Search Results

Search found 18245 results on 730 pages for 'recursive query'.

Page 312/730 | < Previous Page | 308 309 310 311 312 313 314 315 316 317 318 319  | Next Page >

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • What exactly is a reentrant function?

    - by eSKay
    Most of the times, the definition of reentrance is quoted from Wikipedia: A computer program or routine is described as reentrant if it can be safely called again before its previous invocation has been completed (i.e it can be safely executed concurrently). To be reentrant, a computer program or routine: Must hold no static (or global) non-constant data. Must not return the address to static (or global) non-constant data. Must work only on the data provided to it by the caller. Must not rely on locks to singleton resources. Must not modify its own code (unless executing in its own unique thread storage) Must not call non-reentrant computer programs or routines. How is safely defined? If a program can be safely executed concurrently, does it always mean that it is reentrant? What exactly is the common thread between the six points mentioned that I should keep in mind while checking my code for reentrant capabilities? Also, Are all recursive functions reentrant? Are all thread-safe functions reentrant? Are all recursive and thread-safe functions reentrant? While writing this question, one thing comes to mind: Are the terms like reentrance and thread safety absolute at all i.e. do they have fixed concrete definations? For, if they are not, this question is not very meaningful. Thanks!

    Read the article

  • No idea how to solve SICP exercise 1.11

    - by Javier Badia
    This is not homework. Exercise 1.11: A function f is defined by the rule that f(n) = n if n<3 and f(n) = f(n - 1) + 2f(n - 2) + 3f(n - 3) if n 3. Write a procedure that computes f by means of a recursive process. Write a procedure that computes f by means of an iterative process. Implementing it recursively is simple enough. But I couldn't figure out how to do it iteratively. I tried comparing with the Fibonacci example given, but I didn't know how to use it as an analogy. So I gave up (shame on me) and Googled for an explanation, and I found this: (define (f n) (if (< n 3) n (f-iter 2 1 0 n))) (define (f-iter a b c count) (if (< count 3) a (f-iter (+ a (* 2 b) (* 3 c)) a b (- count 1)))) After reading it, I understand the code and how it works. But what I don't understand is the process needed to get from the recursive defintion of the function to this. I don't get how the code formed in someone's head. Could you explain the thought process needed to arrive at the solution?

    Read the article

  • How to find specific value of the node in xml file

    - by user2735149
    I am making windows phone 8 app based the webservices. This is my xml code: - <response> <timestamp>2013-10-31T08:30:56Z</timestamp> <resultsOffset>0</resultsOffset> <status>success</status> <resultsLimit>8</resultsLimit> <resultsCount>38</resultsCount> - <headlines> - <headlinesItem> <headline>City edge past Toon</headline> <keywords /> <lastModified>2013-10-30T23:45:22Z</lastModified> <audio /> <premium>false</premium> + <links> - <api> - <news> <href>http://api.espn.com/v1/sports/news/1600444?region=GB</href> </news> </api> - <web> <href>http://espnfc.com/uk/en/report/381799/city-edge-toon?ex_cid=espnapi_public</href> </web> - <mobile> <href>http://m.espn.go.com/soccer/gamecast?gameId=381799&lang=EN&ex_cid=espnapi_public</href> </mobile> </links> <type>snReport</type> <related /> <id>1600444</id> <story>Alvardo Negredo and Edin Dzeko struck in extra-time to book Manchester City's place in the last eight of the Capital One Cup, while Costel Pantilimon kept a clean sheet in the 2-0 win to keep the pressure on Joe Hart. </story> <linkText>Newcastle 0-2 Man City</linkText> - <images> - <imagesItem> <height>360</height> <alt>Man City celebrate after Edin Dzeko scored their second extra-time goal at Newcastle.</alt> <width>640</width> <name>Man City celeb Edin Dzeko goal v nufc 20131030 [640x360]</name> <caption>Man City celebrate after Edin Dzeko scored their second extra-time goal at Newcastle.</caption> <type>inline</type> <url>http://espnfc.com/design05/images/2013/1030/mancitycelebedindzekogoalvnufc20131030_640x360.jpg</url> </imagesItem> </images> Code behind: myData = XDocument.Parse(e.Result, LoadOptions.None); var data = myData.Descendants("headlines").FirstOrDefault(); var data1 = from query in myData.Descendants("headlinesItem") select new UpdataNews { News = (string)query.Element("headline").Value, Desc = (string)query.Element("description"), Newsurl = (string)query.Element("links").Element("mobile").Element("href"), Imageurl=(string)query.Element("images").Element("imagesItem").Element("url").Value, }; lstShow.ItemsSource = data1; I am trying to get value from xml tags and assign them to News,Desc, etc. Everything works fine except Imageurl, it shows NullException. I tried same method for Imageurl, i dont know whats going wrong. Help..

    Read the article

  • Running a Model::find in for loop in cakephp v1.3

    - by Gaurav Sharma
    Hi all, How can I achieve the following result in cakephp: In my application a Topic is related to category, category is related to city and city is finally related to state in other words: topic belongs to category, category belongs to city , city belongs to state.. Now in the Topic controller's index action I want to find out all the topics and it's city and state. How can I do this. I can easily do this using a custom query ($this-Model-query() function ) but then I will be facing pagination difficulties. I tried doing like this function index() { $this->Topic->recursive = 0; $topics = $this->paginate(); for($i=0; $i<count($topics);$i++) { $topics[$i]['City'] = $this->Topic->Category->City->find('all', array('conditions' => array('City.id' => $topics[$i]['Category']['city_id']))); } $this->set(compact('messages')); } The method that I have adopted is not a good one (running query in a loop) Using the recursive property and setting it to highest value (2) will degrade performance and is not going to yield me state information. How shall I solve this ? Please help Thanks

    Read the article

  • Need help to properly remove duplicates in NHibernate

    - by Michael D. Kirkpatrick
    Here is the problem I am having. I have a database with over 100 records in it. I am paging through the data to get 9 results at a time. When I added a check to see if items are active, it caused the results to start doubling up. A little background: "Product" is the actual product line "ProductSkus" are the actual products that exist in the product line When there is more then 1 ProductSku within Product, it causes a duplicate entry to be returned. See the NHibernate Query below: result = this.Session.CreateCriteria<Model.Product>() .Add(Expression.Eq("IsActive", true)) .AddOrder(new Order("Name", true)) .SetFirstResult(indexNumber).SetMaxResults(maxNumber) // This part of the query duplicates the products .CreateAlias("ProductSkus", "ProdSkus", JoinType.InnerJoin) .Add(Expression.Eq("ProdSkus.IsActive", true)) .CreateAlias("ProductToSubcategory", "ProdToSubcat") .CreateAlias("ProdToSubcat.ProductSubcategory", "ProdSubcat") .Add(Expression.Eq("ProdSubcat.ID", subCatId)) // This part takes out the duplicate products - Removes too many items... // Turns out that with .SetFirstResult(indexNumber).SetMaxResults(maxNumber) // it gets 9 records back then the duplicates are removed. // Example: // Total Records over 100 // Max = 9 // 4 Duplicates removed // Yields 5 records when there should be 9 // Why??? This line is ran in NHibernate on the data after it has been extracted from the SQL server. .SetResultTransformer(new NHibernate.Transform.DistinctRootEntityResultTransformer()) .List<Model.Product>(); I added the DistinctRootEntityResultTransformer to clean up the duplicates. The problem is that it pulls 9 records back that contains duplicates. DistinctRootEntityResultTransformer then cleans up the duplicates in the 9 records. I am basically needing a distinct statement to be ran on the SQL server to begin with. However, distinct on SQL is not going to work since NHibernate by default wants to add every field from every table in the select part of the statement. I am only using the fields that belong to the root table to begin with (Model.Product). If I can tell NHibernate to not add the fields to the joined tables into the select part of the statement along with adding Distinct, it would work. I use NHibernare Profiler to see the actual query: SELECT top 9 this_.ID as ID351_3_, this_.Name as Name351_3_, this_.Description as Descript3_351_3_, this_.IsActive as IsActive351_3_, this_.ManufacturerID as Manufact5_351_3_, prodskus1_.ID as ID373_0_, prodskus1_.Description as Descript2_373_0_, prodskus1_.PartNumber as PartNumber373_0_, prodskus1_.Price as Price373_0_, prodskus1_.IsKit as IsKit373_0_, prodskus1_.IsActive as IsActive373_0_, prodskus1_.IsFeaturedProduct as IsFeatur7_373_0_, prodskus1_.DateAdded as DateAdded373_0_, prodskus1_.Weight as Weight373_0_, prodskus1_.TimesViewed as TimesVi10_373_0_, prodskus1_.TimesOrdered as TimesOr11_373_0_, prodskus1_.ProductID as ProductID373_0_, prodskus1_.OverSizedBoxID as OverSiz13_373_0_, prodtosubc2_.ID as ID362_1_, prodtosubc2_.MasterSubcategory as MasterSu2_362_1_, prodtosubc2_.ProductID as ProductID362_1_, prodtosubc2_.ProductSubcategoryID as ProductS4_362_1_, prodsubcat3_.ID as ID352_2_, prodsubcat3_.Name as Name352_2_, prodsubcat3_.ProductCategoryID as ProductC3_352_2_, prodsubcat3_.ImageID as ImageID352_2_, prodsubcat3_.TriggerShow as TriggerS5_352_2_ FROM Product this_ inner join ProductSku prodskus1_ on this_.ID = prodskus1_.ProductID and (prodskus1_.IsActive = 1) inner join ProductToSubcategory prodtosubc2_ on this_.ID = prodtosubc2_.ProductID inner join ProductSubcategory prodsubcat3_ on prodtosubc2_.ProductSubcategoryID = prodsubcat3_.ID WHERE this_.IsActive = 1 /* @p0 */ and prodskus1_.IsActive = 1 /* @p1 */ and prodsubcat3_.ID = 3 /* @p2 */ ORDER BY this_.Name asc If I hand modify the query and run it directly on the SQL server I get the result set I want (I removed all the extra fields in the select section and added DISTINCT): SELECT DISTINCT top 9 this_.ID as ID351_3_, this_.Name as Name351_3_, this_.Description as Descript3_351_3_, this_.IsActive as IsActive351_3_, this_.ManufacturerID as Manufact5_351_3_, FROM Product this_ inner join ProductSku prodskus1_ on this_.ID = prodskus1_.ProductID and (prodskus1_.IsActive = 1) inner join ProductToSubcategory prodtosubc2_ on this_.ID = prodtosubc2_.ProductID inner join ProductSubcategory prodsubcat3_ on prodtosubc2_.ProductSubcategoryID = prodsubcat3_.ID WHERE this_.IsActive = 1 /* @p0 */ and prodskus1_.IsActive = 1 /* @p1 */ and prodsubcat3_.ID = 3 /* @p2 */ ORDER BY this_.Name asc The big question I now must ask is... What must I change in the NHibernate Query to ultimately get the exact same result? Thanks in advance.

    Read the article

  • C# Recursion SumOfOnlyNeg Elements

    - by Chris
    Hello, A array gets filled up with random elements (negative and positive). Now i want to calculate the sum of ONLY the postive elements. Iterative there is no problem, but in the recursion version i can only get the sum of both negative and postive. How can i "check" in the recursive version that it only sums up the Postive elements? Best Regards. Iterative version: public int IterSomPosElem(int[] tabel, int n) { n = 0; for (int i = 0; i < tabel.Length; i++) { if (tabel[i] >= 0) { n += tabel[i]; } } return n; } Recursive version atm (sums up all the elements insteed, of only the positive) public int RecuSomPosElem(int[] tabel, int n) { if(n == 1) return tabel[0]; //stopCriterium else { return (tabel[n - 1] + RecuSomPosElem(tabel, n - 1)); // how to check, so it only sums up the postive elements and "ignores" the negative elements. } }

    Read the article

  • How to work with CTE. There is some error related to anchor.

    - by Shantanu Gupta
    I am creating a hierarchy representaion of a column. But an error occurs Details are Msg 240, Level 16, State 1, Line 1 Types don't match between the anchor and the recursive part in column "DISPLAY" of recursive query "CTE". I know there is some typecasting error. But I dont know how to remove error. Please just dont only sort out my error. I need explanation why this error is coming. When this error occurs. I am trying to sort table on the basis of sort col that i m introducing. I want to add '-' at every level and want to sort accordingly. Please help WITH CTE (PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH) AS ( SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, '-' AS DISPLAY, '--' AS SORT, 0 AS DEPTH FROM dbo.L_CATEGORY_TYPE WHERE FK_CATEGORY_ID IS NULL UNION ALL SELECT T.PK_CATEGORY_ID, T.[DESCRIPTION], T.FK_CATEGORY_ID, CAST(DISPLAY+T.[DESCRIPTION] AS VARCHAR(1000)), '--' AS SORT, C.DEPTH +1 FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.PK_CATEGORY_ID = T.FK_CATEGORY_ID --SELECT T.PK_CATEGORY_ID, C.SORT+T.[DESCRIPTION], T.FK_CATEGORY_ID --, CAST('--' + C.SORT AS VARCHAR(1000)) AS SORT, CAST(DEPTH +1 AS INT) AS DEPTH --FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.FK_CATEGORY_ID = T.PK_CATEGORY_ID ) SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH FROM CTE ORDER BY SORT

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Normalizing a table

    - by Alex
    I have a legacy table, which I can't change. The values in it can be modified from legacy application (application also can't be changed). Due to a lot of access to the table from new application (new requirement), I'd like to create a temporary table, which would hopefully speed up the queries. The actual requirement, is to calculate number of business days from X to Y. For example, give me all business days from Jan 1'st 2001 until Dec 24'th 2004. The table is used to mark which days are off, as different companies may have different days off - it isn't just Saturday + Sunday) The temporary table would be created from a .NET program, each time user enters the screen for this query (user may run query multiple times, with different values, table is created once), so I'd like it to be as fast as possible. Approach below runs in under a second, but I only tested it with a small dataset, and still it takes probably close to half a second, which isn't great for UI - even though it's just the overhead for first query. The legacy table looks like this: CREATE TABLE [business_days]( [country_code] [char](3) , [state_code] [varchar](4) , [calendar_year] [int] , [calendar_month] [varchar](31) , [calendar_month2] [varchar](31) , [calendar_month3] [varchar](31) , [calendar_month4] [varchar](31) , [calendar_month5] [varchar](31) , [calendar_month6] [varchar](31) , [calendar_month7] [varchar](31) , [calendar_month8] [varchar](31) , [calendar_month9] [varchar](31) , [calendar_month10] [varchar](31) , [calendar_month11] [varchar](31) , [calendar_month12] [varchar](31) , misc. ) Each month has 31 characters, and any day off (Saturday + Sunday + holiday) is marked with X. Each half day is marked with an 'H'. For example, if a month starts on a Thursday, than it will look like (Thursday+Friday workdays, Saturday+Sunday marked with X): ' XX XX ..' I'd like the new table to look like so: create table #Temp (country varchar(3), state varchar(4), date datetime, hours int) And I'd like to only have rows for days which are off (marked with X or H from previous query) What I ended up doing, so far is this: Create a temporary-intermediate table, that looks like this: create table #Temp_2 (country_code varchar(3), state_code varchar(4), calendar_year int, calendar_month varchar(31), month_code int) To populate it, I have a union which basically unions calendar_month, calendar_month2, calendar_month3, etc. Than I have a loop which loops through all the rows in #Temp_2, after each row is processed, it is removed from #Temp_2. To process the row there is a loop from 1 to 31, and substring(calendar_month, counter, 1) is checked for either X or H, in which case there is an insert into #Temp table. [edit added code] Declare @country_code char(3) Declare @state_code varchar(4) Declare @calendar_year int Declare @calendar_month varchar(31) Declare @month_code int Declare @calendar_date datetime Declare @day_code int WHILE EXISTS(SELECT * From #Temp_2) -- where processed = 0) BEGIN Select Top 1 @country_code = t2.country_code, @state_code = t2.state_code, @calendar_year = t2.calendar_year, @calendar_month = t2.calendar_month, @month_code = t2.month_code From #Temp_2 t2 -- where processed = 0 set @day_code = 1 while @day_code <= 31 begin if substring(@calendar_month, @day_code, 1) = 'X' begin set @calendar_date = convert(datetime, (cast(@month_code as varchar) + '/' + cast(@day_code as varchar) + '/' + cast(@calendar_year as varchar))) insert into #Temp (country, state, date, hours) values (@country_code, @state_code, @calendar_date, 8) end if substring(@calendar_month, @day_code, 1) = 'H' begin set @calendar_date = convert(datetime, (cast(@month_code as varchar) + '/' + cast(@day_code as varchar) + '/' + cast(@calendar_year as varchar))) insert into #Temp (country, state, date, hours) values (@country_code, @state_code, @calendar_date, 4) end set @day_code = @day_code + 1 end delete from #Temp_2 where @country_code = country_code AND @state_code = state_code AND @calendar_year = calendar_year AND @calendar_month = calendar_month AND @month_code = month_code --update #Temp_2 set processed = 1 where @country_code = country_code AND @state_code = state_code AND @calendar_year = calendar_year AND @calendar_month = calendar_month AND @month_code = month_code END I am not an expert in SQL, so I'd like to get some input on my approach, and maybe even a much better approach suggestion. After having the temp table, I'm planning to do (dates would be coming from a table): select cast(convert(datetime, ('01/31/2012'), 101) -convert(datetime, ('01/17/2012'), 101) as int) - ((select sum(hours) from #Temp where date between convert(datetime, ('01/17/2012'), 101) and convert(datetime, ('01/31/2012'), 101)) / 8) Besides the solution of normalizing the table, the other solution I implemented for now, is a function which does all this logic of getting the business days by scanning the current table. It runs pretty fast, but I'm hesitant to call a function, if I can instead add a simpler query to get result. (I'm currently trying this on MSSQL, but I would need to do same for Sybase ASE and Oracle)

    Read the article

  • Efficient Multiplication of Varying-Length #s [Conceptual]

    - by Milan Patel
    Write the pseudocode of an algorithm that takes in two arbitrary length numbers (provided as strings), and computes the product of these numbers. Use an efficient procedure for multiplication of large numbers of arbitrary length. Analyze the efficiency of your algorithm. I decided to take the (semi) easy way out and use the Russian Peasant Algorithm. It works like this: a * b = a/2 * 2b if a is even a * b = (a-1)/2 * 2b + a if a is odd My pseudocode is: rpa(x, y){ if x is 1 return y if x is even return rpa(x/2, 2y) if x is odd return rpa((x-1)/2, 2y) + y } I have 3 questions: Is this efficient for arbitrary length numbers? I implemented it in C and tried varying length numbers. The run-time in was near-instant in all cases so it's hard to tell empirically... Can I apply the Master's Theorem to understand the complexity...? a = # subproblems in recursion = 1 (max 1 recursive call across all states) n / b = size of each subproblem = n / 1 - b = 1 (problem doesn't change size...?) f(n^d) = work done outside recursive calls = 1 - d = 0 (the addition when a is odd) a = 1, b^d = 1, a = b^d - complexity is in n^d*log(n) = log(n) this makes sense logically since we are halving the problem at each step, right? What might my professor mean by providing arbitrary length numbers "as strings". Why do that? Many thanks in advance

    Read the article

  • git submodule pull and commit automatically on webserver

    - by Lukas Oppermann
    I have the following setup, I am working on a project project with the submodule submodule. Whenever I push changes to github it sends a post request to update.php on the server. This php file executes a git command. Without submodules I can just do a git pull and everything is fine but with submodules it is much more difficult. I have this at the moment, but it does not do what I want. I should git pull the repo and update and pull the latest version of each submodule. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -m "updating"' && git pull && git submodule foreach 'git add -A .' && git commit -m "updating to latest version including submodules" 2>&1s`; EDIT// Okay, I got it half way done. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -am "updating"; echo "updated"' && git pull && git commit -am "updating to latest version including submodules" && echo 'updated'`; The echo prevents the script to stop because of non-zero returned. It works 100% fine when I run it from the console using php update.php. When github initialized the file, or I run it from the browser it still does not work. Any ideas?

    Read the article

  • Top n items in a List ( including duplicates )

    - by Krishnan
    Trying to find an efficient way to obtain the top N items in a very large list, possibly containing duplicates. I first tried sorting & slicing, which works. But this seems unnnecessary. You shouldn't need to sort a very large list if you just want the top 20 members. So I wrote a recursive routine which builds the top-n list. This also works, but is very much slower than the non-recursive one! Question: Which is my second routine (elite2) so much slower than elite, and how do I make it faster ? My code is attached below. Thanks. import scala.collection.SeqView import scala.math.min object X { def elite(s: SeqView[Int, List[Int]], k:Int):List[Int] = { s.sorted.reverse.force.slice(0,min(k,s.size)) } def elite2(s: SeqView[Int, List[Int]], k:Int, s2:List[Int]=Nil):List[Int] = { if( k == 0 || s.size == 0) s2.reverse else { val m = s.max val parts = s.force.partition(_==m) val whole = if( parts._1.size > 1) parts._1.tail:::parts._2 else parts._2 elite2( whole.view, k-1, m::s2 ) } } def main(args:Array[String]) = { val N = 1000000/3 val x = List(N to 1 by -1).flatten.map(x=>List(x,x,x)).flatten.view println(elite2(x,20)) println(elite(x,20)) } }

    Read the article

  • form_for called in a loop overloads IDs and associates fields and labels incorrectly

    - by Katy Levinson
    Rails likes giving all of my fields the same IDs when they are generated in a loop, and this causes trouble. <% current_user.subscriptions.each do |s| %> <div class="subscription_listing"> <%= link_to_function s.product.name, "toggle_delay(this)"%> in <%= s.calc_time_to_next_arrival %> days. <div class="modify_subscription"> <%= form_for s, :url => change_subscription_path(s) do |f| %> <%= label_tag(:q, "Days to delay:") %> <%= text_field_tag(:query) %> <%= check_box_tag(:always) %> <%= label_tag(:always, "Apply delay to all future orders") %> <%= submit_tag("Change") %> <% end %> <%= link_to 'Destroy', s, :confirm => 'Are you sure?', :method => :delete %> </div> </div> <% end %> Produces <div class="subscription_listing"> <a href="#" onclick="toggle_delay(this); return false;">Pasta</a> in 57 days. <div class="modify_subscription"> <form accept-charset="UTF-8" action="/subscriptions/7/change" class="edit_subscription" id="edit_subscription_7" method="post"><div style="margin:0;padding:0;display:inline"><input name="utf8" type="hidden" value="&#x2713;" /><input name="_method" type="hidden" value="put" /><input name="authenticity_token" type="hidden" value="s5LJffuzmbEMkSrez8b3KLVmDWN/PGmDryXhp25+qc4=" /></div> <label for="q">Days to delay:</label> <input id="query" name="query" type="text" /> <input id="always" name="always" type="checkbox" value="1" /> <label for="always">Apply delay to all future orders</label> <input name="commit" type="submit" value="Change" /> </form> <a href="/subscriptions/7" data-confirm="Are you sure?" data-method="delete" rel="nofollow">Destroy</a> </div> </div> <div class="subscription_listing"> <a href="#" onclick="toggle_delay(this); return false;">Gummy Bears</a> in 57 days. <div class="modify_subscription"> <form accept-charset="UTF-8" action="/subscriptions/8/change" class="edit_subscription" id="edit_subscription_8" method="post"><div style="margin:0;padding:0;display:inline"><input name="utf8" type="hidden" value="&#x2713;" /><input name="_method" type="hidden" value="put" /><input name="authenticity_token" type="hidden" value="s5LJffuzmbEMkSrez8b3KLVmDWN/PGmDryXhp25+qc4=" /></div> <label for="q">Days to delay:</label> <input id="query" name="query" type="text" /> <input id="always" name="always" type="checkbox" value="1" /> <label for="always">Apply delay to all future orders</label> <input name="commit" type="submit" value="Change" /> </form> <a href="/subscriptions/8" data-confirm="Are you sure?" data-method="delete" rel="nofollow">Destroy</a> </div> </div> And that's a problem because now no matter which "Apply delay to all future orders" I select it always very helpfully checks the first box for me. How can I override the ID without doing something ugly and un-rails-like?

    Read the article

  • Insertion into BST without header Node JAVA

    - by Petiatil
    I am working on a recursive insertion method for a BST. This function is suppose to be a recursive helper method and is in a private class called Node. The Node class is in a class called BinarySearchTree which contains an instance variable for the root. When I am trying to insert an element, I get a NullPointerException at : this.left = insert(((Node)left).element); I am unsure about why this occurs. If I understand correctly, in a BST, I am suppose to insert the item at the last spot on the path transversed. Any help is appreciated! private class Node implements BinaryNode<E> { E item; BinaryNode<E> left, right; public BinaryNode<E> insert(E item) { int compare = item.compareTo(((Node)root).item); if(root == null) { root = new Node(); ((Node)root).item = item; } else if(compare < 0) { this.left = insert(((Node)left).item); } else if(compare > 0) { this.right = insert(((Node)right).item); } return root; } }

    Read the article

  • Problems setting NTP sever with w32tm for a DC that is a Hyper-V guest

    - by R.Tonheim
    Hello ! I have tried to sett my DC to get its time from several NTP severs. I follow this answer (http://serverfault.com/questions/24298/w32time-sync-problems-for-hyper-v-guests-w32time-event-ids-38-24-29-35/24299#24299) to do it. First I disable Time Synchronization in the Hyper-V Integration Services for each guest. Then restart the Windows Time serviceon the guest. I had before this used this command: w32tm /config /manualpeerlist:"ntp.uio.no;timekeeper. uio.no;nissen.uio.no;0.no.pool.ntp.org;1.no.pool.ntp.org;2.no.pool.ntp.org" /syn cfromflags:manual /reliable:yes /update And the cmd sad: The command completed successfully. But the time was still 10 min wrong... I run w32tm again after restarted the DC without it having any effect. The w32tm /query /status still say: "Source: Local CMOS Clock" FROM MY CMD: Microsoft Windows [Version 6.0.6002] Copyright (c) 2006 Microsoft Corporation. All rights reserved. C:\Users\Administrator.MHGw32tm /query /status Leap Indicator: 0(no warning) Stratum: 1 (primary reference - syncd by radio clock) Precision: -6 (15.625ms per tick) Root Delay: 0.0000000s Root Dispersion: 10.0000000s ReferenceId: 0x4C4F434C (source name: "LOCL") Last Successful Sync Time: 05.09.2009 20:06:21 Source: Local CMOS Clock Poll Interval: 6 (64s) C:\Users\Administrator.MHGw32tm /config /manualpeerlist:"ntp.uio.no;timekeeper. uio.no;nissen.uio.no;0.no.pool.ntp.org;1.no.pool.ntp.org;2.no.pool.ntp.org" /syn cfromflags:manual /reliable:yes /update The command completed successfully. C:\Users\Administrator.MHGw32tm /query /status Leap Indicator: 0(no warning) Stratum: 1 (primary reference - syncd by radio clock) Precision: -6 (15.625ms per tick) Root Delay: 0.0000000s Root Dispersion: 10.0000000s ReferenceId: 0x4C4F434C (source name: "LOCL") Last Successful Sync Time: 05.09.2009 20:06:21 Source: Local CMOS Clock Poll Interval: 6 (64s) C:\Users\Administrator.MHG

    Read the article

  • mysqld crashes on any statement

    - by ??iu
    I restarted my slave to change configuration settings to skip reverse hostname lookup on connecting and to enable the slow query log. I edited /etc/my.cnf making only these changes, then restarted mysqld with /etc/init.d/mysql restart All appeared to be well but when I connect to msyqld remotely or locally though it connects okay a slight problem is that mysqld crashes whenever you try to issue any kind of statement. The client looks like: Reading table information for completion of table and column names You can turn off this feature to get a quicker startup with -A Welcome to the MySQL monitor. Commands end with ; or \g. Your MySQL connection id is 3 Server version: 5.1.31-1ubuntu2-log Type 'help;' or '\h' for help. Type '\c' to clear the buffer. mysql> show tables; ERROR 2006 (HY000): MySQL server has gone away No connection. Trying to reconnect... Connection id: 1 Current database: mydb ERROR 2006 (HY000): MySQL server has gone away No connection. Trying to reconnect... ERROR 2003 (HY000): Can't connect to MySQL server on 'xx.xx.xx.xx' (61) ERROR: Can't connect to the server ERROR 2006 (HY000): MySQL server has gone away No connection. Trying to reconnect... ERROR 2003 (HY000): Can't connect to MySQL server on 'xx.xx.xx.xx' (61) ERROR: Can't connect to the server ERROR 2006 (HY000): MySQL server has gone away Bus error The mysqld error log looks like: 101210 16:35:51 InnoDB: Error: (1500) Couldn't read the MAX(job_id) autoinc value from the index (PRIMARY). 101210 16:35:51 InnoDB: Assertion failure in thread 140245598570832 in file handler/ha_innodb.cc line 2595 InnoDB: Failing assertion: error == DB_SUCCESS InnoDB: We intentionally generate a memory trap. InnoDB: Submit a detailed bug report to http://bugs.mysql.com. InnoDB: If you get repeated assertion failures or crashes, even InnoDB: immediately after the mysqld startup, there may be InnoDB: corruption in the InnoDB tablespace. Please refer to InnoDB: http://dev.mysql.com/doc/refman/5.1/en/forcing-recovery.html InnoDB: about forcing recovery. 101210 16:35:51 - mysqld got signal 6 ; This could be because you hit a bug. It is also possible that this binary or one of the libraries it was linked against is corrupt, improperly built, or misconfigured. This error can also be caused by malfunctioning hardware. We will try our best to scrape up some info that will hopefully help diagnose the problem, but since we have already crashed, something is definitely wrong and this may fail. key_buffer_size=16777216 read_buffer_size=131072 max_used_connections=3 max_threads=600 threads_connected=3 It is possible that mysqld could use up to key_buffer_size + (read_buffer_size + sort_buffer_size)*max_threads = 1328077 K bytes of memory Hope that's ok; if not, decrease some variables in the equation. thd: 0x18209220 Attempting backtrace. You can use the following information to find out where mysqld died. If you see no messages after this, something went terribly wrong... stack_bottom = 0x7f8d791580d0 thread_stack 0x20000 /usr/sbin/mysqld(my_print_stacktrace+0x29) [0x8b4f89] /usr/sbin/mysqld(handle_segfault+0x383) [0x5f8f03] /lib/libpthread.so.0 [0x7f902a76a080] /lib/libc.so.6(gsignal+0x35) [0x7f90291f8fb5] /lib/libc.so.6(abort+0x183) [0x7f90291fabc3] /usr/sbin/mysqld(ha_innobase::open(char const*, int, unsigned int)+0x41b) [0x781f4b] /usr/sbin/mysqld(handler::ha_open(st_table*, char const*, int, int)+0x3f) [0x6db00f] /usr/sbin/mysqld(open_table_from_share(THD*, st_table_share*, char const*, unsigned int, unsigned int, unsigned int, st_table*, bool)+0x57a) [0x64760a] /usr/sbin/mysqld [0x63f281] /usr/sbin/mysqld(open_table(THD*, TABLE_LIST*, st_mem_root*, bool*, unsigned int)+0x626) [0x641e16] /usr/sbin/mysqld(open_tables(THD*, TABLE_LIST**, unsigned int*, unsigned int)+0x5db) [0x6429cb] /usr/sbin/mysqld(open_normal_and_derived_tables(THD*, TABLE_LIST*, unsigned int)+0x1e) [0x642b0e] /usr/sbin/mysqld(mysqld_list_fields(THD*, TABLE_LIST*, char const*)+0x22) [0x70b292] /usr/sbin/mysqld(dispatch_command(enum_server_command, THD*, char*, unsigned int)+0x146d) [0x60dc1d] /usr/sbin/mysqld(do_command(THD*)+0xe8) [0x60dda8] /usr/sbin/mysqld(handle_one_connection+0x226) [0x601426] /lib/libpthread.so.0 [0x7f902a7623ba] /lib/libc.so.6(clone+0x6d) [0x7f90292abfcd] Trying to get some variables. Some pointers may be invalid and cause the dump to abort... thd->query at 0x18213c70 = thd->thread_id=3 thd->killed=NOT_KILLED The manual page at http://dev.mysql.com/doc/mysql/en/crashing.html contains information that should help you find out what is causing the crash. 101210 16:35:51 mysqld_safe Number of processes running now: 0 101210 16:35:51 mysqld_safe mysqld restarted InnoDB: The log sequence number in ibdata files does not match InnoDB: the log sequence number in the ib_logfiles! 101210 16:35:54 InnoDB: Database was not shut down normally! InnoDB: Starting crash recovery. InnoDB: Reading tablespace information from the .ibd files... InnoDB: Restoring possible half-written data pages from the doublewrite InnoDB: buffer... 101210 16:35:56 InnoDB: Started; log sequence number 456 143528628 101210 16:35:56 [Warning] 'user' entry 'root@PSDB102' ignored in --skip-name-resolve mode. 101210 16:35:56 [Warning] Neither --relay-log nor --relay-log-index were used; so replication may break when this MySQL server acts as a slave and has his hostname changed!! Please use '--relay-log=mysqld-relay-bin' to avoid this problem. 101210 16:35:56 [Note] Event Scheduler: Loaded 0 events 101210 16:35:56 [Note] /usr/sbin/mysqld: ready for connections. Version: '5.1.31-1ubuntu2-log' socket: '/var/run/mysqld/mysqld.sock' port: 3306 (Ubuntu) 101210 16:36:11 InnoDB: Error: (1500) Couldn't read the MAX(job_id) autoinc value from the index (PRIMARY). 101210 16:36:11 InnoDB: Assertion failure in thread 139955151501648 in file handler/ha_innodb.cc line 2595 InnoDB: Failing assertion: error == DB_SUCCESS InnoDB: We intentionally generate a memory trap. InnoDB: Submit a detailed bug report to http://bugs.mysql.com. InnoDB: If you get repeated assertion failures or crashes, even InnoDB: immediately after the mysqld startup, there may be InnoDB: corruption in the InnoDB tablespace. Please refer to InnoDB: http://dev.mysql.com/doc/refman/5.1/en/forcing-recovery.html InnoDB: about forcing recovery. 101210 16:36:11 - mysqld got signal 6 ; This could be because you hit a bug. It is also possible that this binary or one of the libraries it was linked against is corrupt, improperly built, or misconfigured. This error can also be caused by malfunctioning hardware. We will try our best to scrape up some info that will hopefully help diagnose the problem, but since we have already crashed, something is definitely wrong and this may fail. key_buffer_size=16777216 read_buffer_size=131072 max_used_connections=1 max_threads=600 threads_connected=1 It is possible that mysqld could use up to key_buffer_size + (read_buffer_size + sort_buffer_size)*max_threads = 1328077 K bytes of memory Hope that's ok; if not, decrease some variables in the equation. thd: 0x18588720 Attempting backtrace. You can use the following information to find out where mysqld died. If you see no messages after this, something went terribly wrong... stack_bottom = 0x7f49d916f0d0 thread_stack 0x20000 /usr/sbin/mysqld(my_print_stacktrace+0x29) [0x8b4f89] /usr/sbin/mysqld(handle_segfault+0x383) [0x5f8f03] /lib/libpthread.so.0 [0x7f4c8a73f080] /lib/libc.so.6(gsignal+0x35) [0x7f4c891cdfb5] /lib/libc.so.6(abort+0x183) [0x7f4c891cfbc3] /usr/sbin/mysqld(ha_innobase::open(char const*, int, unsigned int)+0x41b) [0x781f4b] /usr/sbin/mysqld(handler::ha_open(st_table*, char const*, int, int)+0x3f) [0x6db00f] /usr/sbin/mysqld(open_table_from_share(THD*, st_table_share*, char const*, unsigned int, unsigned int, unsigned int, st_table*, bool)+0x57a) [0x64760a] /usr/sbin/mysqld [0x63f281] /usr/sbin/mysqld(open_table(THD*, TABLE_LIST*, st_mem_root*, bool*, unsigned int)+0x626) [0x641e16] /usr/sbin/mysqld(open_tables(THD*, TABLE_LIST**, unsigned int*, unsigned int)+0x5db) [0x6429cb] /usr/sbin/mysqld(open_normal_and_derived_tables(THD*, TABLE_LIST*, unsigned int)+0x1e) [0x642b0e] /usr/sbin/mysqld(mysqld_list_fields(THD*, TABLE_LIST*, char const*)+0x22) [0x70b292] /usr/sbin/mysqld(dispatch_command(enum_server_command, THD*, char*, unsigned int)+0x146d) [0x60dc1d] /usr/sbin/mysqld(do_command(THD*)+0xe8) [0x60dda8] /usr/sbin/mysqld(handle_one_connection+0x226) [0x601426] /lib/libpthread.so.0 [0x7f4c8a7373ba] /lib/libc.so.6(clone+0x6d) [0x7f4c89280fcd] Trying to get some variables. Some pointers may be invalid and cause the dump to abort... thd->query at 0x18599950 = thd->thread_id=1 thd->killed=NOT_KILLED The manual page at http://dev.mysql.com/doc/mysql/en/crashing.html contains information that should help you find out what is causing the crash. 101210 16:36:11 mysqld_safe Number of processes running now: 0 101210 16:36:11 mysqld_safe mysqld restarted The config is [mysqld_safe] socket = /var/run/mysqld/mysqld.sock nice = 0 [mysqld] innodb_file_per_table innodb_buffer_pool_size=10G innodb_log_buffer_size=4M innodb_flush_log_at_trx_commit=2 innodb_thread_concurrency=8 skip-slave-start server-id=3 # # * IMPORTANT # If you make changes to these settings and your system uses apparmor, you may # also need to also adjust /etc/apparmor.d/usr.sbin.mysqld. # user = mysql pid-file = /var/run/mysqld/mysqld.pid socket = /var/run/mysqld/mysqld.sock port = 3306 basedir = /usr datadir = /DB2/mysql tmpdir = /tmp skip-external-locking # # Instead of skip-networking the default is now to listen only on # localhost which is more compatible and is not less secure. #bind-address = 127.0.0.1 # # * Fine Tuning # key_buffer = 16M max_allowed_packet = 16M thread_stack = 128K thread_cache_size = 8 # This replaces the startup script and checks MyISAM tables if needed # the first time they are touched myisam-recover = BACKUP max_connections = 600 #table_cache = 64 #thread_concurrency = 10 # # * Query Cache Configuration # query_cache_limit = 1M query_cache_size = 32M # skip-federated slow-query-log skip-name-resolve Update: I followed the instructions as per http://dev.mysql.com/doc/refman/5.1/en/forcing-innodb-recovery.html and set innodb_force_recovery = 4 and the logs are showing a different error but the behavior is still the same: 101210 19:14:15 mysqld_safe mysqld restarted 101210 19:14:19 InnoDB: Started; log sequence number 456 143528628 InnoDB: !!! innodb_force_recovery is set to 4 !!! 101210 19:14:19 [Warning] 'user' entry 'root@PSDB102' ignored in --skip-name-resolve mode. 101210 19:14:19 [Warning] Neither --relay-log nor --relay-log-index were used; so replication may break when this MySQL server acts as a slave and has his hostname changed!! Please use '--relay-log=mysqld-relay-bin' to avoid this problem. 101210 19:14:19 [Note] Event Scheduler: Loaded 0 events 101210 19:14:19 [Note] /usr/sbin/mysqld: ready for connections. Version: '5.1.31-1ubuntu2-log' socket: '/var/run/mysqld/mysqld.sock' port: 3306 (Ubuntu) 101210 19:14:32 InnoDB: error: space object of table mydb/__twitter_friend, InnoDB: space id 1602 did not exist in memory. Retrying an open. 101210 19:14:32 InnoDB: error: space object of table mydb/access_request, InnoDB: space id 1318 did not exist in memory. Retrying an open. 101210 19:14:32 InnoDB: error: space object of table mydb/activity, InnoDB: space id 1595 did not exist in memory. Retrying an open. 101210 19:14:32 - mysqld got signal 11 ; This could be because you hit a bug. It is also possible that this binary or one of the libraries it was linked against is corrupt, improperly built, or misconfigured. This error can also be caused by malfunctioning hardware. We will try our best to scrape up some info that will hopefully help diagnose the problem, but since we have already crashed, something is definitely wrong and this may fail. key_buffer_size=16777216 read_buffer_size=131072 max_used_connections=1 max_threads=600 threads_connected=1 It is possible that mysqld could use up to key_buffer_size + (read_buffer_size + sort_buffer_size)*max_threads = 1328077 K bytes of memory Hope that's ok; if not, decrease some variables in the equation. thd: 0x1753c070 Attempting backtrace. You can use the following information to find out where mysqld died. If you see no messages after this, something went terribly wrong... stack_bottom = 0x7f7a0b5800d0 thread_stack 0x20000 /usr/sbin/mysqld(my_print_stacktrace+0x29) [0x8b4f89] /usr/sbin/mysqld(handle_segfault+0x383) [0x5f8f03] /lib/libpthread.so.0 [0x7f7cbc350080] /usr/sbin/mysqld(ha_innobase::innobase_get_index(unsigned int)+0x46) [0x77c516] /usr/sbin/mysqld(ha_innobase::innobase_initialize_autoinc()+0x40) [0x77c640] /usr/sbin/mysqld(ha_innobase::open(char const*, int, unsigned int)+0x3f3) [0x781f23] /usr/sbin/mysqld(handler::ha_open(st_table*, char const*, int, int)+0x3f) [0x6db00f] /usr/sbin/mysqld(open_table_from_share(THD*, st_table_share*, char const*, unsigned int, unsigned int, unsigned int, st_table*, bool)+0x57a) [0x64760a] /usr/sbin/mysqld [0x63f281] /usr/sbin/mysqld(open_table(THD*, TABLE_LIST*, st_mem_root*, bool*, unsigned int)+0x626) [0x641e16] /usr/sbin/mysqld(open_tables(THD*, TABLE_LIST**, unsigned int*, unsigned int)+0x5db) [0x6429cb] /usr/sbin/mysqld(open_normal_and_derived_tables(THD*, TABLE_LIST*, unsigned int)+0x1e) [0x642b0e] /usr/sbin/mysqld(mysqld_list_fields(THD*, TABLE_LIST*, char const*)+0x22) [0x70b292] /usr/sbin/mysqld(dispatch_command(enum_server_command, THD*, char*, unsigned int)+0x146d) [0x60dc1d] /usr/sbin/mysqld(do_command(THD*)+0xe8) [0x60dda8] /usr/sbin/mysqld(handle_one_connection+0x226) [0x601426] /lib/libpthread.so.0 [0x7f7cbc3483ba] /lib/libc.so.6(clone+0x6d) [0x7f7cbae91fcd] Trying to get some variables. Some pointers may be invalid and cause the dump to abort... thd->query at 0x1754d690 = thd->thread_id=1 thd->killed=NOT_KILLED The manual page at http://dev.mysql.com/doc/mysql/en/crashing.html contains information that should help you find out what is causing the crash.

    Read the article

  • How to find out where or if MYSQL5 logs are stored on a machine WHM/Cpanel

    - by moi
    I have a WHM/Cpanel re-seller hosting account on a virtual private server (Linux). I have root access to the machine via SSH I am trying to locate a file that contains information that will help me to determine which users have accessed what db and from which hosts. I would imagine this kind of data is stored in a log file somewhere. The MySQL page says: The general query log - Established client connections and statements received from clients See: http://dev.mysql.com/doc/refman/5.0/en/server-logs.html It also says: By default, all log files are created in the mysqld data directory. So, I am am NOT asking where are the general query log logs stored, (cos I expect I will get answers saying "it depends") Please help me work out: "How can go about finding out where MySQL general query log logs are stored on a linux machine" Couple of things i've already tried: I looked at /etc/my.cnf it was a tiny file that only contained the following info: [mysqld] skip-bdb skip-innodb set-variable = max_connections=500 safe-show-database ~ ~ I have looked in: /var/lib/mysql/ But I could not see any log-like file names in that directory. Any clues on this would be most welcome.

    Read the article

  • 'pskill \\hostname winlogon' might budge a server "stuck rebooting", but why?

    - by Snoi
    Question: Executing remote (Sysinternals) command... pskill \\machine winlogon ...can budge a server that is stuck rebooting, but how/why does this work? How do you know which service to kill? To recreate (e.g.): You run Windows Update, allow a reboot, and ...NOTHING! RDP gets cut off but the server does not reboot. Just about every other service seems to stay up. Further Background: I've faced this problem on VMs hosted around the planet for some years, and used various sc.exe and shutdown commands to learn the state of and attempt remote reboot of servers in such a state, with limited success. Most datacentres don't offer any way to see the true console or power off/on such machines. They charge $$ for you to call them to do such simple things after hours, when you nearly always have to run your maint tasks. e.g. NET USE \\machine\IPC$ /USER:login password sc \\machine query RpcSs sc \\machine query TermService sc \\machine query wuauserv tasklist /s machine This occasionally works for me... shutdown /m \\machine /r /f /t: 0 ...but more often than not it fails with: A system shutdown is in progress (1115). I found this question, and the answer by @Tweek, and it worked really well, but was I just lucky? Can not RDP to Win 2003 box or initiate remote restart @Tweek said to run: pskill \\hostname winlogon ...and that got me past this situation in a new way (Server 2008 R2 in my most recent case) - really useful! I just need to understand if I got lucky or there is more science here. What I'd like to know is why the winlogon process? @Livne said to use "tasklist /s HostName" to see what is the culprit, but how do you tell from the listed output? It's just a list of running tasks etc. From that I would not know what to look for, nor could I see anything about the winlogon process that suggested to my eyes that was the one to kill.

    Read the article

  • Can't setup 3 nodes MongoDB recplica set

    - by Victor Lin
    I just follow instructions in MongoDB document Replica Sets - Basics to setup a 3-node Replica set. Everything goes fine when I do the initiate and add first node in the primary. [foo@host-a mongodb]$ bin/mongo localhost MongoDB shell version: 1.8.2 connecting to: localhost > rs.initiate() { "info2" : "no configuration explicitly specified -- making one", "info" : "Config now saved locally. Should come online in about a minute.", "ok" : 1 } > rs.add("host-b") { "ok" : 1 } So far so good, but when I try to add third node myset:PRIMARY> rs.addArb("host-c") Sun Aug 7 22:57:09 MessagingPort recv() errno:104 Connection reset by peer 127.0.0.1:27017 Sun Aug 7 22:57:09 SocketException: remote: error: 9001 socket exception [1] Sun Aug 7 22:57:09 DBClientCursor::init call() failed Sun Aug 7 22:57:09 query failed : local.$cmd { count: "system.replset", query: {}, fields: {} } to: 127.0.0.1 Sun Aug 7 22:57:09 Error: error doing query: failed shell/collection.js:150 Sun Aug 7 22:57:09 trying reconnect to 127.0.0.1 Sun Aug 7 22:57:09 reconnect 127.0.0.1 ok As result, the current primary became secondary, and the host-b was marked as dead, but actually, it is still alive. myset:SECONDARY> rs.status() { "set" : "myset", "date" : ISODate("2011-08-08T04:03:23Z"), "myState" : 2, "members" : [ { "_id" : 0, "name" : "host-a:27017", "health" : 1, "state" : 2, "stateStr" : "SECONDARY", "optime" : { "t" : 1312775799000, "i" : 1 }, "optimeDate" : ISODate("2011-08-08T03:56:39Z"), "self" : true }, { "_id" : 1, "name" : "host-b", "health" : 0, "state" : 6, "stateStr" : "(not reachable/healthy)", "uptime" : 0, "optime" : { "t" : 0, "i" : 0 }, "optimeDate" : ISODate("1970-01-01T00:00:00Z"), "lastHeartbeat" : ISODate("2011-08-08T04:03:22Z"), "errmsg" : "still initializing" } ], "ok" : 1 } How could this happen? I just follow the guide in the document, did I do something wrong? Moreover, I can't do anything on current secondary server. It doesn't allow me to reconfig on the secondary node, but the problem is there is no primary node. myset:SECONDARY> rs.reconfig({}) { "errmsg" : "replSetReconfig command must be sent to the current replica set primary.", "ok" : 0 } Any ideas?

    Read the article

  • What causes style corruption in MS Word?

    - by Phil.Wheeler
    I've had a few documents across my desk that appear to have a corrupted or recursive style for much of the body text: Char char char char char char Does anyone know what causes this and how to permanently delete this style? When I try to delete it, it disappears from the Styles and Formatting pane of Word, only to reappear later when different text is selected. Input or guidance much appreciated.

    Read the article

  • Perl TDS character sets

    - by skiphoppy
    I'm using the FreeTDS driver with DBD::Sybase, connecting to an MS SQL Server. When I query certain values of certain records, I get this error: DBD::Sybase::st fetchrow_arrayref failed: OpenClient message: LAYER = (0) ORIGIN = (0) SEVERITY = (9) NUMBER = (99) Server , database Message String: WARNING! Some character(s) could not be converted into client's character set. Unconverted bytes were changed to question marks ('?'). This seems to happen for records that contain special Windows character-set characters, such as curly quotes, copied and pasted from people's Outlook and Word messages. Unfortunately, I do not have any control of this database; sanitizing the input on the way in is obviously the way to go, but is not available to me. What FreeTDS settings do I need to change to be able to successfully query these records? Additional information: The query works fine from tsql. I only get this error through Perl's DBD::Sybase interface. (Should I test through something else? I don't have the expertise yet to install PHP or Python. I've got jTDS and can use it, but I think that's a completely different implementation, not an interface to FreeTDS.) Adding client charset = UTF-8 to my freetds.conf file results in "Out of memory!" printed to STDERR.

    Read the article

  • email output of powershell script

    - by Gordon Carlisle
    I found this wonderful script that outputs the status of the current DFS backlog to the powershell console. This works great, but I need the script to email me so I can schedule it to run nightly. I have tried using the Send-MailMessage command, but can't get it to work. Mainly because my powershell skills are very weak. I believe most of the issue revolve around the script using the Write-Host command. While the coloring is nice I would much rather have it email me the results. I also need the solution to be able to specify a mail server since the dfs servers don't have email capability. Any help or tips are welcome and appreciated. Here is the code. $RGroups = Get-WmiObject -Namespace "root\MicrosoftDFS" -Query "SELECT * FROM DfsrReplicationGroupConfig" $ComputerName=$env:ComputerName $Succ=0 $Warn=0 $Err=0 foreach ($Group in $RGroups) { $RGFoldersWMIQ = "SELECT * FROM DfsrReplicatedFolderConfig WHERE ReplicationGroupGUID='" + $Group.ReplicationGroupGUID + "'" $RGFolders = Get-WmiObject -Namespace "root\MicrosoftDFS" -Query $RGFoldersWMIQ $RGConnectionsWMIQ = "SELECT * FROM DfsrConnectionConfig WHERE ReplicationGroupGUID='"+ $Group.ReplicationGroupGUID + "'" $RGConnections = Get-WmiObject -Namespace "root\MicrosoftDFS" -Query $RGConnectionsWMIQ foreach ($Connection in $RGConnections) { $ConnectionName = $Connection.PartnerName.Trim() if ($Connection.Enabled -eq $True) { if (((New-Object System.Net.NetworkInformation.ping).send("$ConnectionName")).Status -eq "Success") { foreach ($Folder in $RGFolders) { $RGName = $Group.ReplicationGroupName $RFName = $Folder.ReplicatedFolderName if ($Connection.Inbound -eq $True) { $SendingMember = $ConnectionName $ReceivingMember = $ComputerName $Direction="inbound" } else { $SendingMember = $ComputerName $ReceivingMember = $ConnectionName $Direction="outbound" } $BLCommand = "dfsrdiag Backlog /RGName:'" + $RGName + "' /RFName:'" + $RFName + "' /SendingMember:" + $SendingMember + " /ReceivingMember:" + $ReceivingMember $Backlog = Invoke-Expression -Command $BLCommand $BackLogFilecount = 0 foreach ($item in $Backlog) { if ($item -ilike "*Backlog File count*") { $BacklogFileCount = [int]$Item.Split(":")[1].Trim() } } if ($BacklogFileCount -eq 0) { $Color="white" $Succ=$Succ+1 } elseif ($BacklogFilecount -lt 10) { $Color="yellow" $Warn=$Warn+1 } else { $Color="red" $Err=$Err+1 } Write-Host "$BacklogFileCount files in backlog $SendingMember->$ReceivingMember for $RGName" -fore $Color } # Closing iterate through all folders } # Closing If replies to ping } # Closing If Connection enabled } # Closing iteration through all connections } # Closing iteration through all groups Write-Host "$Succ successful, $Warn warnings and $Err errors from $($Succ+$Warn+$Err) replications." Thanks, Gordon

    Read the article

  • How can i link a oracle user to a business objects user

    - by Robert Speckmann
    I have a problem with linking the oracle user to a business objects user. I will try to explain it as detailed as possible; I have a Oracle database (10g) where a couple of users are defined. These users can query on information with application X. Those records will then be written into the oracle database. The records that is written into the database has a ID that links to the person that has run the query. I also have a active directory in wich a couple of users are made; testuser1, testuser2. When those users log on, and want to load a report in Business Objects XI i want them to see the information that was created when the report was activated by that same user that had runned the query before with application X. The name of the person in the active directory and the name in the oracle database are not the same but i dont think that would be a problem in this stage. So the steps i took: First, i run a report in application X (with a account prodpim_rs) wich fills my Oracle database with a record. The second step is logging on as testuser1 (from the AD) and then login on Business Objects XI with the account. Now i want to load a report with the information in my Oracle database. So the prodpim_rs user and the testuser must have a link between them. I am wondering how to forfill this. Can i link the account, wich is made in a Oracle database, with the user of BO wich is linked to my AD? Thank you in advance for your reply Robert

    Read the article

  • SQL Server 2005 - Linked Visual Foxpro Authorization

    - by John
    Here's the Scenario: We have an existing SQL 2000 Server that has a linked server to a share directory (on another server) containing Visual FoxPro tables; all connections work correctly. Porting the SQL 2000 server to a new SQL 2005 server results in questionable behavior: If you connect to the server, remotely, using Windows Authentication, you receive this error when running a query against the linked server: OLE DB provider "MSDASQL" for linked server "[linked server name]" returned message "[Microsoft][ODBC Visual FoxPro Driver]File 'MyTable.dbf' does not exist.". Msg 7350, Level 16, State 2, Line 2 Cannot get the column information from OLE DB provider "MSDASQL" for linked server "[linked server name]". However, logged in locally, the query works fine. The query also works correctly when logged in remotely, but using a SQL login. The only scenario I receive the error is when connected remotely, using windows authentication. As I mentioned before, this works on the SQL 2000 server, and both the old and new servers are running under the same network account (which has access to the folder the FoxPro files are in). Doing a little searching on the internet it looks like others have run into this situation, but I haven't found a resolution. Has anyone run into this before?

    Read the article

< Previous Page | 308 309 310 311 312 313 314 315 316 317 318 319  | Next Page >