Search Results

Search found 22717 results on 909 pages for 'load operation'.

Page 32/909 | < Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >

  • Problem with JOGL and Framebuffer Render-to-texture: Invalid Framebuffer Operation Error

    - by quadelirus
    Okay, so I am trying to render a scene to a small 32x32 texture and ran into problems. I get an "invalid framebuffer operation" error when I try to actually draw anything to the texture. I have simplified the code below so that it simply tries to render a quad to a texture and then bind that quad as a texture for another quad that is rendered to the screen. So my question is this... where is the error? This is using JOGL 1.1.1. The error occurs at Checkpoint2 in the code. import java.awt.event.*; import javax.media.opengl.*; import javax.media.opengl.glu.*; import javax.swing.JFrame; import java.nio.*; public class Main extends JFrame implements GLEventListener, KeyListener, MouseListener, MouseMotionListener, ActionListener{ /* GL related variables */ private final GLCanvas canvas; private GL gl; private GLU glu; private int winW = 600, winH = 600; private int texRender_FBO; private int texRender_RB; private int texRender_32x32; public static void main(String args[]) { new Main(); } /* creates OpenGL window */ public Main() { super("Problem Child"); canvas = new GLCanvas(); canvas.addGLEventListener(this); canvas.addKeyListener(this); canvas.addMouseListener(this); canvas.addMouseMotionListener(this); getContentPane().add(canvas); setSize(winW, winH); setLocationRelativeTo(null); setDefaultCloseOperation(EXIT_ON_CLOSE); setVisible(true); canvas.requestFocus(); } /* gl display function */ public void display(GLAutoDrawable drawable) { gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, this.texRender_FBO); gl.glPushAttrib(GL.GL_VIEWPORT_BIT); gl.glViewport(0, 0, 32, 32); gl.glClearColor(1.f, 0.f, 0.f, 1.f); System.out.print("Checkpoint1: "); outputError(); gl.glBegin(GL.GL_QUADS); { //gl.glTexCoord2f(0.0f, 0.0f); gl.glColor3f(1.f, 0.f, 0.f); gl.glVertex3f(0.0f, 1.0f, 1.0f); //gl.glTexCoord2f(1.0f, 0.0f); gl.glColor3f(1.f, 1.f, 0.f); gl.glVertex3f(1.0f, 1.0f, 1.0f); //gl.glTexCoord2f(1.0f, 1.0f); gl.glColor3f(1.f, 1.f, 1.f); gl.glVertex3f(1.0f, 0.0f, 1.0f); //gl.glTexCoord2f(0.0f, 1.0f); gl.glColor3f(1.f, 0.f, 1.f); gl.glVertex3f(0.0f, 0.0f, 1.0f); } gl.glEnd(); System.out.print("Checkpoint2: "); outputError(); //Here I get an invalid framebuffer operation gl.glPopAttrib(); gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, 0); gl.glClearColor(0.f, 0.f, 0.f, 1.f); gl.glClear(GL.GL_COLOR_BUFFER_BIT); gl.glColor3f(1.f, 1.f, 1.f); gl.glBindTexture(GL.GL_TEXTURE_1D, this.texRender_32x32); gl.glBegin(GL.GL_QUADS); { gl.glTexCoord2f(0.0f, 0.0f); //gl.glColor3f(1.f, 0.f, 0.f); gl.glVertex3f(0.0f, 1.0f, 1.0f); gl.glTexCoord2f(1.0f, 0.0f); //gl.glColor3f(1.f, 1.f, 0.f); gl.glVertex3f(1.0f, 1.0f, 1.0f); gl.glTexCoord2f(1.0f, 1.0f); //gl.glColor3f(1.f, 1.f, 1.f); gl.glVertex3f(1.0f, 0.0f, 1.0f); gl.glTexCoord2f(0.0f, 1.0f); //gl.glColor3f(1.f, 0.f, 1.f); gl.glVertex3f(0.0f, 0.0f, 1.0f); } gl.glEnd(); } /* initialize GL */ public void init(GLAutoDrawable drawable) { gl = drawable.getGL(); glu = new GLU(); gl.glClearColor(.3f, .3f, .3f, 1f); gl.glClearDepth(1.0f); gl.glMatrixMode(GL.GL_PROJECTION); gl.glLoadIdentity(); gl.glOrtho(0, 1, 0, 1, -10, 10); gl.glMatrixMode(GL.GL_MODELVIEW); //Set up the 32x32 texture this.texRender_FBO = genFBO(gl); gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, this.texRender_FBO); this.texRender_32x32 = genTexture(gl); gl.glBindTexture(GL.GL_TEXTURE_2D, this.texRender_32x32); gl.glTexImage2D(GL.GL_TEXTURE_2D, 0, GL.GL_RGB_FLOAT32_ATI, 32, 32, 0, GL.GL_RGB, GL.GL_FLOAT, null); gl.glFramebufferTexture2DEXT(GL.GL_FRAMEBUFFER_EXT, GL.GL_COLOR_ATTACHMENT0_EXT, GL.GL_TEXTURE_2D, this.texRender_32x32, 0); //gl.glDrawBuffer(GL.GL_COLOR_ATTACHMENT0_EXT); this.texRender_RB = genRB(gl); gl.glBindRenderbufferEXT(GL.GL_RENDERBUFFER_EXT, this.texRender_RB); gl.glRenderbufferStorageEXT(GL.GL_RENDERBUFFER_EXT, GL.GL_DEPTH_COMPONENT24, 32, 32); gl.glFramebufferRenderbufferEXT(GL.GL_FRAMEBUFFER_EXT, GL.GL_DEPTH_ATTACHMENT_EXT, GL.GL_RENDERBUFFER_EXT, this.texRender_RB); gl.glBindFramebufferEXT(GL.GL_FRAMEBUFFER_EXT, 0); gl.glBindRenderbufferEXT(GL.GL_RENDERBUFFER_EXT, 0); outputError(); } private void outputError() { int c; if ((c = gl.glGetError()) != GL.GL_NO_ERROR) System.out.println(glu.gluErrorString(c)); } private int genRB(GL gl) { int[] array = new int[1]; IntBuffer ib = IntBuffer.wrap(array); gl.glGenRenderbuffersEXT(1, ib); return ib.get(0); } private int genFBO(GL gl) { int[] array = new int[1]; IntBuffer ib = IntBuffer.wrap(array); gl.glGenFramebuffersEXT(1, ib); return ib.get(0); } private int genTexture(GL gl) { final int[] tmp = new int[1]; gl.glGenTextures(1, tmp, 0); return tmp[0]; } /* mouse and keyboard callback functions */ public void reshape(GLAutoDrawable drawable, int x, int y, int width, int height) { winW = width; winH = height; gl.glViewport(0, 0, width, height); } //Sorry about these, I just had to delete massive amounts of code to boil this thing down and these are hangers-on public void mousePressed(MouseEvent e) {} public void mouseDragged(MouseEvent e) {} public void mouseReleased(MouseEvent e) {} public void keyPressed(KeyEvent e) {} public void displayChanged(GLAutoDrawable drawable, boolean modeChanged, boolean deviceChanged) { } public void keyTyped(KeyEvent e) { } public void keyReleased(KeyEvent e) { } public void mouseMoved(MouseEvent e) { } public void actionPerformed(ActionEvent e) { } public void mouseClicked(MouseEvent e) { } public void mouseEntered(MouseEvent e) { } public void mouseExited(MouseEvent e) { } }

    Read the article

  • applet does not load

    - by jcp
    We have a legacy program that was ported from Java 1.3 to Java 1.5. This application involves applets which worked fine before. After porting however, the applet would not load. However there are no errors or exceptions. The app would just try to load it forever. We tried to run it with Java 1.6 and poof! No problems whatsoever. Isn't Java 6 backwards compatible? So how come it would run in that version and not in 1.5? ==== Java Console log for Java 1.5.0_19 basic: Registered modality listener basic: Registered modality listener basic: Registered modality listener liveconnect: Invoking JS method: document liveconnect: Invoking JS method: document liveconnect: Invoking JS method: document liveconnect: Invoking JS method: URL liveconnect: Invoking JS method: URL liveconnect: Invoking JS method: URL basic: Referencing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=1 basic: Referencing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=2 basic: Referencing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=3 basic: Added progress listener: sun.plugin.util.GrayBoxPainter@b0bad7 basic: Loading applet ... basic: Initializing applet ... basic: Starting applet ... basic: Added progress listener: sun.plugin.util.GrayBoxPainter@ba9340 basic: Added progress listener: sun.plugin.util.GrayBoxPainter@1198891 basic: Loading applet ... basic: Initializing applet ... basic: Starting applet ... basic: Loading applet ... basic: Initializing applet ... basic: Starting applet ... basic: Referencing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=4 basic: Releasing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=3 basic: Referencing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=4 basic: Releasing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=3 basic: Referencing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=4 basic: Releasing classloader: sun.plugin.ClassLoaderInfo@bb7759, refcount=3 network: Connecting <something>.jar with proxy=HTTP @ proxy/<ip address> basic: Loading <something>.jar from cache basic: No certificate info, this is unsigned JAR file. Left START init() Left END init() Right START init() Control start() Waiting for Left Panel to load... Right START start() network: Connecting socket://<ip address>:14444 with proxy=DIRECT Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... my HostName : <ip address> Thread-19 Check : Thread-19 Check : Monitor : run : start Thread-20 Monitor : Monitor: run() start Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... Control start() Waiting for Left Panel to load... the last message goes on forever... and now with the working version: ==== Java Console log for Java 1.6.0_15 basic: Added progress listener: sun.plugin.util.GrayBoxPainter$GrayBoxProgressListener@1b000e7 basic: Added progress listener: sun.plugin.util.GrayBoxPainter$GrayBoxProgressListener@12611a7 basic: Added progress listener: sun.plugin.util.GrayBoxPainter$GrayBoxProgressListener@1807ca8 network: CleanupThread used 6 us network: CleanupThread used 5 us network: CleanupThread used 6 us cache: Skip blacklist check as cached value is ok. network: Cache entry found [url: <something>.jar, version: null] network: Connecting <something>.jar with proxy=HTTP @ proxy/<ip address> network: ResponseCode for <something>.jar : 304 network: Encoding for <something>.jar : null network: Disconnect connection to <something>.jar Reading certificates from 11 <something>.jar | <something>.idx network: No certificate info for unsigned JAR file: <something>.jar basic: Applet loaded. basic: Applet loaded. basic: Applet resized and added to parent container basic: Applet resized and added to parent container basic: PERF: AppletExecutionRunnable - applet.init() BEGIN ; jvmLaunch dt 330275 us, pluginInit dt 27768955 us, TotalTime: 28099230 us Right START init() basic: PERF: AppletExecutionRunnable - applet.init() BEGIN ; jvmLaunch dt 330275 us, pluginInit dt 27770563 us, TotalTime: 28100838 us Left START init() basic: Applet loaded. basic: Applet resized and added to parent container basic: PERF: AppletExecutionRunnable - applet.init() BEGIN ; jvmLaunch dt 330275 us, pluginInit dt 27779332 us, TotalTime: 28109607 us Left END init() basic: Applet initialized basic: Removed progress listener: sun.plugin.util.GrayBoxPainter$GrayBoxProgressListener@12611a7 basic: Applet made visible And that's it. Still haven't figured out why it works with java6 and not java5. @valli: the object tag was used, not applet @thorbjorn: i tried that already... it just keeps saying loading applet... @aaron: how can i know what exception it is, if there really is one? and yes we have considered that its a java bug but i still havent found what that bug is. i have to submit a report tomorrow and i've scoured the net but came up with nothing as of yet... @all: thank you for your replies

    Read the article

  • require wp-load.php 3 directories back

    - by sman591
    I'm trying to include a file (/wp-load.php) at the beginning of the /html/ directory. I'm trying to include it from /wp-content/themes/pw-steel-orange/index-load.php, but I always get the error message Warning: require_once(../wp-load.php) [function.require-once]: failed to open stream: No such file or directory in /nfs/c07/h01/mnt/102799/domains/platyworld.com/html/wp-content/themes/pw-steel-orange/index-load.php on line 1 Fatal error: require_once() [function.require]: Failed opening required '../wp-load.php' (include_path='.:/usr/local/php-5.2.6-1/share/pear') in /nfs/c07/h01/mnt/102799/domains/platyworld.com/html/wp-content/themes/pw-steel-orange/index-load.php on line 1 Am I doing something wrong? I though ../ brings the includes to the beginning directory Sorry if this is a duplicate, I couldn't find something related to this in my searches...

    Read the article

  • "rake test" doesn't load fixtures?

    - by Pavel K.
    when i run rake test --trace here's what happens ** Invoke test (first_time) ** Execute test ** Invoke test:units (first_time) ** Invoke db:test:prepare (first_time) ** Invoke db:abort_if_pending_migrations (first_time) ** Invoke environment (first_time) ** Execute environment ** Execute db:abort_if_pending_migrations ** Execute db:test:prepare ** Invoke db:test:load (first_time) ** Invoke db:test:purge (first_time) ** Invoke environment ** Execute db:test:purge ** Execute db:test:load ** Invoke db:schema:load (first_time) ** Invoke environment ** Execute db:schema:load ** Execute test:units /usr/bin/ruby1.8 -I"lib:test".... (and after that fails because there's no fixtures loaded) why doesn't it load fixtures (i thought that would be default behaviour) and how do i make it load fixtures before executing tests??? p.s. my test/test_helper.rb content is: ENV["RAILS_ENV"] = "test" require File.expand_path(File.dirname(__FILE__) + "/../config/environment") require 'test_help' class ActiveSupport::TestCase self.use_transactional_fixtures = true self.use_instantiated_fixtures = false fixtures :all end (rails 2.3.4)

    Read the article

  • User class - 'load' data

    - by John
    <?php class User { private $id; private $username; public function __construct($id = null) { $this->id = $id; if (!is_null($this->id)) { $this->load(); } } public function load() { } } ?> In the 'load' method I am going to load all the information from the current user (id) But I wonder how is the best way to load all info. I could grab all data and then just assign all private variables, but I assume there must be another "cheaper" way to get all the data so I can use as such $this-variable; And not have to ASSIGN every single data row, I select in the load method. How?

    Read the article

  • Cheap server stress testing

    - by acrosman
    The IT department of the nonprofit organization I work for recently got a new virtual server running CentOS (with Apache and PHP 5), which is supposed to host our website. During the process of setting up the server I discovered that the slightest use of the new machine caused major performance problems (I couldn't extract tarballs without bringing it to a halt). After several weeks of casting about in the dark by tech support, it now appears to be working fine, but I'm still nervous about moving the main site there. I have no budget to work with (so no software or services that require money), although due to recent cut backs I have several older desktops that I could use if it helps. The site doesn't need to withstand massive amounts of traffic (it's a Drupal site just a few thousand visitors a day), but I would like to put it through a bit of it paces before moving the main site over. What are cheap tools that I can use to get a sense if the server can withstand even low levels of traffic? I'm not looking to test the site itself yet, just fundamental operation of the server.

    Read the article

  • GMLib Could not complete the operation due to error 80020101

    - by Pierrie
    I get this error "Could not complete the operation due to error 80020101." at random times when displaying a map with a marker on it. I use Delphi 2007 and GMLib [1.2.0 Final]. I have read up on the issue and some suggestions was that the problem is due to commenting or bad syntax in java code, and it was suggested that i take out all the commenting and check for errors in the java code. This i did, i recompiled and reinstalled GMLib after modifying the map.html file. I stripped it of all commenting and parsed it through ie for faults but found none, as expected. But the problem still occurs. Here is a sample of my code to show the map and add the marker : Var newmarker : TMarker; begin newmarker := GMMarker1.Add(); newmarker.Position.Lat := MarkersToPaint[i].Latitude; newmarker.Position.Lng := MarkersToPaint[i].Longitude; newmarker.Visible := True; newmarker.Title := MarkersToPaint[i].Title; GMMap1.RequiredProp.Center.Lat := midlat; GMMap1.RequiredProp.Center.Lng := midlong; GMMap1.RequiredProp.Zoom := 18; GMMarker1.ShowElements; GMMap1.Active := True; Any help in this matter will be greatly appreciated.

    Read the article

  • Refresh RadGridview when Insert,Update and Delete Operation done on Database in WPF

    - by patelriki13
    WPF and C#: Problem: 1. How to Refresh Radgridview when i Insert,update and Delete Record in database anrecord. 2.when i am Insert or Update Record than in radgridview that row is selected. i am useing sql server 2005. i am use to set data source of radgridview like " radgridview1.ItemsSource = ds; " == ds is dataset. i am beginner so if possible than tel me by code it is easy to understand....... can u help me as early as possible .... i give some code which i am useing for update RadGridview con.ConnectionString = @"Data Source=(local);Initial Catalog=DigiDms;Integrated Security=True"; cmd1.Connection = con; con.Open(); cmd1.CommandType = CommandType.StoredProcedure; cmd1.CommandText = "Pro_Insurance_Master_Select"; da1.SelectCommand = cmd1; da1.Fill(ds1); con.Close(); //dataGrid.clear(); //dsGrid.Reset(); //dsGrid = dataGrid.GetData("Pro_Insurance_Master_Select"); //set datasource of gridview gridShowData.ItemsSource = null; gridShowData.ItemsSource = ds1; doing this , when i am delete or update record than folloning error generated... Error: "Object reference not set to an object" when i am doing the "gridShowData.ItemsSource = null;" and when i am doing insert operation than this error is not generated and RadGridview also updated..... so pls help me as early as possible.... i am beginer ........ my email address is [email protected]

    Read the article

  • WCF Ria Services Error : Load operation failed for query 'GetTranslationProgress'

    - by Manoj
    Hello, I am using WCF Ria Services beta in my silverlight application. I have a long running task on the server which keeps writing its status to a database table. I have a "GetTranslationProgress" Ria Service Query method which queries the state to get the status. This query method is called continuously at a regular interval of 5 seconds until a status = Finished or Error is retrieved. In some cases if the task on the server is running for a long duration 2-3 minutes then I receives this error:- Load operation failed for query 'GetTranslationProgress'. The server did not provide a meaningful reply; this might be caused by a contract mismatch, a premature session shutdown or an internal server error. at System.Windows.Ria.OperationBase.Complete(Exception error) at System.Windows.Ria.LoadOperation.Complete(Exception error) at System.Windows.Ria.DomainContext.CompleteLoad(IAsyncResult asyncResult) at System.Windows.Ria.DomainContext.<c_DisplayClass17.b_13(Object ) The error occurs intermittently and I have no idea what could be causing this error. I have checked most of the forums and sites but I have not been able to find out any solution to this issue. Please help.

    Read the article

  • Ajax Asynchronous in IE - Error "The Data Necessary to Complete This Operation is Not Yet Available"

    - by Supernovah
    Hey there. I have a 100% valid Ajax model written in Javascript with a few inputs I use being, Get or Post method, What page to communicate with, What String to send to that page and What element on my own page I might be fiddling with when I receive my response. The problem is that, should I set the request to Asynchronous (Hence Ajax), IE returns the error "The Data Necessary to Complete This Operation is Not Yet Available" in the onreadystatechange event where all I do is check if the readystate is 4 and the status is 200. The error doesn't come up in Firefox or Chrome as I would exepect as the Ajax is Asynchronous. Heres a snippet from the Post method xmlhttp.open("POST", commPage, true); xmlhttp.setRequestHeader("Content-Type","application/x-www-form-urlencoded; charset=UTF-8"); xmlhttp.onreadystatechange = function() { if (xmlhttp.readyState == 4 && xmlhttp.status == 200) { j = xmlhttp.responseText; i.innerHTML = j; } } xmlhttp.send(str); Edit: I should point out that in IE, I'm using the ActiveX Control - Msxml2.XMLHTTP or Microsoft.XMLHTTP or whichever returns true first.

    Read the article

  • Encrypting using RSA via COM Interop = "The requested operation requires delegation to be enabled on

    - by Mr AH
    Hi Guys, So i've got this little static method in a .Net class which takes a string, uses some stored public key and returns the encrypted version of that key. This is basically so some user entered data can be saved an encrypted, then retrieved and decrypted at a later date. Pretty basic stuff and the unit test works fine. However, part of the application is in classic ASP. This then uses some COM visible version of the class to go off and invoke the method on the real class and return the same string to the COM client (classic ASP). I use this kind of stuff all the time, but in this case we have a major problem. As the method is doing something with RSA keys and has to access certain machine information to do so, we get the error: "The requested operation requires delegation to be enabled on the machine. I've searched around a lot, but can't really understand what this means. I assume I am getting this error on the COM but not the UT because the UT runs as me (Administrator) and classic ASP as IWAM. Anyone know what I need to do to enable IWAM to do this? Or indeed if this is the real problem here?

    Read the article

  • Why is TransactionScope operation is not valid?

    - by Cragly
    I have a routine which uses a recursive loop to insert items into a SQL Server 2005 database The first call which initiates the loop is enclosed within a transaction using TransactionScope. When I first call ProcessItem the myItem data gets inserted into the database as expected. However when ProcessItem is called from either ProcessItemLinks or ProcessItemComments I get the following error. “The operation is not valid for the state of the transaction” I am running this in debug with VS 2008 on Windows 7 and have the MSDTC running to enable distributed transactions. The code below isn’t my production code but is set out exactly the same. The AddItemToDatabase is a method on a class I cannot modify and uses a standard ExecuteNonQuery() which creates a connection then closes and disposes once completed. I have looked at other posting on here and the internet and still cannot resolve this issue. Any help would be much appreciated. using (TransactionScope processItem = new TransactionScope()) { foreach (Item myItem in itemsList) { ProcessItem(myItem); } processItem.Complete(); } private void ProcessItem(Item myItem) { AddItemToDatabase(myItem); ProcessItemLinks(myItem); ProcessItemComments(myItem); } private void ProcessItemLinks(Item myItem) { foreach (Item link in myItem.Links) { ProcessItem(link); } } private void ProcessItemComments(Item myItem) { foreach (Item comment in myItem.Comments) { ProcessItem(comment); } } Here is top part of the stack trace. Unfortunatly I cant show the build up to this point as its company sensative information which I can not disclose. Hope this is enough information. at System.Transactions.TransactionState.EnlistPromotableSinglePhase(InternalTransaction tx, IPromotableSinglePhaseNotification promotableSinglePhaseNotification, Transaction atomicTransaction) at System.Transactions.Transaction.EnlistPromotableSinglePhase(IPromotableSinglePhaseNotification promotableSinglePhaseNotification) at System.Data.SqlClient.SqlInternalConnection.EnlistNonNull(Transaction tx) at System.Data.SqlClient.SqlInternalConnection.Enlist(Transaction tx) at System.Data.SqlClient.SqlInternalConnectionTds.Activate(Transaction transaction) at System.Data.ProviderBase.DbConnectionInternal.ActivateConnection(Transaction transaction) at System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) at System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) at System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) at System.Data.SqlClient.SqlConnection.Open()

    Read the article

  • Call long running operation in WSS feature OnActivated Event

    - by dirq
    More specifically - How do I reference SPContext in Web Service with [SoapDocumentMethod(OneWay=true)]? We are creating a feature that needs to run a job when a site is created. The job takes about 4 minutes to complete. So, we made a web service that we can call when the feature is activated. This works but we want it to run asynchronously now. We've found the SoapDocumentMethod's OneWay property and that would work awesomely but the SPContext is now NULL. We have our web services in the _vti_bin virtual directory so it's available in each Windows Sharepoint Services site. I was using the SPContext.Current.Web to get the site and perform the long running operation. I wanted to just fire and forget about it by returning a soap response right away and letting the process run. How can I get the current SPContext? I used to be able to do this in my web service: SPWeb mySite = SPContext.Current.Web; Can I get the same context when I have the [SoapDocumentMethod(OneWay=true)] attribute applied to my web service? Or must I recreate the SPWeb from the url? This is similar to this thread: http://stackoverflow.com/questions/340192/webservice-oneway-and-new-spsitemyurl Update: I've tried these two ways but they didn't work: SPWeb targetSite = SPControl.GetContextWeb(this.Context); SPWeb targetSite2 = SPContext.GetContext(this.Context).Web;

    Read the article

  • edmx - The operation could not be completed - After adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas???

    Read the article

  • Asp.net Crawler Webresponse Operation Timed out.

    - by Leon
    Hi I have built a simple threadpool based web crawler within my web application. Its job is to crawl its own application space and build a Lucene index of every valid web page and their meta content. Here's the problem. When I run the crawler from a debug server instance of Visual Studio Express, and provide the starting instance as the IIS url, it works fine. However, when I do not provide the IIS instance and it takes its own url to start the crawl process(ie. crawling its own domain space), I get hit by operation timed out exception on the Webresponse statement. Could someone please guide me into what I should or should not be doing here? Here is my code for fetching the page. It is executed in the multithreaded environment. private static string GetWebText(string url) { string htmlText = ""; HttpWebRequest request = (HttpWebRequest)HttpWebRequest.Create(url); request.UserAgent = "My Crawler"; using (WebResponse response = request.GetResponse()) { using (Stream stream = response.GetResponseStream()) { using (StreamReader reader = new StreamReader(stream)) { htmlText = reader.ReadToEnd(); } } } return htmlText; } And the following is my stacktrace: at System.Net.HttpWebRequest.GetResponse() at CSharpCrawler.Crawler.GetWebText(String url) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 366 at CSharpCrawler.Crawler.CrawlPage(String url, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 105 at CSharpCrawler.Crawler.CrawlSiteBuildIndex(String hostUrl, String urlToBeginSearchFrom, List1 threadCityList) in c:\myAppDev\myApp\site\App_Code\CrawlerLibs\Crawler.cs:line 89 at crawler_Default.threadedCrawlSiteBuildIndex(Object threadedCrawlerObj) in c:\myAppDev\myApp\site\crawler\Default.aspx.cs:line 108 at System.Threading.QueueUserWorkItemCallback.WaitCallback_Context(Object state) at System.Threading.ExecutionContext.runTryCode(Object userData) at System.Runtime.CompilerServices.RuntimeHelpers.ExecuteCodeWithGuaranteedCleanup(TryCode code, CleanupCode backoutCode, Object userData) at System.Threading.ExecutionContext.RunInternal(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state, Boolean ignoreSyncCtx) at System.Threading.QueueUserWorkItemCallback.System.Threading.IThreadPoolWorkItem.ExecuteWorkItem() at System.Threading.ThreadPoolWorkQueue.Dispatch() at System.Threading._ThreadPoolWaitCallback.PerformWaitCallback() Thanks and cheers, Leon.

    Read the article

  • edmx - The operation could not be completed - When adding Inheritance

    - by vdh_ant
    Hey guys I have an edmx model which I have draged 2 tables onto - One called 'File' and the other 'ApplicaitonFile'. These two tables have a 1 to 1 relationship in the database. If I stop here everything works fine. But in my model, I want 'ApplicaitonFile' to inherit from 'File'. So I delete the 1 to 1 relationship then configure 'ApplicaitonFile' from 'File' and then remove the FileId from 'ApplicaitonFile' which was the primary key. (Note I am following the instructions from here). If I leave the model open at this point everything is fine, but as soon as I close it, if I try and reopen it again I get the following error "The operation could not be completed". I have been searching for a solution and found this - http://stackoverflow.com/questions/944050/entity-model-does-not-load but as far as I can tell I don't have a duplicate InheritanceConnectors (although I don't know exactly what I'm looking for but I can't see anything out of the ordinary - like 2 connectors with the same name) and the relationship I originally have is a 1 to 1 not a 1 to 0..1 Any ideas??? this is driving me crazy...

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Invalid Pointer Operation, advice requested with debugging

    - by Xanyx
    I appear to have created code that is trashing memory. Having never had such problems before, i am now settign an Invalid Pointer Operation. In the following the value of the const string sFilename gets trashed after my call to PromptForXYZPropertiesSettings. // Allow the user to quickly display the properties of XYZ without needing to display the full Editor function PromptForXYZProperties(const sFilename:string; var AXYZProperties: TXYZProperties): boolean; var PropEditor: TdlgEditor; begin PropEditor:= TdlgEditor.create(nil); try PropEditor.LoadFromFile(sFilename); Other Details: Delphi 2007, Windows 7 64 bit, but can reproduce when testing EXE on XP REMOVING CONST STOPS PROBLEM FROM EXHIBITING (but presumably the problem is thus just lurking) PropEditor.PromptForXYZPropertiesSettings creates and shows a form. If I disable the ShowModal call then the memory is not trashed. Even though i have REMOVED ALL CONTROLS AND CODE from the form So I would like some advice on how to debug the issue. I was thinking perhaps watching the memory pointer where the sFilename var exists to see where it gets trashed, but not sure how i would do that (obviously needs to be done within the app so is owned memory). Thanks

    Read the article

  • question about siftdown operation on heap

    - by davit-datuashvili
    i have following pseudo code which execute siftdown operation on heap array suppose is x void siftdown(int n) pre heap(2,n) && n>=0 post heap(1,n) i=1; loop /*invariant heap(1,n) except perhaps between i and it's (0,1,or 2) children*/ c=2*i; if (c>n) break; // c is left child of i if (c+1)<=n /* c+1 is rigth child of i if (x[c+1]<x[c]) c++ /* c is lesser child of i if (x[i]<=x[c]) break; swap(c,i) i=c; i have wrote following code is it correct? public class siftdown{ public static void main(String[]args){ int c; int n=9; int a[]=new int[]{19,100,17,2,7,3,36,1,25}; int i=1; while (i<n){ c=2*i; if (c>n) break; //c is the left child of i if (c+1<=n) //c+1 ir rigth child of i if (a[c+1]<a[c]) c++; if (a[i]<=a[c]) break; int t=a[c]; a[c]=a[i]; a[i]=t; i=c; } for (int j=0;j<a.length;j++){ System.out.println(a[j]); } } } // result is 19 2 17 1 7 3 36 100 25

    Read the article

  • How can solve "Cross-thread operation not valid"?

    - by Phsika
    i try to start multi Thread but i can not it returns to me error: Cross-thread operation not valid: 'listBox1' thread was created to control outside access from another thread was. MyCodes: public DataTable dTable; public DataTable dtRowsCount; Thread t1; ThreadStart ts1; void ExcelToSql() { // SelectDataFromExcel(); ts1 = new ThreadStart(SelectDataFromExcel); t1 = new Thread(ts1); t1.Start(); } void SelectDataFromExcel() { string connectionString = @"Provider=Microsoft.ACE.OLEDB.12.0;Data Source=C:\Source\Addresses.xlsx;Extended Properties=""Excel 12.0;HDR=YES;"""; OleDbConnection excelConnection = new OleDbConnection(connectionString); string[] Sheets = new string[] { "Sayfa1"}; excelConnection.Open(); // This code will open excel file. OleDbCommand dbCommand; OleDbDataAdapter dataAdapter; // progressBar1.Minimum = 1; foreach (var sheet in Sheets) { dbCommand = new OleDbCommand("select * From[" + sheet + "$]", excelConnection); //progressBar1.Maximum = CountRowsExcel(sheet).Rows.Count; // progressBar2.Value = i + 1; System.Threading.Thread.Sleep(1000); **listBox1.Items.Add("Tablo ismi: "+sheet.ToUpper()+"Satir Adeti: "+CountRowsExcel(sheet).Rows.Count.ToString()+" ");** dataAdapter = new OleDbDataAdapter(dbCommand); dTable = new DataTable(); dataAdapter.Fill(dTable); dTable.TableName = sheet.ToUpper(); dTable.Dispose(); dataAdapter.Dispose(); dbCommand.Dispose(); ArrangedDataList(dTable); FillSqlTable(dTable, dTable.TableName); } excelConnection.Close(); excelConnection.Dispose(); }

    Read the article

  • iPhone UIWebView width does not fit after zooming operation + UIInterfaceOrientation change

    - by choonkeat
    I created a bare bones iPhone app with a UIWebView (Scales Page to Fit = YES, shouldAutorotateToInterfaceOrientation = YES) and loaded a webpage, e.g. http://stackoverflow.com/ Rotating the device shows that UIWebView is auto-resized to fit the width. Good. Incorrect: Zoom into the page and zoom out. Now rotating the device shows UIWebView in a weird width in one of the orientation (if u zoom in landscape, the portrait width is weird, vice versa). This behavior is fixed only when you navigate to another page. Correct: Load the same URL in Mobile Safari. Rotating works & the width fits regardless of the zooming exercise. Is this a UIWebView bug (probably not)? Or is there something that needs to be done to make things "just work" like in Mobile Safari?

    Read the article

  • Is it possible to either abort or interrupt and later continue a lvconvert -m1 operation?

    - by SLi
    I have run the command lvconvert -m1 rootvg/newroot /dev/sdb to convert a linear logical volume to a mirrored one. The operation has not yet finished; I interrupted the command with ctrl-c at around 10% mark, but the operation seems to be running in the background anyway. Is it possible to either 1) Abort the lvconvert operation and revert to the state before it? (This would be my preferred option) 2) To safely interrupt the operation and resume it later?

    Read the article

  • Potential issues with multiple home pages

    - by Maxim Zaslavsky
    I have a site where I want to have two different home pages: a general description page for anonymous users, and a dashboard page for logged-in users. I am debating between two implementations: Both pages live at / The page for anonymous users is located at / and the dashboard is at /dashboard, with automatic redirection between them based on whether a given user is logged in (e.g., if you're logged in and navigate to /, you are redirected to /dashboard. Is it cleaner to have both pages use the same URL or separate URLs? Also, I imagine that choices for that question will affect the following: Caching: the anonymous page would be completely cached, while the logged-in page would not be cached at all (except for static resources). This could lead to issues with server caching, request speed, and UX (such as if one version of the page is cached in a user's browser when the other version should be displayed, instead). SEO: how would search engines react to such canonical URLs? Load time (due to redirects or to the server having to always reevaluate which page to display)

    Read the article

  • Very High CPU usage (100%) from just browsing the Web

    - by cole
    I tested on Firefox and Chromioum. Im at 100% while loading pages which causes them to load slow and when I dont have a application running Im at 40% CPU (At least) Everything is slow basically. Im also already on Ubuntu Classic so im not using Unity. Should I go to 10.04? is that more stable? On windows this wasnt an issue. I have a Dual Boot with XP and a 2.4Ghz Intel Celeron with 768MB RAM and an Nvidia 6200 Graphics card. I heard 10.04 was the most stable. any suggestions?

    Read the article

  • Clear OS always showing "Operation too slow. Less than 1 bytes/sec"

    - by Blue Gene
    Have been trying to install clear os addon but nothing is working as i am facing this error on every mirror in the .repo file. Yum install squid http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on http://mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-houston.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dallas.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'O*peration too slow. Less than 1 bytes/sec transfered the last 30 seconds'*) Trying other mirror. mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror2-dc.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror1.timburgess.net/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: [Errno 12] Timeout on mirror3-toronto.clearsdn.com/clearos/core/6/x86_64/repodata/primary.sqlite.bz2: (28, 'Operation too slow. Less than 1 bytes/sec transfered the last 30 seconds') Trying other mirror. Error: failure: repodata/primary.sqlite.bz2 from clearos-core: [Errno 256] No more mirrors to try. How can i fix this.i am able to access repo through web,and it seems nothing wrong with the repo.Where can be the problem. Tried yum clean all but it also didnt help. Is there a way to fix it as i am not able to install any package in it.

    Read the article

< Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >