Search Results

Search found 14486 results on 580 pages for 'python idle'.

Page 319/580 | < Previous Page | 315 316 317 318 319 320 321 322 323 324 325 326  | Next Page >

  • Creating collaborative whiteboard drawing application

    - by Steven Sproat
    I have my own drawing program in place, with a variety of "drawing tools" such as Pen, Eraser, Rectangle, Circle, Select, Text etc. It's made with Python and wxPython. Each tool mentioned above is a class, which all have polymorphic methods, such as left_down(), mouse_motion(), hit_test() etc. The program manages a list of all drawn shapes -- when a user has drawn a shape, it's added to the list. This is used to manage undo/redo operations too. So, I have a decent codebase that I can hook collaborative drawing into. Each shape could be changed to know its owner -- the user who drew it, and to only allow delete/move/rescale operations to be performed on shapes owned by one person. I'm just wondering the best way to develop this. One person in the "session" will have to act as the server, I have no money to offer free central servers. Somehow users will need a way to connect to servers, meaning some kind of "discover servers" browser...or something. How do I broadcast changes made to the application? Drawing in realtime and broadcasting a message on each mouse motion event would be costly in terms of performance and things get worse the more users there are at a given time. Any ideas are welcome, I'm not too sure where to begin with developing this (or even how to test it)

    Read the article

  • Forwarding keypresses in GTK

    - by dguaraglia
    I'm writing a bit of code for a Gedit plugin. I'm using Python and the interface (obviously) is GTK. So, the issue I'm having is quite simple: I have a search box (a gtk.Entry) and right below I have a results box (a gtk.TreeView). Right after you type something in the search box you are presented a bunch of results, and I would like the user to be able to press the Up/Down keys to select one, Enter to choose it, and be done. Thing is, I can't seem to find a way to forward the Up/Down keypress to the TreeView. Currently I have this piece of code: def __onSearchKeyPress(self, widget, event): """ Forward up and down keys to the tree. """ if event.keyval in [gtk.keysyms.Up, gtk.keysyms.Down]: print "pressed up or down" e = gtk.gdk.Event(gtk.gdk.KEY_PRESS) e.keyval = event.keyval e.window = self.browser.window e.send_event = True self.browser.emit("key-press-event", e) return True I can clearly see I'm receiving the right kind of event, but the event I'm sending gets ignored by the TreeView. Any ideas? Thanks in advance people.

    Read the article

  • Is there a programmatic way to transform a sequence of image files into a PDF?

    - by Salim Fadhley
    I have a sequence of JPG images. Each of the scans is already cropped to the exact size of one page. They are sequential pages of a valuable and out of print book. The publishing application requires that these pages be submitted as a single PDF file. I could take each of these images and just past them into a word-processor (e.g. OpenOffice) - unfortunately the problem here is that it's a very big book and I've got quite a few of these books to get through. It would obviously be time-consuming. This is volunteer work! My second idea was to use LaTeX - I could make a very simple document that consists of nothing more than a series of in-line image includes. I'm sure that this approach could be made to work, it's just a little on the complex side for something which seems like a very simple job. It occurred to me that there must be a simpler way - so any suggestions? I'm on Ubuntu 9.10, my primary programming language is Python, but if the solution is super-simple I'd happily adopt any technology that works.

    Read the article

  • Process xml-like log file queue

    - by Zsolt Botykai
    Hi all, first of all: I'm not a programmer, never was, although had learn a lot during my professional carreer as a support consultant. Now my task is to process - and create some statistics about a constantly written and rapidly growing XML like log file. It's not valid XML, because it does not have a proper <root> element, e.g. the log looks like this: <log itemdate="somedate"> <field id="0" /> ... </log> <log itemdate="somedate+1"> <field id="0" /> ... </log> <log itemdate="somedate+n"> <field id="0" /> ... </log> E.g. I have to count all the items with field id=0. But most of the solutions I had found (e.g. using XPath) reports an error about the garbage after the first closing </log>. Most probably I can use python (2.6, although I can compile 3.x as well), or some really old perl version (5.6.x), and recently compiled xmlstarlet which really looks promising - I was able to create the statistics for a certain period after copying the file, and pre- & appending the opening and closing root element. But this is a huge file and copying takes time as well. Isn't there a better solution? Thanks in advance!

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • sqlalchemy dynamic mapping

    - by adancu
    Hi, I have the following problem: I have the class: class Word(object): def __init__(self): self.id = None self.columns = {} def __str__(self): return "(%s, %s)" % (str(self.id), str(self.columns)) self.columns is a dict which will hold (columnName:columnValue) values. The name of the columns are known at runtime and they are loaded in a wordColumns list, for example wordColumns = ['english', 'korean', 'romanian'] wordTable = Table('word', metadata, Column('id', Integer, primary_key = True) ) for columnName in wordColumns: wordTable.append_column(Column(columnName, String(255), nullable = False)) I even created a explicit mapper properties to "force" the table columns to be mapped on word.columns[columnName], instead of word.columnName, I don't get any error on mapping, but it seems that doesn't work. mapperProperties = {} for column in wordColumns: mapperProperties['columns[\'%']' % column] = wordTable.columns[column] mapper(Word, wordTable, mapperProperties) When I load a word object, SQLAlchemy creates an object which has the word.columns['english'], word.columns['korean'] etc. properties instead of loading them into word.columns dict. So for each column, it creates a new property. Moreover word.columns dictionary doesn't even exists. The same way, when I try to persist a word, SQLAlchemy expects to find the column values in properties named like word.columns['english'] (string type) instead of the dictionary word.columns. I have to say that my experience with Python and SQLAlchemy is quite limited, maybe it isn't possible to do what I'm trying to do. Any help appreciated, Thanks in advance.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Accessing data entered into multiple Django forms and generating them onto a new URL

    - by pedjk
    I have a projects page where users can start up new projects. Each project has two forms. The two forms are: class ProjectForm(forms.Form): Title = forms.CharField(max_length=100, widget=_hfill) class SsdForm(forms.Form): Status = forms.ModelChoiceField(queryset=P.ProjectStatus.objects.all()) With their respective models as follows: class Project(DeleteFlagModel): Title = models.CharField(max_length=100) class Ssd(models.Model): Status = models.ForeignKey(ProjectStatus) Now when a user fills out these two forms, the data is saved into the database. What I want to do is access this data and generate it onto a new URL. So I want to get the "Title" and the "Status" from these two forms and then show them on a new page for that one project. I don't want the "Title" and "Status" from all the projects to show up, just for one project at a time. If this makes sense, how would I do this? I'm very new to Django and Python (though I've read the Django tutorials) so I need as much help as possible. Thanks in advance Edit: The ProjectStatus code is (under models): class ProjectStatus(models.Model): Name = models.CharField(max_length=30) def __unicode__(self): return self.Name

    Read the article

  • pyOpenSSL and the WantReadError

    - by directedition
    I have a socket server that I am trying to move over to SSL on python 2.5, but I've run into a snag with pyOpenSSL. I can't find any good tutorials on using it, so I'm operating largely on guesses. Here is how my server sets up the socket: ctx = SSL.Context(SSL.SSLv23_METHOD) ctx.use_privatekey_file ("mykey.pem") ctx.use_certificate_file("mycert.pem") sock = SSL.Connection(ctx, socket.socket(socket.AF_INET, socket.SOCK_STREAM)) sock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) addr = ('', int(8081)) sock.bind(addr) sock.listen(5) Here is how it accepts clients: sock.setblocking(0) while True: if len(select([sock], [], [], 0.25)[0]): client_sock, client_addr = sock.accept() client = ClientGen(client_sock) And here is how it sends/receives from the connected sockets: while True: (r, w, e) = select.select([sock], [sock], [], 0.25) if len(r): bytes = sock.recv(1024) if len(w): n_bytes = sock.send(self.message) It's compacted, but you get the general idea. The problem is, once the send/receive loop starts, it dies right away, before anything has been sent or received (that I can see anyway): Traceback (most recent call last): File "ClientGen.py", line 50, in networkLoop n_bytes = sock.send(self.message WantReadError The manual's description of the 'WantReadError' is very vague, saying it can come from just about anywhere. What am I doing wrong?

    Read the article

  • Design an Application That Stores and Processes Files

    - by phasetwenty
    I'm tasked with writing an application that acts as a central storage point for files (usually document formats) as provided by other applications. It also needs to take commands like "file 395 needs a copy in X format", at which point some work is offloaded to a 3rd party application. I'm having trouble coming up with a strategy for this. I'd like to keep the design as simple as possible, so I'd like to avoid big extra frameworks or techniques like threads for as long as it makes sense. The clients are expected to be web applications (for example, one is a django application that receives files from our customers; the others are not yet implemented). The platform it will be running on is likely going to be Python on Linux, unless I have a strong argument to use something else. In the beginning I thought I could fit the information I wanted to communicate in the filenames, and let my application parse the filename to figure out what it needed to do, but this is proving too inflexible with the amount of information I'm realizing I need to make available. Another idea is to pair FTP with a database used as a communication medium (client uploads a file and updates the database with a command as a row in a table) but I don't like this idea because adding commands (a known change) looks like it will require adding code as well as changing database schemas. It will also muddy up the interface my clients will have to use. I looked into Pyro to let applications communicate more directly but I don't like the idea of running an extra nameserver for this one purpose. I also don't see a good way to do file transfer within this framework. What I'm looking for is techniques and/or technologies applicable to my problem. At the simplest level, I need the ability to accept files and messages with them.

    Read the article

  • Nose2 multiprocess error on Windows7

    - by tt293
    I was looking into nose2 as a way to get around the restrictions of having both xunit output and multiprocessing in nose1.3. However, when always-on is set to False in the [multiprocess] section, I can only get a single process running, while when running with always-on set to True, I get the following error: ---------------------------------------------------------------------- Ran 0 tests in 0.043s OK Traceback (most recent call last): File "C:\dev\testing\Tests\PythonTests\venv\Scripts\nose2-script.py", line 8, in <module> load_entry_point('nose2==0.4.7', 'console_scripts', 'nose2')() File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\main.py", line 284, in discover return main(*args, **kwargs) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\main.py", line 98, in __init__ super(PluggableTestProgram, self).__init__(**kw) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\unittest2-0.5.1- py2.7.egg\unittest2\main.py", line 98, in __init__ self.runTests() File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\main.py", line 260, in runTests self.result = runner.run(self.test) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\runner.py", line 53, in run executor(test, result) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\plugins\mp.py", line 60, in _runmp ready, _, _ = select.select(rdrs, [], [], self.testRunTimeout) select.error: (10038, 'An operation was attempted on something that is not a soc ket') This is running python 2.7.5 (32bit) on Windows 7 in a virtualenv with six-1.1.0, unittest2-0.5.1 and nose2-0.4.7 (I get the same behavior outside of the venv, so I don't think that is the issue here).

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Add a value to an element in a list of sets

    - by Kapelson
    Hello. I'm using python, and I have a list of sets, constructed like this: list = [set([])]*n ...where n is the number of sets I want in the list. I want to add a value to a specific set in the list. Say, the second set. I tried list[1].add(value) But this instead adds the value to each set in the list. This behaviour is pretty non-intuitive to me. Through further tests, I think I've found the problem: the list apparently contains 10 instances of the same set, or ten pointers to the same set, or something. Constructing the list through repeated calls of list.append(set([])) allowed me to use the syntax above to add elements to single sets. So my question is this: what exactly is going on in my first list-construction technique? It is clear I don't understand the syntax so well. Also, is there a better way to intialize an n-element list? I've been using this syntax for a while and this is my first problem with it.

    Read the article

  • create a class attribute without going through __setattr__

    - by eric.frederich
    Hello, What I have below is a class I made to easily store a bunch of data as attributes. They wind up getting stored in a dictionary. I override __getattr__ and __setattr__ to store and retrieve the values back in different types of units. When I started overriding __setattr__ I was having trouble creating that initial dicionary in the 2nd line of __init__ like so... super(MyDataFile, self).__setattr__('_data', {}) My question... Is there an easier way to create a class level attribute with going through __setattr__? Also, should I be concerned about keeping a separate dictionary or should I just store everything in self.__dict__? #!/usr/bin/env python from unitconverter import convert import re special_attribute_re = re.compile(r'(.+)__(.+)') class MyDataFile(object): def __init__(self, *args, **kwargs): super(MyDataFile, self).__init__(*args, **kwargs) super(MyDataFile, self).__setattr__('_data', {}) # # For attribute type access # def __setattr__(self, name, value): self._data[name] = value def __getattr__(self, name): if name in self._data: return self._data[name] match = special_attribute_re.match(name) if match: varname, units = match.groups() if varname in self._data: return self.getvaras(varname, units) raise AttributeError # # other methods # def getvaras(self, name, units): from_val, from_units = self._data[name] if from_units == units: return from_val return convert(from_val, from_units, units), units def __str__(self): return str(self._data) d = MyDataFile() print d # set like a dictionary or an attribute d.XYZ = 12.34, 'in' d.ABC = 76.54, 'ft' # get it back like a dictionary or an attribute print d.XYZ print d.ABC # get conversions using getvaras or using a specially formed attribute print d.getvaras('ABC', 'cm') print d.XYZ__mm

    Read the article

  • Merging similar dictionaries in a list together

    - by WonderSteve
    New to python here. I've been pulling my hair for hours and still can't figure this out. I have a list of dictionaries: [ {'FX0XST001.MID5': '195', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} {'FX0XST001.MID13': '4929', 'Name': 'Firmicutes', 'Taxonomy ID': '1239','Type': 'phylum'}, {'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'}, . . . . {'FX0XST001.MID6': '125', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID25': '70', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} ] I want to merge the dictionaries in the list based on their Type, Name, and Taxonomy ID [ {'FX0XST001.MID5': '195', 'FX0XST001.MID13': '4929', 'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} . . . . {'FX0XST001.MID6': '125', 'FX0XST001.MID25': '70', 'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'}] I have the data structure setup like this because I need to write the data to CSV using csv.DictWriter later. Would anyone kindly point me to the right direction?

    Read the article

  • Problems with i18n using django translation on App-Engine with Korean and Hindi

    - by Greg
    I've got a setup based on the post here, and it works perfectly. Adding more languages to the mix, it recognises them fine, except for Korean (ko) and Hindi (hi). Chinese/Japanese/Hebrew are all fine, so nothing to do with encodings/charsets I don't think. Taking a look into the django code inside the app-engine SDK, I notice that all the languages that I'm using except for ko and hi are ones that ship with django - in the default settings.py and inside the locale folder they are missing. If I copy one of the locale folders inside the /usr/local/google_appengine/lib/django[...]/conf/locale and rename it to be 'ko', then it starts working in my app, but I won't be able to replicate this modification when I deploy to app-engine, so need a bit of help understanding what I might be doing wrong. my settings.py is definitely being taken into account, as if I remove languages from there then they stop working (as they should). If I copied the django modules into my app, under 'lib' there say, could I use those instead of the ones app-engine tries to use, maybe? I'm brand new to python/django/app-engine, and developing on a Mac with Leopard, if that makes any difference. I have the latest app-engine SDK as of tuesday.

    Read the article

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • Repeated host lookups failing in urllib2

    - by reve_etrange
    I have code which issues many HTTP GET requests using Python's urllib2, in several threads, writing the responses into files (one per thread). During execution, it looks like many of the host lookups fail (causing a name or service unknown error, see appended error log for an example). Is this due to a flaky DNS service? Is it bad practice to rely on DNS caching, if the host name isn't changing? I.e. should a single lookup's result be passed into the urlopen? Exception in thread Thread-16: Traceback (most recent call last): File "/usr/lib/python2.6/threading.py", line 532, in __bootstrap_inner self.run() File "/home/da/local/bin/ThreadedDownloader.py", line 61, in run page = urllib2.urlopen(url) # get the page File "/usr/lib/python2.6/urllib2.py", line 126, in urlopen return _opener.open(url, data, timeout) File "/usr/lib/python2.6/urllib2.py", line 391, in open response = self._open(req, data) File "/usr/lib/python2.6/urllib2.py", line 409, in _open '_open', req) File "/usr/lib/python2.6/urllib2.py", line 369, in _call_chain result = func(*args) File "/usr/lib/python2.6/urllib2.py", line 1170, in http_open return self.do_open(httplib.HTTPConnection, req) File "/usr/lib/python2.6/urllib2.py", line 1145, in do_open raise URLError(err) URLError: <urlopen error [Errno -2] Name or service not known>

    Read the article

  • Paginating requests to an API

    - by user332912
    I'm consuming (via urllib/urllib2) an API that returns XML results. The API always returns the total_hit_count for my query, but only allows me to retrieve results in batches of, say, 100 or 1000. The API stipulates I need to specify a start_pos and end_pos for offsetting this, in order to walk through the results. Say the urllib request looks like "http://someservice?query='test'&start_pos=X&end_pos=Y". If I send an initial 'taster' query with lowest data transfer such as http://someservice?query='test'&start_pos=1&end_pos=1 in order to get back a result of, for conjecture, total_hits = 1234, I'd like to work out an approach to most cleanly request those 1234 results in batches of, again say, 100 or 1000 or... This is what I came up with so far, and it seems to work, but I'd like to know if you would have done things differently or if I could improve upon this: hits_per_page=1000 # or 1000 or 200 or whatever, adjustable total_hits = 1234 # retreived with BSoup from 'taster query' base_url = "http://someservice?query='test'" startdoc_positions = [n for n in range(1, total_hits, hits_per_page)] enddoc_positions = [startdoc_position + hits_per_page - 1 for startdoc_position in startdoc_positions] for start, end in zip(startdoc_positions, enddoc_positions): if end total_hits: end = total_hits print "url to request is:\n ", print "%s&start_pos=%s&end_pos=%s" % (base_url, start, end) p.s. I'm a long time consumer of StackOverflow, especially the Python questions, but this is my first question posted. You guys are just brilliant.

    Read the article

  • Faster Insertion of Records into a Table with SQLAlchemy

    - by Kyle Brandt
    I am parsing a log and inserting it into either MySQL or SQLite using SQLAlchemy and Python. Right now I open a connection to the DB, and as I loop over each line, I insert it after it is parsed (This is just one big table right now, not very experienced with SQL). I then close the connection when the loop is done. The summarized code is: log_table = schema.Table('log_table', metadata, schema.Column('id', types.Integer, primary_key=True), schema.Column('time', types.DateTime), schema.Column('ip', types.String(length=15)) .... engine = create_engine(...) metadata.bind = engine connection = engine.connect() .... for line in file_to_parse: m = line_regex.match(line) if m: fields = m.groupdict() pythonified = pythoninfy_log(fields) #Turn them into ints, datatimes, etc if use_sql: ins = log_table.insert(values=pythonified) connection.execute(ins) parsed += 1 My two questions are: Is there a way to speed up the inserts within this basic framework? Maybe have a Queue of inserts and some insertion threads, some sort of bulk inserts, etc? When I used MySQL, for about ~1.2 million records the insert time was 15 minutes. With SQLite, the insert time was a little over an hour. Does that time difference between the db engines seem about right, or does it mean I am doing something very wrong?

    Read the article

  • I need Selenium to open it's web browser in a larger resolution ( preferably maximized)

    - by user1854271
    I am using Selenium WebDriver and coding in Python I have looked all over the place and the best I could find were things written in different languages. I also tried to use the export tool on Selenium IDE but when I look at the data says that the function is not supported for export. EDIT: The reason I need the browser to open up with a larger resolution is because the web application that I am testing is supporting tablet resolution as so elements are different depending on the resolution of the browser window. This is the script I exported from the IDE with a couple of modifications. from selenium import webdriver from selenium.webdriver.common.by import By from selenium.webdriver.support.ui import Select from selenium.common.exceptions import NoSuchElementException import unittest, time, re from Funk_Lib import RS class CreatingEditingDeletingVault(unittest.TestCase): def setUp(self): self.driver = webdriver.Firefox() self.driver.implicitly_wait(30) self.base_url = "http://cimdev-qa40/" self.verificationErrors = [] def test_creating_editing_deleting_vault(self): driver = self.driver driver.get(self.base_url + "/Login?contoller=Home") driver.find_element_by_id("UserName").click() driver.find_element_by_id("UserName").clear() driver.find_element_by_id("UserName").send_keys("[email protected]") driver.find_element_by_name("Password").click() driver.find_element_by_name("Password").clear() driver.find_element_by_name("Password").send_keys("Codigo#123") driver.find_element_by_id("fat-btn").click() driver.get(self.base_url + "/Content/Vaults/") driver.find_element_by_link_text("Content").click() driver.find_element_by_link_text("Vaults").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("New vault").click() driver.find_element_by_name("Name").clear() driver.find_element_by_name("Name").send_keys("Test Vault") driver.find_element_by_xpath("//button[@onclick=\"vault_action('createvault', null, $('#CreateVault [name=\\'Name\\']').val())\"]").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("Rename vault").click() driver.find_element_by_name("Id").click() Select(driver.find_element_by_name("Id")).select_by_visible_text("Test Vault") driver.find_element_by_css_selector("option[value=\"2\"]").click() driver.find_element_by_name("Name").clear() driver.find_element_by_name("Name").send_keys("Test Change") driver.find_element_by_xpath("//button[@onclick=\"vault_action('renamevault', $('#RenameVault [name=\\'Id\\']').val(), $('#RenameVault [name=\\'Name\\']').val())\"]").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("Delete vault").click() driver.find_element_by_name("Id").click() Select(driver.find_element_by_name("Id")).select_by_visible_text("Test Change") driver.find_element_by_css_selector("option[value=\"2\"]").click() driver.find_element_by_xpath("//button[@onclick=\"vault_action('deletevault', $('#DeleteVault [name=\\'Id\\']').val(), '')\"]").click() def is_element_present(self, how, what): try: self.driver.find_element(by=how, value=what) except NoSuchElementException, e: return False return True def tearDown(self): self.driver.quit() self.assertEqual([], self.verificationErrors) if __name__ == "__main__": unittest.main()

    Read the article

  • tk: how to invoke it just to display something, and return to the main program?

    - by max
    Sorry for the noob question but I really don't understand this. I'm using python / tkinter and I want to display something (say, a canvas with a few shapes on it), and keep it displayed until the program quits. I understand that no widgets would be displayed until I call tkinter.tk.mainloop(). However, if I call tkinter.tk.mainloop(), I won't be able to do anything else until the user closes the main window. I don't need to monitor any user input events, just display some stuff. What's a good way to do this without giving up control to mainloop? EDIT: Is this sample code reasonable: class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.loop() def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after(0, self.loop) def redraw(): # get whatever we need from self.sim, and put it on the screen EDIT2 (added after_idle): class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.after_idle(self.preloop) def preloop(): self.after(0, self.loop) def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after_idle(self.preloop) def redraw(): # get whatever we need from self.sim, and put it on the screen

    Read the article

  • Extended slice that goes to beginning of sequence with negative stride

    - by recursive
    Bear with me while I explain my question. Skip down to the bold heading if you already understand extended slice list indexing. In python, you can index lists using slice notation. Here's an example: >>> A = list(range(10)) >>> A[0:5] [0, 1, 2, 3, 4] You can also include a stride, which acts like a "step": >>> A[0:5:2] [0, 2, 4] The stride is also allowed to be negative, meaning the elements are retrieved in reverse order: >>> A[5:0:-1] [5, 4, 3, 2, 1] But wait! I wanted to see [4, 3, 2, 1, 0]. Oh, I see, I need to decrement the start and end indices: >>> A[4:-1:-1] [] What happened? It's interpreting -1 as being at the end of the array, not the beginning. I know you can achieve this as follows: >>> A[4::-1] [4, 3, 2, 1, 0] But you can't use this in all cases. For example, in a method that's been passed indices. My question is: Is there any good pythonic way of using extended slices with negative strides and explicit start and end indices that include the first element of a sequence? This is what I've come up with so far, but it seems unsatisfying. >>> A[0:5][::-1] [4, 3, 2, 1, 0]

    Read the article

  • django multiprocess problem

    - by iKiR
    I have django application, running under lighttpd via fastcgi. FCGI running script looks like: python manage.py runfcgi socket=<path>/main.socket method=prefork \ pidfile=<path>/server.pid \ minspare=5 maxspare=10 maxchildren=10 maxrequests=500 \ I use SQLite. So I have 10 proccess, which all work with the same DB. Next I have 2 views: def view1(request) ... obj = MyModel.objects.get_or_create(id=1) obj.param1 = <some value> obj.save () def view2(request) ... obj = MyModel.objects.get_or_create(id=1) obj.param2 = <some value> obj.save () And If this views are executed in two different threads sometimes I get MyModel instance in DB with id=1 and updated either param1 or param2 (BUT not both) - it depends on which process was the first. (of course in real life id changes, but sometimes 2 processes execute these two views with same id) The question is: What should I do to get instance with updated param1 and param2? I need something for merging changes in different processes. One decision is create interprocess lock object but in this case I will get sequence executing views and they will not be able to be executed simultaneously, so I ask help

    Read the article

  • Reason for socket.error

    - by August Flanagan
    Hi, I am a complete newbie when it comes to python, and programming in general. I've been working on a little webapp for the past few weeks trying to improve my coding chops. A few days ago my laptop was stolen so I went out and got a new MacBook Pro. Thank God I had everything under subversion control. The problem is now that I am on my new machine a script that I was running has stopped working and I have no idea why. This is really the only part of what I have been writing that I borrowed heavily for existing scripts. It is from the widely available whois.py script and I have only slightly modified it as follows (see below). It was running fine on my old system (running ubuntu), but now the socket.error is being raised. I'm completely lost on this, and would really appreciate any help. Thanks! def is_available(domainname, whoisserver="whois.verisign-grs.com", cache=0): if whoisserver is None: whoisserver = "whois.networksolutions.com" s = None while s == None: try: s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.setblocking(0) try: s.connect((whoisserver, 43)) except socket.error, (ecode, reason): if ecode in (115, 150): pass else: raise socket.error, (ecode, reason) ret = select.select([s], [s], [], 30) if len(ret[1])== 0 and len(ret[0]) == 0: s.close() raise TimedOut, "on connect " s.setblocking(1) except socket.error, (ecode, reason): print ecode, reason time.sleep(1) s = None s.send("%s \n\n" % domainname) page = "" while 1: data = s.recv(8196) if not data: break page = page + data s.close()

    Read the article

< Previous Page | 315 316 317 318 319 320 321 322 323 324 325 326  | Next Page >