Search Results

Search found 22448 results on 898 pages for 'build numbers'.

Page 32/898 | < Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • TFS2010 Hangs “Waiting for Build Agent”

    - by Qpirate
    I have asked this question over on SO the link to the question is here but i am hoping this is a better place to ask it. I have 3 VM's each running the TFS Build Host Service 1 has 1 controller and 1 agent 2 have 2 Build Agents each. Most of the time (7\10 builds) it comes back with the following error message TF215097: An error occurred while initializing a build for build definition BUILD_DEFINITION: There was no endpoint listening at http://MACHINE1:9191/Build/v3.0/Services/Controller/14 that could accept the message. This is often caused by an incorrect address or SOAP action. See InnerException, if present, for more details. and there is no errors when i do get this message. the following is the config file that i have created <configuration> <appSettings> <add key="traceWriter" value="true"/> </appSettings> <system.diagnostics> <switches> <add name="BuildServiceTraceLevel" value="4"/> <add name="API" value="4"/> <add name="Authentication" value="4"/> <add name="Authorization" value="4"/> <add name="Database" value="4"/> <add name="General" value="4"/> <add name="traceLevel" value="4"/> </switches> <trace autoflush="true" indentsize="4"> <listeners> <add name="myListener" type="Microsoft.TeamFoundation.TeamFoundationTextWriterTraceListener,Microsoft.TeamFoundation.Common, Version=10.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a" initializeData="c:\logs\TFSBuildServiceHost.exe.log" /> <remove name="Default" /> </listeners> </trace> </system.diagnostics> </configuration> I do have my own custom activities in my build process but this does not seem to be a problem as sometimes the build actually does go. I have tried refreshing the template as some sites suggest. Has anyone come across a solution for this problem? or can anyone tell me how to catch these errors when they happen?

    Read the article

  • Web Deployment Projects for VS2010 on build server failing with Error MSB4086

    - by SteveBering
    When I upgraded my Web Deployment Project from VS2008 to the VS2010 beta version, I was able to execute the build locally on my development box. However, when I tried to execute the build on our TeamCity build server, I began getting the following exception: C:\Program Files\MSBuild\Microsoft\WebDeployment\v10.0\Microsoft.WebDeployment.targets(162, 37): error MSB4086: A numeric comparison was attempted on "$(_SourceWebProjectPath.Length)" that evaluates to "" instead of a number, in condition "'$(_SourceWebProjectPath)' != '' And $(_SourceWebProjectPath.Length) >= 4)". I did install the Web Deployment Project addin on my build server and I did copy over the C:\Program Files (x86)\MSBuild\Microsoft\VisualStudio\v10.0\WebApplications directory on my development box to the C:\Program Files\MSBuild\Microsoft\VisualStudio\v10.0\ directory on the build server. Note: My dev box is 64bit and the build server 32bit. I can't figure out why this is behaving differently on the build server than on my dev machine. Anyone have any ideas? Thanks, Steve

    Read the article

  • Build Pipelining and Continuous Integration with Maven and Hudson

    - by Brandon
    Currently the my team is considering splitting our single CI build process into a more streamlined multi-stage process to speed up basic build feedback and isolate different ci concerns. The idea we had was to have each stage exist in Hudson as a different build with the correct maven goal or maven plugin execution, then chain them together using the post-build hooks of Hudson. However to my knowledge, Maven as a build tool mandates that any lifecycle phase which is performed automatically builds every preceding lifecycle phase. This presents a number of problems the most significant of which is that maven is recreating the build resources with each distinct call and not using those of the previous stage. This not only breaks the consistency of the build lifecycle but has much more unnecessary processing overhead. Is there a way to accomplish pipelining with CI using Maven? Assuming there is, is there a way to let Hudson know to use those resources built from the previous stage in the next one?

    Read the article

  • Normal Priority Builds Will Not Build in TFS 2010

    - by 37Stars
    I have two build processes setup in TFS 2010. One build starts when any developer checks code into TFS. The second build runs every night at 12:30am. I can see the builds have a priority of Normal in the queue. However no queued build ever is run until I change the priority to high. They will sit in the queue forever until the priority is changed. It appears there is a normal priority build in the queue that is stuck. However I cannot find it. I can select , , and and not see anything but these builds queued up. I can run them all and the next day I have queued builds again. I say this because I see the Build Service is configured for port 9192, which leads me to believe there is or was another Build Service on port 9191. Any idea how to resolve this issue? Thanks

    Read the article

  • How to build a game like HaxBall?

    - by Cengiz Frostclaw
    I'm a coder interested in game development, and I want to build a very simple p2p (real time) game. The perfect example for this is haxball. The client/server model doesn't matter, it could be like haxball (i.e. the room creator is the host) or changing host, or the server is host (if there is such a thing) I just want to learn the basics to create a field where players can move their characters in real time. So where should I start? Please guide me into the right direction. And with examples please. I found out that RTMFP does what I seek, but how do I use it? I know ActionScript 3.0, but no idea how to setup a multiplayer game. Please help ! Thanks in advance.

    Read the article

  • How to Own Your Own Website (Even If You Can’t Build One) Pt 1

    - by Eric Z Goodnight
    You’ve probably put up plenty of pages and accounts on various services and blogs. But today, learn how to become a real website owner and put together an awesome feature-rich website of your own with little to no experience. Having your own website is expected in many fields. You can host your resume and various files, or put up an online business card to make sure that you’re one of the top results when you do an ego search on Google. Whatever your reason is, you don’t have to pay hundreds (or thousands?) of dollars to have somebody else make a website for you, when you can use free software and cheap hosting to make your own in minutes. In this first part of a multi-part series, we’ll discuss how to put up a simple website and and how to start owning your own domain. How to Own Your Own Website (Even If You Can’t Build One) Pt 1 What’s the Difference Between Sleep and Hibernate in Windows? Screenshot Tour: XBMC 11 Eden Rocks Improved iOS Support, AirPlay, and Even a Custom XBMC OS

    Read the article

  • I am trying to build libmtp 1.1.14 but I cannot fix this error

    - by Kristoffer
    I have run this in a terminal. git clone git://libmtp.git.sourceforge.net/gitroot/libmtp/libmtp cd libmtp ./autogen.sh (answering yes to all questions) But when I try to run the ./configure --prefix=/usr/ I get this error: checking whether to build static libraries... yes ./configure: line 11739: AC_LIB_PREPARE_PREFIX: command not found ./configure: line 11740: AC_LIB_RPATH: command not found ./configure: line 11745: syntax error near unexpected token `iconv' ./configure: line 11745: ` AC_LIB_LINKFLAGS_BODY(iconv)' I have built and installed the libiconv from here. I do not know what to do, been trying for a few hours but I am pretty noob to Linux. How can i fix this? The lines 11739 to 11745 in the configure file looks like this: AC_LIB_PREPARE_PREFIX AC_LIB_RPATH AC_LIB_LINKFLAGS_BODY(iconv)

    Read the article

  • How to build a turn-based multiplayer "real time" server

    - by jmosesman
    I want to build a TCG for mobile devices that is multiplayer over the web (not local wifi or bluetooth). As a player plays cards I want the second player to see what is being played in "real time" (within a few seconds). Only one player can play at a time. Server requirements: 1) Continuously listens for input from Player 1 2) As it receives input from Player 1, sends the message to Player 2 I know some PHP, but it seems like unless I had a loop that continued until I broke it (seems like a bad idea) the script would just receive one input and quit. On the mobile side I know I can open sockets using various frameworks, but what language allows a "stream-like" behavior that continuously listens/sends messages on the server? Or if I'm missing something, what would be the best practice here?

    Read the article

  • Download Firefox 3.6.4 Build 4 (Beta)

    - by samsudeen
    Firefox has released its latest version 3.6.4 as beta. User who has already installed Firefox 3.6.4  can use the update check option in the browser will recognize to download it automatically,so that the browser can be updated. You can also download the latest beta version from the direct link (Firefox 3..6.4) of Mozilla website with the option to select the language and operating system version. As the per the release note from Mozilla this build works on the out of process plug-in module for Adobe Flash, Apple QuickTime or Microsoft Silver light plug-in, so that If a plug-in crashes or freezes, it will not affect the rest of Firefox. You will be able to reload the page to restart the plug-in and try again. The release note also states that many of the security issues and and total of 194 issues from the BugZilla list is fixed. Join us on Facebook to read all our stories right inside your Facebook news feed.

    Read the article

  • Approached to build app centered around new API and suddenly API is abandoned

    - by LuxuryMode
    This isn't a huge deal, but I was approached by colleagues/friends to build an app using their new API. There was some potential for pecuniary gain for me depending on app usage. I spent a considerable amount of time polishing the mobile app, based on my assumption that, having been approached in a serious way, that the company would not suddenly shift focus and abandon the API. I wasn't even given so much as a heads up that the API was dead even though I had an app in production that relied on it... For the most part, building the app was a learning experience which I enjoyed, but I don't think I'd have expended all the effort if I knew that the company wasn't as serious about the API as their reaching out to me clearly indicated. How, if at all, would you react?

    Read the article

  • Best Practices in Setting up a Build and Deployment environment for the Java Platform

    - by Genadinik
    I have a project for which "quick and dirty" isn't the best solution. What is the most stable and currently accepted set of procedures/tools that I should look into when setting up my build/deploy dev (and later production) environment? What I mean is: Should I use ANT? Or has there been something better that has evolved? In what instances should I use Maven? What are some best practices to create a continuous integration/deployment environment? What are best practices for doing test-driven development? Anything else?

    Read the article

  • Build one to throw away vs Second-system effect

    - by m3th0dman
    One one hand there is an advice that says "Build one to throw away". Only after finishing a software system and seeing the end product we realize what went wrong in the design phase and understand how we should have really done it. On the other hand there is the "second-system effect" which says that the second system of the same kind that is designed is usually worse than the first one; there are many features that did not fit in the first project and were pushed into the second version usually leading to overly complex and overly engineered. Isn't here some contradiction between these principles? What is the correct view over the problems and where is the border between these two? I believe that these "good practices" are were firstly promoted in the seminal book The Mythical Man-Month by Fred Brooks. I know that some of these issues are solved by Agile methodologies, but deep down, the problem is still the principles still stand; for example we would not make important design changes 3 sprints before going live.

    Read the article

  • Best tools to build an auction website

    - by Daniel Loureiro
    Can I get your feedback on the best tools to build an auction website with the following features: The site takes a commission (like 5%) on each transaction Each user can assign a rating (like 4.5 stars) to his completed transaction, and comment on the seller's profile. Accept payments in paypal and credit card I've been looking into Joomla! and JomSocial but they haven't convinced me much so far. I have some programming experience in C, Python and Java. If no CMS tools are of use I'd appreaciate if you could tell the best route to take in programming to get the auction site done.

    Read the article

  • Ouya build experiencing odd graphical artifacts, screen half black

    - by Neeko
    I'm witnessing very odd graphical artifacts when I run my Unity game on Ouya. After the Unity splash screen, the game loads with the screen half black. This seemingly has started occurring out of the blue. It also doesn't occur in the editor or the standalone build, only on Ouya. I can't think of a single reason why this would be happening. If I open the Ouya menu screen and close it, the game returns to normal; somewhat, as there may be some artifacts lingering but the screen isn't half black like in the screen shot above. I know there's not much to go off of, but any insight into why this may be happening is greatly appreciated.

    Read the article

  • build command by concatenating string in bash

    - by Lennart Rolland
    I have a bash script that builds a command-line in a string based on some parameters before executing it in one go. The parts that are concatenated to the command string are supposed to be separated by pipes to facilitate a "streaming" of data through each component. A very simplified example: #!/bin/bash part1=gzip -c part2=some_other_command cmd="cat infile" if [ ! "$part1" = "" ] then cmd+=" | $part1" fi if [ ! "$part2" = "" ] then cmd+=" | $part2" fi cmd+="> outfile" #show command. It looks ok echo $cmd #run the command. fails with pipes $cmd For some reason the pipes don't seem to work. When I run this script i get different error messages relating usually to the first part of the command (before the first pipe). So my question is whether or not it is possible to build a command in this way, and what is the best way to do it?

    Read the article

  • Build an Inexpensive but Polished Sous Vide Cooker for Geeky Culinary Fun

    - by Jason Fitzpatrick
    Kitchen craft has taken a turn for the geekier in the last few years with all manner of DIY projects; this DIY Sous Video cooker stands apart from the average hacked-together model and is polished enough to leave on the counter. We see a lot of cooking related hacks in our news feeds and this one is definitely one of the cleaner builds. It sports a clean display, nice case, and and easy to use interface–perfect for Sous Vide’ing yourself a delicious streak or other culinary treat. Hit up the link below for a full run down on the build. DIY Sous Vide Immersion Cooker On The Cheap [via Make] How To Customize Your Wallpaper with Google Image Searches, RSS Feeds, and More 47 Keyboard Shortcuts That Work in All Web Browsers How To Hide Passwords in an Encrypted Drive Even the FBI Can’t Get Into

    Read the article

  • Nautilus build fail

    - by ts01
    I am trying to patch Nautilus 3.2.1 on 11.10 with this patch (dual screen fix). So I've executed whole sequence: sudo apt-get install devscripts sudo apt-get build-dep nautilus apt-get source nautilus cd nautilus-3.2.1/ cp ~/nautilus.patch . patch --dry-run -p1 < nautilus.patch patch -p1 < nautilus.patch debuild And I've got finally fatal error (whole output here): dpkg-buildpackage: error: dpkg-source -b nautilus-3.2.1 gave error exit status 13 debuild: fatal error at line 1348: dpkg-buildpackage -rfakeroot -D -us -uc failed Any ideas?

    Read the article

  • JD Edwards Customers - Build your case to Attend Oracle OpenWorld

    This Podcast will cover Oracle OpenWorld's value add to JD Edwards customers. Hear how you can build a case to attend that will benefit you and the future of your organization, including the opportunity to meet with JD Edwards partners who bring the best of breed services and solutions to you. For more information about OpenWorld, click here. Also, call your SYSTIME representative to learn more at [email protected]. You don't want to miss this opportunity. We hope to see you in San Francisco!

    Read the article

  • How to build a .Net app which runs on desktop and as a Windows Service

    - by Mike
    Ok, I hope this is not too much confusing (with my poor English). I want to build a small .Net 4.0 app which monitors several other applications on a Windows Server OR on a regular Windows PC. It will have a WPF GUI with a variety of graphical controls. The app will be used in the following scenarios: If installed on a PC it should run as a “normal” single Windows desktop app If installed on a Server, it should run as a Windows Service. To use/manage the app it must have the same WPF GUI as in scenario 1 and the GUI should be run on the Server or on a remote PC At the moment I consider to write the application logic and connect it to the WPF GUI using a self-hosted WCF Data Service IN BOTH SCENARIOS. Since I’m not a pro developer I suppose it’s possible that I've missed something ;-) Will this work? Are there other/better solutions? Any answer or comment is highly appreciated.

    Read the article

< Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >