Search Results

Search found 12166 results on 487 pages for 'invocation api'.

Page 317/487 | < Previous Page | 313 314 315 316 317 318 319 320 321 322 323 324  | Next Page >

  • compact framework windows CE using ExtEscape to control the brightness

    - by mack369
    I need to be able to control brightness of my Windows CE 5.0 device. I've found that there is an API function ExtEscape to do that ( http://msdn.microsoft.com/en-us/library/aa453063 ) but it needs a structure ContrastCmdInputParm (http://msdn.microsoft.com/en-us/library/Aa447689 ) as a parameter. Since ExtEscape is unmanaged, I cannot pass a .net structure. What is the simplest way to call this function?

    Read the article

  • Best way to associate phone numbers with names

    - by Horace Loeb
    My application stores lots of its users friends' phone numbers. I'd like to allow users to associate names with these phone numbers, but I don't want to make users manually type in names (obviously). I'm curious what the best overall approach is here, as well as the best way to implement it Overall approach-wise, I imagine using Gmail / Yahoo / Windows Live contacts is best (the Facebook API doesn't let you access phone numbers), though the gems I've found for interacting with these contacts APIs (this and this) only give you access to the names and email addresses of each contact.

    Read the article

  • error in fetching url data

    - by Rahul s
    from google.appengine.ext import webapp from google.appengine.ext.webapp import util from google.appengine.ext import db from google.appengine.api import urlfetch class TrakHtml(db.Model): hawb = db.StringProperty(required=False) htmlData = db.TextProperty() class MainHandler(webapp.RequestHandler): def get(self): Traks = list() Traks.append('93332134') #Traks.append('91779831') #Traks.append('92782244') #Traks.append('38476214') for st in Traks : trak = TrakHtml() trak.hawb = st url = 'http://etracking.cevalogistics.com/eTrackResultsMulti.aspx?sv='+st result = urlfetch.fetch(url) self.response.out.write(result.read()) trak.htmlData = result.read() trak.put() result.read() is not giving whole file , it giving some portion. trak.htmlData is a textproparty() so it have to store whole file and i want that only

    Read the article

  • Java: Is it possible to send SMS from a Java application

    - by dhiraj
    Is it possible to send SMS from a Java application. I don't want to use J2ME in this case. I want to know with respect to J2SE and J2EE only. Is there any API available to achieve this? If it is available whether we have to use any service provider or not for this? Can you tell me how to achieve that?

    Read the article

  • Introduction to midi programming

    - by bobobobo
    So I have a little (musical) keyboard that has USB midi interface. I know you can program to this (many programs accept input from the midi device via USB interface) but where do you begin to program a midi device? Ideally I'm looking for a platform-independent api, through Python or something.

    Read the article

  • Paypal Mass pay fails when large transactions are made

    - by Sid
    I am using the paypal mass pay feature but i am unable to make payments greater than $20. When I attempt to make large transactions (say for $120) i get the error that says the account has insufficient funds. My account has more than the requisite amount to make the payment. I am trying to find a solution as there is no documentation that says anything about an a limit for each payment in the mass pay api. I would appreciate any help on this.

    Read the article

  • How to find WindowRef of Apple Help Viewer application?

    - by Mark
    Hi, In my Carbon application upon display of Preference Panes, I have a link which when clicked opens up Apple Help Viewer. The problem I am facing is the Help Viewer Window is behind my preference pane window. I would like to keep the Help Viewer window on top of the Preference Pane. Is there any way to get the WindowRef of the Help Viewer app so that I can use SendBehind API to send the help viewer behind the current window. Thanks a lot Regards, Marc

    Read the article

  • Android: Music track visualization

    - by Swathi EP
    Hello all, I want to create an music track visualization for an music player application which should look like as below: you can see in the above image that, there is an equalizer kind of view and it should vary as the music track is played. I need to know the right way to achieve the above visualization, which api to use?, etc., Any suggestion will be greatly helpful to me. Thanks, Swathi

    Read the article

  • Excel Save fails in Windows 7

    - by Karthik
    Hi, I have created an application to interact with Excel in C#.net The API to save the Excel Excel._Workbook m_oWorkBook; m_oWorkBook.Save(); Throws up a File Saveas MessageBox though the workbook was already saved in a given name. Note: This happens only in Windows 7 & only when another Workbook was already opened. Any clues.

    Read the article

  • Why enabling transparency can lead to cliping problems ?

    - by Amokrane
    Hi, I'm working on a 3D graphical application in Java using the Java 3D API. I noticed that every time I was dealing with transparency, all I got in return were some clipping problems. Some parts of the scene weren't displayed properly. It might seem obvious that this would happen in a certain way but I'm looking for a logical explanation, why is this happening? Thank you

    Read the article

  • Efficient database access when dealing with multiple abstracted repositories

    - by Nathan Ridley
    I want to know how most people are dealing with the repository pattern when it involves hitting the same database multiple times (sometimes transactionally) and trying to do so efficiently while maintaining database agnosticism and using multiple repositories together. Let's say we have repositories for three different entities; Widget, Thing and Whatsit. Each repository is abstracted via a base interface as per normal decoupling design processes. The base interfaces would then be IWidgetRepository, IThingRepository and IWhatsitRepository. Now we have our business layer or equivalent (whatever you want to call it). In this layer we have classes that access the various repositories. Often the methods in these classes need to do batch/combined operations where multiple repositories are involved. Sometimes one method may make use of another method internally, while that method can still be called independently. What about, in this scenario, when the operation needs to be transactional? Example: class Bob { private IWidgetRepository _widgetRepo; private IThingRepository _thingRepo; private IWhatsitRepository _whatsitRepo; public Bob(IWidgetRepository widgetRepo, IThingRepository thingRepo, IWhatsitRepository whatsitRepo) { _widgetRepo = widgetRepo; _thingRepo= thingRepo; _whatsitRepo= whatsitRepo; } public void DoStuff() { _widgetRepo.StoreSomeStuff(); _thingRepo.ReadSomeStuff(); _whatsitRepo.SaveSomething(); } public void DoOtherThing() { _widgetRepo.UpdateSomething(); DoStuff(); } } How do I keep my access to that database efficient and not have a constant stream of open-close-open-close on connections and inadvertent invocation of MSDTS and whatnot? If my database is something like SQLite, standard mechanisms like creating nested transactions are going to inherently fail, yet the business layer should not have to be concerning itself with such things. How do you handle such issues? Does ADO.Net provide simple mechanisms to handle this or do most people end up wrapping their own custom bits of code around ADO.Net to solve these types of problems?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Converting PDF to PCL5 on Windows?

    - by Hein du Plessis
    In my application, I need to convert PDF docs to PCL5 generic files to send to FTP PCL capable printers. Printing to file would be a last resort, I would prefer a small-footprint command line tool or API that will do the job. I've seen some mention of doing this on Linux using Ghostscript, but I've got no idea how to replicate this on windows. Many thanks

    Read the article

  • HTTPS on iPhone

    - by Rob
    I need to be able to use https to connect to a server and I'm wondering if there's recommended way of doing this on the iPhone that's NOT: - an undocumented api call - does not require manually storing certificates in the app bundle Thanks all.

    Read the article

  • How to cancel a touch sequence

    - by Alex
    I have an UIImage view that responds to touch events. I want to cancel the touch sequence if the touch goes outside of certain bounds. How can I do that? I know that I can inspect the coordinates of the touch object, what I don't know is how to cancel the sequence. I don't see any event in the API that allows for that.

    Read the article

  • Good way to create PDF from Office documents in Java

    - by Sindri Traustason
    I'm looking for a good way to convert Office (mostly Microsoft) documents to PDF in Java. I've been looking at using the OpenOffice SDK but from the samples I've looked at it looks like this requires having OpenOffice running in server mode to do the work. Does anyone know of a good way to do this? Good meaning the less external requirements, the better. A 100% Java API would be best, but I don't expect that actually exists.

    Read the article

< Previous Page | 313 314 315 316 317 318 319 320 321 322 323 324  | Next Page >