalType == 4) { Button4.Visible = false; goalid4 = true; } } } As you can see, I tried setting a boolean, and then check it when the page is re-loaded. But the problem (I guess) is that the whole page isn't refreshed when the delete button is clicked in the ListView. This is the delete button in the ListView: <asp:ImageButton ID="ImageButton2" runat="server" CommandName="Delete" CausesValidation="false" ToolTip="Delete" CommandArgument='<%#Eval("GoalID")%>' ImageUrl="delete.gif" OnClientClick="return confirm('Delete this post?');" CssClass="button"/> I guess the question is, how do I make the button re-appear right after the ListView button is clicked?

    Read the article

  • How to configure a session timeout for Grails application?

    - by curd0
    In one of controllers in my Grails application I'm preserving a parameter value in a session variable like this: session.myVariable = params.myValue After that, I can access the saved value from different controllers/GSP-pages as long as I actively use the app. However, if I don't use my app for a while, even though my browser window is still open, the session variable looses it's value. Does this happens because the session expires? I was under impression that a session lives until the browser window is still open, but apparently I was wrong. What should I do to ensure all session variables I define in my Grails app don't expire until the browser is closed? Is there any way to set session timeout manually? Thank you in advance for your answers!

    Read the article

  • I keep getting a "System InvalidOperationException occurred in System Windows Forms dll" error in VB

    - by Heartrent
    I've just started learning VB.NET with VS 9.0; a small application I'm working on keeps returning an "A first chance exception of type System InvalidOperationException occurred in System Windows Forms dll" error from the Immediate Window. The application has almost zero functionality so far, it consists of a menu strip with: File About |Open |Save |Save As |Quit The only code I have written opens an Open File dialog, a Save As dialog, an About window with background sound and an OK button, and the Quit button which exits. Since there is almost no code for me to search through, I can't understand why there would be an error. The program runs just fine when I'm debugging it too.

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

< Previous Page | 306 307 308 309 310 311 312 313 314 315 316 317  | Next Page >