Search Results

Search found 5439 results on 218 pages for 'madhup 25'.

Page 32/218 | < Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >

  • Speed up SQL Server queries with PREFETCH

    - by Akshay Deep Lamba
    Problem The SAN data volume has a throughput capacity of 400MB/sec; however my query is still running slow and it is waiting on I/O (PAGEIOLATCH_SH). Windows Performance Monitor shows data volume speed of 4MB/sec. Where is the problem and how can I find the problem? Solution This is another summary of a great article published by R. Meyyappan at www.sqlworkshops.com.  In my opinion, this is the first article that highlights and explains with working examples how PREFETCH determines the performance of a Nested Loop join.  First of all, I just want to recall that Prefetch is a mechanism with which SQL Server can fire up many I/O requests in parallel for a Nested Loop join. When SQL Server executes a Nested Loop join, it may or may not enable Prefetch accordingly to the number of rows in the outer table. If the number of rows in the outer table is greater than 25 then SQL will enable and use Prefetch to speed up query performance, but it will not if it is less than 25 rows. In this section we are going to see different scenarios where prefetch is automatically enabled or disabled. These examples only use two tables RegionalOrder and Orders.  If you want to create the sample tables and sample data, please visit this site www.sqlworkshops.com. The breakdown of the data in the RegionalOrders table is shown below and the Orders table contains about 6 million rows. In this first example, I am creating a stored procedure against two tables and then execute the stored procedure.  Before running the stored proceudre, I am going to include the actual execution plan. --Example provided by www.sqlworkshops.com --Create procedure that pulls orders based on City --Do not forget to include the actual execution plan CREATE PROC RegionalOrdersProc @City CHAR(20) AS BEGIN DECLARE @OrderID INT, @OrderDetails CHAR(200) SELECT @OrderID = o.OrderID, @OrderDetails = o.OrderDetails       FROM RegionalOrders ao INNER JOIN Orders o ON (o.OrderID = ao.OrderID)       WHERE City = @City END GO SET STATISTICS time ON GO --Example provided by www.sqlworkshops.com --Execute the procedure with parameter SmallCity1 EXEC RegionalOrdersProc 'SmallCity1' GO After running the stored procedure, if we right click on the Clustered Index Scan and click Properties we can see the Estimated Numbers of Rows is 24.    If we right click on Nested Loops and click Properties we do not see Prefetch, because it is disabled. This behavior was expected, because the number of rows containing the value ‘SmallCity1’ in the outer table is less than 25.   Now, if I run the same procedure with parameter ‘BigCity’ will Prefetch be enabled? --Example provided by www.sqlworkshops.com --Execute the procedure with parameter BigCity --We are using cached plan EXEC RegionalOrdersProc 'BigCity' GO As we can see from the below screenshot, prefetch is not enabled and the query takes around 7 seconds to execute. This is because the query used the cached plan from ‘SmallCity1’ that had prefetch disabled. Please note that even if we have 999 rows for ‘BigCity’ the Estimated Numbers of Rows is still 24.   Finally, let’s clear the procedure cache to trigger a new optimization and execute the procedure again. DBCC freeproccache GO EXEC RegionalOrdersProc 'BigCity' GO This time, our procedure runs under a second, Prefetch is enabled and the Estimated Number of Rows is 999.   The RegionalOrdersProc can be optimized by using the below example where we are using an optimizer hint. I have also shown some other hints that could be used as well. --Example provided by www.sqlworkshops.com --You can fix the issue by using any of the following --hints --Create procedure that pulls orders based on City DROP PROC RegionalOrdersProc GO CREATE PROC RegionalOrdersProc @City CHAR(20) AS BEGIN DECLARE @OrderID INT, @OrderDetails CHAR(200) SELECT @OrderID = o.OrderID, @OrderDetails = o.OrderDetails       FROM RegionalOrders ao INNER JOIN Orders o ON (o.OrderID = ao.OrderID)       WHERE City = @City       --Hinting optimizer to use SmallCity2 for estimation       OPTION (optimize FOR (@City = 'SmallCity2'))       --Hinting optimizer to estimate for the currnet parameters       --option (recompile)       --Hinting optimize not to use histogram rather       --density for estimation (average of all 3 cities)       --option (optimize for (@City UNKNOWN))       --option (optimize for UNKNOWN) END GO Conclusion, this tip was mainly aimed at illustrating how Prefetch can speed up query execution and how the different number of rows can trigger this.

    Read the article

  • The enterprise vendor con - connecting SSD's using SATA 2 (3Gbits) thus limiting there performance

    - by tonyrogerson
    When comparing SSD against Hard drive performance it really makes me cross when folk think comparing an array of SSD running on 3GBits/sec to hard drives running on 6GBits/second is somehow valid. In a paper from DELL (http://www.dell.com/downloads/global/products/pvaul/en/PowerEdge-PowerVaultH800-CacheCade-final.pdf) on increasing database performance using the DELL PERC H800 with Solid State Drives they compare four SSD drives connected at 3Gbits/sec against ten 10Krpm drives connected at 6Gbits [Tony slaps forehead while shouting DOH!]. It is true in the case of hard drives it probably doesn’t make much difference 3Gbit or 6Gbit because SAS and SATA are both end to end protocols rather than shared bus architecture like SCSI, so the hard drive doesn’t share bandwidth and probably can’t get near the 600MiBytes/second throughput that 6Gbit gives unless you are doing contiguous reads, in my own tests on a single 15Krpm SAS disk using IOMeter (8 worker threads, queue depth of 16 with a stripe size of 64KiB, an 8KiB transfer size on a drive formatted with an allocation size of 8KiB for a 100% sequential read test) I only get 347MiBytes per second sustained throughput at an average latency of 2.87ms per IO equating to 44.5K IOps, ok, if that was 3GBits it would be less – around 280MiBytes per second, oh, but wait a minute [...fingers tap desk] You’ll struggle to find in the commodity space an SSD that doesn’t have the SATA 3 (6GBits) interface, SSD’s are fast not only low latency and high IOps but they also offer a very large sustained transfer rate, consider the OCZ Agility 3 it so happens that in my masters dissertation I did the same test but on a difference box, I got 374MiBytes per second at an average latency of 2.67ms per IO equating to 47.9K IOps – cost of an 240GB Agility 3 is £174.24 (http://www.scan.co.uk/products/240gb-ocz-agility-3-ssd-25-sata-6gb-s-sandforce-2281-read-525mb-s-write-500mb-s-85k-iops), but that same drive set in a box connected with SATA 2 (3Gbits) would only yield around 280MiBytes per second thus losing almost 100MiBytes per second throughput and a ton of IOps too. So why the hell are “enterprise” vendors still only connecting SSD’s at 3GBits? Well, my conspiracy states that they have no interest in you moving to SSD because they’ll lose so much money, the argument that they use SATA 2 doesn’t wash, SATA 3 has been out for some time now and all the commodity stuff you buy uses it now. Consider the cost, not in terms of price per GB but price per IOps, SSD absolutely thrash Hard Drives on that, it was true that the opposite was also true that Hard Drives thrashed SSD’s on price per GB, but is that true now, I’m not so sure – a 300GByte 2.5” 15Krpm SAS drive costs £329.76 ex VAT (http://www.scan.co.uk/products/300gb-seagate-st9300653ss-savvio-15k3-25-hdd-sas-6gb-s-15000rpm-64mb-cache-27ms) which equates to £1.09 per GB compared to a 480GB OCZ Agility 3 costing £422.10 ex VAT (http://www.scan.co.uk/products/480gb-ocz-agility-3-ssd-25-sata-6gb-s-sandforce-2281-read-525mb-s-write-410mb-s-30k-iops) which equates to £0.88 per GB. Ok, I compared an “enterprise” hard drive with a “commodity” SSD, ok, so things get a little more complicated here, most “enterprise” SSD’s are SLC and most commodity are MLC, SLC gives more performance and wear, I’ll talk about that another day. For now though, don’t get sucked in by vendor marketing, SATA 2 (3Gbit) just doesn’t cut it, SSD need 6Gbit to breath and even that SSD’s are pushing. Alas, SSD’s are connected using SATA so all the controllers I’ve seen thus far from HP and DELL only do SATA 2 – deliberate? Well, I’ll let you decide on that one.

    Read the article

  • hall.dll errors

    - by Robert Elliott
    I am getting frequent BSoDs, mostly with hall.dll errors. I have Dell Inspiron laptop running Windows 7 SP1. The following file, werfault, is shown below. Can anyone help me work out what is wrong? Version=1 EventType=BlueScreen EventTime=129987824768810026 ReportType=4 Consent=1 ReportIdentifier=1c3e1c58-3b30-11e2-9074-002219f61870 IntegratorReportIdentifier=113012-32557-01 Response.type=4 DynamicSig[1].Name=OS Version DynamicSig[1].Value=6.1.7601.2.1.0.768.3 DynamicSig[2].Name=Locale ID DynamicSig[2].Value=2057 UI[2]=C:\Windows\system32\wer.dll UI[3]=Windows has recovered from an unexpected shutdown UI[4]=Windows can check online for a solution to the problem. UI[5]=&Check for solution UI[6]=&Check later UI[7]=Cancel UI[8]=Windows has recovered from an unexpected shutdown UI[9]=A problem caused Windows to stop working correctly. Windows will notify you if a solution is available. UI[10]=Close Sec[0].Key=BCCode Sec[0].Value=a Sec[1].Key=BCP1 Sec[1].Value=0000000000000000 Sec[2].Key=BCP2 Sec[2].Value=0000000000000002 Sec[3].Key=BCP3 Sec[3].Value=0000000000000000 Sec[4].Key=BCP4 Sec[4].Value=FFFFF80002C0E477 Sec[5].Key=OS Version Sec[5].Value=6_1_7601 Sec[6].Key=Service Pack Sec[6].Value=1_0 Sec[7].Key=Product Sec[7].Value=768_1 File[0].CabName=113012-32557-01.dmp File[0].Path=113012-32557-01.dmp File[0].Flags=589826 File[0].Type=2 File[0].Original.Path=C:\Windows\Minidump\113012-32557-01.dmp File[1].CabName=sysdata.xml File[1].Path=WER-75941-0.sysdata.xml File[1].Flags=589826 File[1].Type=5 File[1].Original.Path=C:\Users\Robert\AppData\Local\Temp\WER-75941-0.sysdata.xml File[2].CabName=Report.cab File[2].Path=Report.cab File[2].Flags=196608 File[2].Type=7 File[2].Original.Path=Report.cab FriendlyEventName=Shut down unexpectedly ConsentKey=BlueScreen AppName=Windows AppPath=C:\Windows\System32\WerFault.exe *********From the minidump file**** RAX = fffff88002f22150 RBX = fffffa80074141f0 RCX = 000000000000000a RDX = 0000000000000000 RSI = fffffa8007278180 RDI = 0000000000000001 R9 = 0000000000000000 R10 = fffff80002c0e477 R11 = 0000000000000000 R12 = fffffa800523e7a0 R13 = 0000000000001000 R14 = 0000000000000028 R15 = fffffa80074141f0 RBP = fffff88002f22210 RIP = fffff80002cd3fc0 RSP = fffff88002f22048 SS = 0000 GS = 002b FS = 0053 ES = 002b DS = 002b CS = 0010 Flags = 00200286 fffff800`02e99ac0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99ad0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99ae0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99af0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b10 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b20 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b30 00 00 00 00 00 00 00 00 00 00 00 00 04 00 00 00 ................ fffff800`02e99b40 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b50 00 00 00 00 00 00 00 00 00 00 00 00 ............ fffff800`02e81928 00 00 00 00 .... fffff800`02e81924 00 00 00 00 .... fffff800`02e0a880 37 36 30 31 2E 31 37 39 34 34 2E 61 6D 64 36 34 7601.17944.amd64 fffff800`02e0a890 66 72 65 2E 77 69 6E 37 73 70 31 5F 67 64 72 2E fre.win7sp1_gdr. fffff800`02e0a8a0 31 32 30 38 33 30 2D 30 33 33 33 00 00 00 00 00 120830-0333..... fffff800`02e0a8b0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8c0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8d0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8e0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8f0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a900 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a910 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a920 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a930 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a940 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a950 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a960 35 36 65 38 62 61 31 33 2D 37 30 32 39 2D 34 37 56e8ba13-7029-47 fffff800`02e0a970 32 38 2D 61 35 30 36 2D 32 64 64 62 34 61 30 63 28-a506-2ddb4a0c fffff800`02c0e000 C5 0F 85 79 02 00 00 8B 9C 24 90 00 00 00 E9 A5 ...y.....$...... fffff800`02c0e010 00 00 00 44 2B C3 45 33 C9 E8 5E 14 00 00 49 3B ...D+.E3..^...I; fffff800`02c0e020 C5 74 2B 44 8B 8C 24 90 00 00 00 48 8B C8 41 8D .t+D..$....H..A. fffff800`02c0e030 51 FF 41 3B D5 76 0D 44 8B C2 49 83 E8 01 48 8B Q.A;.v.D..I...H. fffff800`02c0e040 49 08 75 F6 48 89 79 08 41 03 D9 48 8B F8 3B DD I.u.H.y.A..H..;. fffff800`02c0e050 75 08 48 8B C7 E9 26 02 00 00 48 8B 96 98 00 00 u.H...&...H..... fffff800`02c0e060 00 48 8D 84 24 90 00 00 00 44 8B C5 48 89 44 24 .H..$....D..H.D$ fffff800`02c0e070 28 44 2B C3 45 33 C9 48 8B CE 44 88 6C 24 20 E8 (D+.E3.H..D.l$ . fffff800`02c0e080 CC 14 00 00 49 3B C5 74 2B 44 8B 8C 24 90 00 00 ....I;.t+D..$... fffff800`02c0e090 00 48 8B C8 41 8D 51 FF 41 3B D5 76 0D 44 8B C2 .H..A.Q.A;.v.D.. fffff800`02c0e0a0 49 83 E8 01 48 8B 49 08 75 F6 48 89 79 08 41 03 I...H.I.u.H.y.A. fffff800`02c0e0b0 D9 48 8B F8 3B DD 74 9A 44 38 AE 28 01 00 00 0F .H..;.t.D8.(.... fffff800`02c0e0c0 85 DF 00 00 00 48 8D 44 24 30 4C 8D 8C 24 A0 00 .....H.D$0L..$.. fffff800`02c0e0d0 00 00 4C 8D 84 24 A8 00 00 00 8B D5 48 8B CE 48 ..L..$......H..H fffff800`02c0e0e0 89 44 24 20 E8 F7 1F 00 00 8B F8 89 84 24 90 00 .D$ .........$.. fffff800`02c0e0f0 00 00 41 3B C5 0F 84 83 01 00 00 4C 8B A4 24 A8 ..A;.......L..$. fffff800`02c0e100 00 00 00 44 8B 84 24 A0 00 00 00 48 8B 8E 98 00 ...D..$....H.... fffff800`02c0e110 00 00 49 8B D4 44 8B C8 E8 DB 1B 00 00 49 3B C5 ..I..D.......I;. fffff800`02c0e120 74 35 48 8B 96 98 00 00 00 48 8D 84 24 90 00 00 t5H......H..$... fffff800`02c0e130 00 41 B1 01 48 89 44 24 28 44 8B C5 48 8B CE 44 .A..H.D$(D..H..D fffff800`02c0e140 88 6C 24 20 E8 43 12 00 00 49 3B C5 0F 84 2C 01 .l$ .C...I;...,. fffff800`02c0e150 00 00 E9 29 01 00 00 48 8B 5C 24 30 49 3B DD 74 ...)...H.\$0I;.t fffff800`02c0e160 2A 4D 3B E5 74 0C 48 8B D3 49 8B CC FF 15 AE CE *M;.t.H..I...... fffff800`02c0e170 01 00 48 8B CB FF 15 95 CF 01 00 33 D2 48 8B CB ..H........3.H.. fffff800`02c0e180 FF 15 AA CE 01 00 E9 F3 00 00 00 C1 E7 0C 41 B8 ..............A. fffff800`02c0e190 01 00 00 00 49 8B CC 8B D7 FF 15 99 CE 01 00 E9 ....I........... fffff800`02c0e1a0 DA 00 00 00 2B EB 33 C9 41 B8 48 61 6C 20 8B D5 ....+.3.A.Hal .. fffff800`02c0e1b0 44 8B FD 48 C1 E2 03 FF 15 33 D4 01 00 4C 8B F0 D..H.....3...L.. fffff800`02c0e1c0 49 3B C5 0F 84 8F 00 00 00 45 8B E5 41 3B ED 76 I;.......E..A;.v fffff800`02c0e1d0 3F 4C 8B E8 BA 00 10 00 00 B9 04 00 00 00 41 B8 ?L............A. fffff800`02c0e1e0 48 61 6C 20 FF 15 06 D4 01 00 49 89 45 00 48 85 Hal ......I.E.H. fffff800`02c0e1f0 C0 74 39 48 8B C8 FF 15 BC CE 01 00 48 C1 E8 20 .t9H........H.. fffff800`02c0e200 85 C0 75 28 41 FF C4 49 83 C5 08 44 3B E5 72 C4 ..u(A..I...D;.r. fffff800`02c0e210 48 8B 8E 98 00 00 00 44 8B C5 BA 01 00 00 00 E8 H......D........ fffff800`02c0e220 58 19 00 00 4C 8B E8 48 85 C0 75 6C 45 33 ED 45 X...L..H..ulE3.E fffff800`02c0e230 3B E5 76 19 49 8B EE 48 8B 4D 00 33 D2 FF 15 ED ;.v.I..H.M.3.... fffff800`02c0e240 CD 01 00 48 83 C5 08 49 83 EC 01 75 EA 33 D2 49 ...H...I...u.3.I fffff800`02c0e250 8B CE FF 15 D8 CD 01 00 41 3B DD 76 21 8B EB 48 ........A;.v!..H fffff800`02c0e260 8B 96 98 00 00 00 48 8B 5F 08 4C 8B C7 48 8B CE ......H._.L..H.. fffff800`02c0e270 E8 2B 15 00 00 48 83 ED 01 48 8B FB 75 E1 33 C0 .+...H...H..u.3. fffff800`02c0e280 48 8B 9C 24 98 00 00 00 48 83 C4 50 41 5F 41 5E H..$....H..PA_A^ fffff800`02c0e290 41 5D 41 5C 5F 5E 5D C3 8D 4D FF 85 C9 74 0C 8B A]A\_^]..M...t.. fffff800`02c0e2a0 D1 48 83 EA 01 48 8B 40 08 75 F6 48 89 78 08 49 [email protected] fffff800`02c0e2b0 8B FD 85 ED 74 29 49 8B DE 48 8B 0B FF 15 F6 CD ....t)I..H...... fffff800`02c0e2c0 01 00 41 89 45 00 48 8B 03 48 83 C3 08 48 83 C8 ..A.E.H..H...H.. fffff800`02c0e2d0 0F 49 83 EF 01 49 89 45 10 4D 8B 6D 08 75 DA 48 .I...I.E.M.m.u.H fffff800`02c0e2e0 8B 8E 98 00 00 00 48 8D 54 24 38 48 83 C1 78 FF ......H.T$8H..x. fffff800`02c0e2f0 15 83 CD 01 00 4C 8B 9E 98 00 00 00 48 8D 4C 24 .....L......H.L$ fffff800`02c0e300 38 41 01 AB D0 00 00 00 FF 15 3A CD 01 00 33 D2 8A........:...3. fffff800`02c0e310 49 8B CE FF 15 17 CD 01 00 E9 34 FD FF FF 90 90 I.........4..... fffff800`02c0e320 90 90 90 90 45 85 C0 74 43 48 89 5C 24 08 48 89 ....E..tCH.\$.H. fffff800`02c0e330 74 24 10 57 48 83 EC 20 48 8B F1 41 8B F8 48 8B t$.WH.. H..A..H. fffff800`02c0e340 5A 08 4C 8B C2 48 8B 96 98 00 00 00 48 8B CE E8 Z.L..H......H... fffff800`02c0e350 4C 14 00 00 48 83 EF 01 48 8B D3 75 E1 48 8B 5C L...H...H..u.H.\ fffff800`02c0e360 24 30 48 8B 74 24 38 48 83 C4 20 5F C3 90 90 90 $0H.t$8H.. _.... fffff800`02c0e370 90 90 90 90 48 8B C4 48 89 58 08 48 89 68 10 48 ....H..H.X.H.h.H fffff800`02c0e380 89 70 18 48 89 78 20 41 54 41 55 4C 8B D9 4D 8B .p.H.x ATAUL..M. fffff800`02c0e390 E0 48 8B F2 B9 FF 0F 00 00 4D 85 DB 75 08 4C 8B .H.......M..u.L. fffff800`02c0e3a0 D1 40 32 FF EB 12 4D 8B 93 88 00 00 00 41 8A BB [email protected].. fffff800`02c0e3b0 91 00 00 00 49 C1 EA 0C 44 8B 44 24 38 41 8B C1 ....I...D.D$8A.. fffff800`02c0e3c0 4C 2B 4E 20 23 C1 49 C1 E9 0C 41 BD 00 10 00 00 L+N #.I...A..... fffff800`02c0e3d0 41 8B D5 41 8B E9 2B D0 8B CA 4C 39 54 EE 30 76 A..A..+...L9T.0v fffff800`02c0e3e0 04 33 C9 EB 4F 41 3B D0 73 43 4C 8D 4C EE 38 4D .3..OA;.sCL.L.8M fffff800`02c0e3f0 39 11 77 39 49 8B 59 F8 48 8D 43 01 49 3B 01 75 9.w9I.Y.H.C.I;.u fffff800`02c0e400 2C 48 8B C3 49 33 01 48 A9 00 00 F0 FF 75 1E 40 ,H..I3.H.....u.@ fffff800`02c0e410 80 FF 01 74 0C 49 33 19 48 F7 C3 F0 FF FF FF 75 ...t.I3.H......u fffff800`02c0e420 0C 41 03 CD 49 83 C1 08 41 3B C8 72 C2 41 3B C8 .A..I...A;.r.A;. fffff800`02c0e430 41 0F 47 C8 4D 85 DB 0F 84 92 00 00 00 41 80 BB A.G.M........A.. fffff800`02c0e440 28 01 00 00 00 0F 84 84 00 00 00 4C 39 54 EE 30 (..........L9T.0 fffff800`02c0e450 76 7D 8B CA 48 8D 44 EE 38 41 3B D0 73 11 4C 39 v}..H.D.8A;.s.L9 fffff800`02c0e460 10 76 0C 41 03 CD 48 83 C0 08 41 3B C8 72 EF 49 .v.A..H...A;.r.I fffff800`02c0e470 8B 44 24 18 41 3B C8 44 8B 08 4C 8B 50 08 41 0F .D$.A;.D..L.P.A. fffff800`02c0e480 47 C8 41 C1 E9 0C EB 3A 45 8B 02 41 8D 41 01 41 G.A....:E..A.A.A fffff800`02c0e490 C1 E8 0C 44 3B C0 75 2E 41 8B C0 41 33 C1 A9 00 ...D;.u.A..A3... fffff800`02c0e4a0 00 F0 FF 75 21 40 80 FF 01 74 0D 41 8B C0 41 33 [email protected] fffff800`02c0e4b0 C1 A9 F0 FF FF FF 75 0E 4D 8B 52 08 45 8B C8 41 ......u.M.R.E..A fffff800`02c0e4c0 03 D5 3B D1 72 C2 3B D1 0F 47 D1 8B C2 EB 02 8B ..;.r.;..G...... fffff800`02c0e4d0 C1 48 8B 5C 24 18 48 8B 6C 24 20 48 8B 74 24 28 .H.\$.H.l$ H.t$( fffff800`02c0e4e0 48 8B 7C 24 30 41 5D 41 5C C3 90 90 90 90 90 90 H.|$0A]A\....... fffff800`02c0e4f0 48 89 5C 24 08 48 89 6C 24 10 48 89 74 24 18 57 H.\$.H.l$.H.t$.W fffff800`02c0e500 41 54 41 55 48 83 EC 30 48 8B 5C 24 70 4D 8B E1 ATAUH..0H.\$pM.. fffff800`02c0e510 49 8B F0 8B 03 4C 8B EA 48 8B E9 89 44 24 20 E8 I....L..H...D$ . fffff800`02c0e520 50 FE FF FF 49 8B CC 89 03 49 2B 4D 20 8B F8 48 P...I....I+M ..H fffff800`02c0e530 C1 E9 0C 8B C9 49 8B 54 CD 30 49 8B CC 48 C1 E2 .....I.T.0I..H.. fffff800`02c0e540 0C 81 E1 FF 0F 00 00 48 03 D1 48 85 F6 74 72 48 .......H..H..trH fffff800`02c0e550 39 95 88 00 00 00 73 69 4C 8B 4E 18 48 8B 84 24 9.....siL.N.H..$ fffff800`02c0e560 80 00 00 00 41 8B DC 41 8B 09 81 E3 FF 0F 00 00 ....A..A........ fffff800`02c0e570 03 CB 80 7C 24 78 01 48 89 08 75 17 4D 8B C4 49 ...|$x.H..u.M..I fffff800`02c0e580 8B D5 48 8B CD C6 44 24 28 01 89 7C 24 20 E8 C5 ..H...D$(..|$ .. fffff800`02c0e590 06 00 00 8B C7 C1 EF 0C 25 FF 0F 00 00 8D 8C 18 ........%....... fffff800`02c0e5a0 FF 0F 00 00 48 8B 46 18 C1 E9 0C 03 CF 74 0C 8B ....H.F......t.. fffff800`02c0e5b0 D1 48 83 EA 01 48 8B 40 08 75 F6 48 89 46 18 EB [email protected].. fffff800`02c0e5c0 0B 48 8B 84 24 80 00 00 00 48 89 10 48 8B 5C 24 .H..$....H..H.\$ fffff800`02c0e5d0 50 48 8B 6C 24 58 48 8B 74 24 60 48 83 C4 30 41 PH.l$XH.t$`H..0A fffff800`02c0e5e0 5D 41 5C 5F C3 90 90 90 90 90 90 90 4D 85 C0 0F ]A\_........M... fffff800`02c0e5f0 84 09 01 00 00 48 8B C4 48 89 58 08 48 89 68 10 .....H..H.X.H.h. fffff800`02c0e600 48 89 70 18 48 89 78 20 41 54 41 55 41 56 48 83 H.p.H.x ATAUAVH. fffff800`02c0e610 EC 30 44 8A 64 24 78 49 8B D8 49 8B F1 4C 8B EA .0D.d$xI..I..L.. fffff800`02c0e620 4C 8B F1 49 89 58 18 41 80 FC 01 0F 84 AF 00 00 L..I.X.A........ fffff800`02c0e630 00 8B 7C 24 70 85 FF 0F 84 9F 00 00 00 4C 8B CE ..|$p........L.. fffff800`02c0e640 4C 8B C3 49 8B D5 49 8B CE 89 7C 24 20 E8 22 FD L..I..I...|$ .". fffff800`02c0e650 FF FF 48 8B CE 49 2B 4D 20 8B E8 48 C1 E9 0C 8B ..H..I+M ..H.... fffff800`02c0e660 C9 49 8B 54 CD 30 48 8B CE 48 C1 E2 0C 81 E1 FF .I.T.0H..H...... fffff800`02c0e670 0F 00 00 48 03 D1 49 39 96 88 00 00 00 73 52 4C ...H..I9.....sRL fffff800`02c0e680 8B 4B 18 4C 8B C6 49 8B D5 49 8B CE 44 88 64 24 .K.L..I..I..D.d$ fffff800`02c0e690 28 89 6C 24 20 E8 BE 05 00 00 8B C5 44 8B DE 25 (.l$ .......D..% fffff800`02c0e6a0 FF 0F 00 00 41 81 E3 FF 0F 00 00 41 8D 8C 03 FF ....A......A.... fffff800`02c0e6b0 0F 00 00 8B C5 C1 E8 0C C1 E9 0C 03 C8 48 8B 43 .............H.C fffff800`02c0e6c0 18 74 0A 48 83 E9 01 48 8B 40 08 75 F6 48 89 43 [email protected] fffff800`02c0e6d0 18 48 03 F5 2B FD 0F 85 61 FF FF FF 48 89 5B 18 .H..+...a...H.[. fffff800`02c0e6e0 48 8B 5C 24 50 48 8B 6C 24 58 48 8B 74 24 60 48 H.\$PH.l$XH.t$`H fffff800`02c0e6f0 8B 7C 24 68 48 83 C4 30 41 5E 41 5D 41 5C C3 90 .|$hH..0A^A]A\.. fffff800`02c0e700 90 90 90 90 90 90 90 90 48 89 54 24 10 53 55 56 ........H.T$.SUV fffff800`02c0e710 57 41 54 41 55 41 56 41 57 48 83 EC 58 48 8B F2 WATAUAVAWH..XH.. fffff800`02c0e720 48 8B D9 48 8D 54 24 30 48 8D 0D B9 67 02 00 45 H..H.T$0H...g..E fffff800`02c0e730 8B E1 49 8B F8 4C 89 84 24 B0 00 00 00 FF 15 35 ..I..L..$......5 fffff800`02c0e740 C9 01 00 4C 8B 2D 86 67 02 00 4C 8B 35 77 67 02 ...L.-.g..L.5wg. fffff800`02c0e750 00 48 8B C6 44 8B C6 48 2B 43 20 41 81 E0 FF 0F .H..D..H+C A.... fffff800`02c0e760 00 00 BD 00 10 00 00 48 C1 E8 0C 45 89 45 2C 8B .......H...E.E,. fffff800`02c0e770 CD 8B C0 41 2B C8 41 89 4D 28 4C 8D 4C C3 30 48 ...A+.A.M(L.L.0H fffff800`02c0e780 8B C6 48 25 00 F0 FF FF 49 89 45 20 49 89 46 20 ..H%....I.E I.F fffff800`02c0e790 45 89 46 2C 41 89 4E 28 44 89 84 24 B8 00 00 00 E.F,A.N(D..$.... fffff800`02c0e7a0 4C 89 8C 24 A0 00 00 00 45 85 E4 0F 84 90 01 00 L..$....E....... fffff800`02c0e7b0 00 48 8B 5F 10 48 81 E3 00 F0 FF FF 75 3C 8B 07 .H._.H......u<.. fffff800`02c0e7c0 48 8B 0D 49 67 02 00 44 8D 4B 01 48 C1 E8 0C 4D H..Ig..D.K.H...M fffff800`02c0e7d0 8B C6 BA 48 61 6C 20 49 89 46 30 FF 15 DF C8 01 ...Hal I.F0..... fffff800`02c0e7e0 00 48 8B D8 48 85 C0 0F 84 36 01 00 00 4C 8B 8C .H..H....6...L.. fffff800`02c0e7f0 24 A0 00 00 00 41 B7 01 EB 09 41 8B C0 48 03 D8 $....A....A..H.. fffff800`02c0e800 45 32 FF 49 8B 01 33 FF 49 89 45 30 48 8B 0D C5 E2.I..3.I.E0H... fffff800`02c0e810 66 02 00 44 8B CF 4D 8B C5 BA 48 61 6C 20 FF 15 f..D..M...Hal .. fffff800`02c0e820 9C C8 01 00 48 8B F0 48 85 C0 75 24 FF C7 83 FF ....H..H..u$.... fffff800`02c0e830 06 7C D9 48 21 44 24 20 45 33 C9 41 B8 01 EF 00 .|.H!D$ E3.A.... fffff800`02c0e840 00 48 8B D5 B9 AC 00 00 00 FF 15 A1 CA 01 00 CC .H.............. fffff800`02c0e850 8B FD 2B BC 24 B8 00 00 00 44 3B E7 41 0F 42 FC ..+.$....D;.A.B. fffff800`02c0e860 80 BC 24 C0 00 00 00 01 8B EF 44 8B C7 75 0E 48 ..$.......D..u.H fffff800`02c0e870 8B D0 48 8B CB FF 15 AD 33 02 00 EB 0B 48 8B D3 ..H.....3....H.. fffff800`02c0e880 48 8B C8 E8 C8 A6 01 00 4D 8B C5 BA 48 61 6C 20 H.......M...Hal fffff800`02c0e890 48 8B CE FF 15 47 C8 01 00 41 80 FF 01 75 11 4D H....G...A...u.M fffff800`02c0e8a0 8B C6 BA 48 61 6C 20 48 8B CB FF 15 30 C8 01 00 ...Hal H....0... fffff800`02c0e8b0 48 8B 84 24 A8 00 00 00 4C 8B 8C 24 A0 00 00 00 H..$....L..$.... fffff800`02c0e8c0 44 2B E7 48 8B BC 24 B0 00 00 00 48 03 C5 BD 00 D+.H..$....H.... fffff800`02c0e8d0 10 00 00 48 8B 7F 08 49 83 C1 08 45 33 C0 44 3B ...H..I...E3.D; fffff800`02c0e8e0 E5 48 8B C8 41 8B D4 0F 47 D5 48 81 E1 00 F0 FF .H..A...G.H..... fffff800`02c0e8f0 FF 48 89 84 24 A8 00 00 00 49 89 4D 20 41 89 55 .H..$....I.M A.U fffff800`02c0e900 28 25 FF 0F 00 00 41 89 45 2C 49 89 4E 20 41 89 (%....A.E,I.N A. fffff800`02c0e910 46 2C 41 89 56 28 48 89 BC 24 B0 00 00 00 E9 75 F,A.V(H..$.....u fffff800`02c0e920 FE FF FF 48 83 64 24 20 00 45 33 C9 41 B8 00 EF ...H.d$ .E3.A... fffff800`02c0e930 00 00 48 8B D5 B9 AC 00 00 00 FF 15 B0 C9 01 00 ..H............. fffff800`02c0e940 CC 48 8D 4C 24 30 FF 15 FC C6 01 00 48 83 C4 58 .H.L$0......H..X fffff800`02c0e950 41 5F 41 5E 41 5D 41 5C 5F 5E 5D 5B C3 90 90 90 A_A^A]A\_^][.... fffff800`02c0e960 90 90 90 90 48 89 5C 24 08 48 89 6C 24 10 48 89 ....H.\$.H.l$.H. fffff800`02c0e970 74 24 18 57 41 54 41 55 48 83 EC 50 33 C0 49 8B t$.WATAUH..P3.I. fffff800`02c0e980 F9 41 8B F0 4C 8B E2 48 8B CA 49 C7 C3 00 F0 FF .A..L..H..I..... fffff800`02c0e990 FF 45 85 C0 74 10 4C 85 59 10 74 0A 48 8B 49 08 .E..t.L.Y.t.H.I. fffff800`02c0e9a0 FF C0 3B C6 72 F0 3B C6 75 09 49 83 21 00 E9 FB ..;.r.;.u.I.!... fffff800`02c0e9b0 00 00 00 65 48 8B 04 25 20 00 00 00 33 C9 44 8B ...eH..% ...3.D. fffff800`02c0e9c0 50 24 48 8B 05 F7 64 02 00 4A 8B 2C D0 4C 8D 4D P$H...d..J.,.L.M fffff800`02c0e9d0 30 45 85 C0 74 22 4C 8B C6 4C 85 5A 10 75 0F 8B 0E..t"L..L.Z.u.. fffff800`02c0e9e0 02 FF C1 48 C1 E8 0C 49 89 01 49 83 C1 08 49 83 ...H...I..I...I. fffff800`02c0e9f0 E8 01 48 8B 52 08 75 E1 33 DB C1 E1 0C 41 B5 01 ..H.R.u.3....A.. fffff800`02c0ea00 48 21 5D 20 21 5D 2C 89 4D 28 44 38 2D 07 65 02 H!] !],.M(D8-.e. fffff800`02c0ea10 00 75 10 48 8B 05 C6 64 02 00 4A 8B 1C D0 E9 29 .u.H...d..J....) fffff800`02c0ea20 01 00 00 48 8D 0D D6 64 02 00 FF 15 50 C6 01 00 ...H...d....P... fffff800`02c0ea30 48 85 C0 0F 85 F9 00 00 00 44 8D 40 01 45 33 C9 [email protected]. fffff800`02c0ea40 33 D2 48 8B CD C7 44 24 28 20 00 00 00 21 5C 24 3.H...D$( ...!\$ fffff800`02c0ea50 20 FF 15 71 C6 01 00 4C 8B D8 48 85 C0 74 69 45 ..q...L..H..tiE fffff800`02c0ea60 32 ED 49 8B D3 85 F6 74 36 48 8B CE 49 F7 44 24 2.I....t6H..I.D$ fffff800`02c0ea70 10 00 F0 FF FF 75 1D 41 8B 44 24 10 25 EF 0F 00 .....u.A.D$.%... fffff800`02c0ea80 00 48 0B C2 48 83 C8 10 48 81 C2 00 10 00 00 49 .H..H...H......I fffff800`02c0ea90 89 44 24 10 48 83 E9 01 4D 8B 64 24 08 75 CD 48 .D$.H...M.d$.u.H fffff800`02c0eaa0 89 2F 4C 89 5F 08 48 89 5F 10 44 88 6F 30 4C 8D ./L._.H._.D.o0L. fffff800`02c0eab0 5C 24 50 49 8B 5B 20 49 8B 6B 28 49 8B 73 30 49 \$PI.[ I.k(I.s0I fffff800`02c0eac0 8B E3 41 5D 41 5C 5F C3 48 8D 54 24 30 48 8D 0D ..A]A\_.H.T$0H.. fffff800`02c0ead0 4C 64 02 00 FF 15 66 C5 01 00 48 8B 15 FF 63 02 Ld....f...H...c. fffff800`02c0eae0 00 44 8B 0D 10 64 02 00 48 8B 02 B9 01 00 00 00 .D...d..H....... fffff800`02c0eaf0 44 8B 40 18 44 3B C9 76 1E 48 83 C2 08 48 8B 02 [email protected];.v.H...H.. fffff800`02c0eb00 44 39 40 18 7D 06 44 8B 40 18 8B D9 FF C1 48 83 D9@.}[email protected]. fffff800`02c0eb10 C2 08 41 3B C9 72 E6 48 8D 4C 24 30 FF 15 0E C6 ..A;.r.H.L$0.... fffff800`02c0eb20 01 00 48 8B 05 B7 63 02 00 44 8B DB 4A 8B 1C D8 ..H...c..D..J... fffff800`02c0eb30 EB 07 83 60 1C 00 48 8B D8 F0 83 43 18 01 48 8D ...`..H....C..H. fffff800`02c0eb40 57 18 48 8D 4B 20 FF 15 F4 C4 01 00 48 8B 4B 10 W.H.K ......H.K. fffff800`02c0eb50 41 B9 01 00 00 00 4C 8B C5 BA 48 61 6C 20 FF 15 A.....L...Hal .. fffff800`02c0eb60 5C C5 01 00 4C 8B D8 48 85 C0 0F 85 F2 FE FF FF \...L..H........ fffff800`02c0eb70 48 21 44 24 20 45 33 C9 BA 00 10 00 00 B9 AC 00 H!D$ E3......... fffff800`02c0eb80 00 00 41 B8 02 EF 00 00 FF 15 62 C7 01 00 CC 90 ..A.......b..... fffff800`02c0eb90 90 90 90 90 90 90 90 90 48 89 5C 24 08 48 89 6C ........H.\$.H.l fffff800`02c0eba0 24 18 48 89 74 24 20 57 48 83 EC 20 41 80 78 30 $.H.t$ WH.. A.x0 fffff800`02c0ebb0 00 49 8B F8 8B F2 48 8B D9 BD 01 00 00 00 75 0F .I....H.......u. fffff800`02c0ebc0 49 8B 10 49 8B 48 08 FF 15 53 C4 01 00 EB 4A 4D I..I.H...S....JM fffff800`02c0ebd0 8B 00 48 8B 4F 08 BA 48 61 6C 20 FF 15 FF C4 01 ..H.O..Hal ..... fffff800`02c0ebe0 00 80 3D 30 63 02 00 00 75 2F 48 8D 4F 18 FF 15 ..=0c...u/H.O... fffff800`02c0ebf0 3C C5 01 00 48 8B 57 10 83 C8 FF F0 0F C1 42 18 <...H.W.......B. fffff800`02c0ec00 83 C0 FF 75 14 F0 0F B1 6A 1C 75 0D 48 8D 0D ED ...u....j.u.H... fffff800`02c0ec10 62 02 00 FF 15 4F C4 01 00 85 F6 74 1E 48 8B CE b....O.....t.H.. fffff800`02c0ec20 F6 43 10 10 74 0C 8B 43 10 25 EF 0F 00 00 48 89 .C..t..C.%....H. fffff800`02c0ec30 43 10 48 2B CD 48 8B 5B 08 75 E5 48 8B 5C 24 30 C.H+.H.[.u.H.\$0 fffff800`02c0ec40 48 8B 6C 24 40 48 8B 74 24 48 48 83 C4 20 5F C3 [email protected]$HH.. _. fffff800`02c0ec50 90 90 90 90 90 90 90 90 48 89 5C 24 18 48 89 4C ........H.\$.H.L fffff800`02c0ec60 24 08 55 56 57 41 54 41 55 41 56 41 57 48 83 EC $.UVWATAUAVAWH.. fffff800`02c0ec70 70 4D 8B F1 4D 8B E8 48 8B F2 4C 8B D1 44 0F 20 pM..M..H..L..D. fffff800`02c0ec80 C7 F6 42 0A 05 74 06 48 8B 5A 18 EB 2A 45 33 C9 ..B..t.H.Z..*E3. fffff800`02c0ec90 33 D2 48 8B CE 45 8D 41 01 C7 44 24 28 20 00 00 3.H..E.A..D$( .. fffff800`02c0eca0 00 83 64 24 20 00 FF 15 1C C4 01 00 4C 8B 94 24 ..d$ .......L..$ fffff800`02c0ecb0 B0 00 00 00 48 8B D8 BD 02 00 00 00 48 85 DB 75 ....H.......H..u fffff800`02c0ecc0 4A 40 3A FD 76 1F 48 21 5C 24 20 45 33 C9 BA 00 J@:.v.H!\$ E3... fffff800`02c0ecd0 10 00 00 B9 AC 00 00 00 41 B8 05 EF 00 00 FF 15 ........A....... fffff800`02c0ece0 0C C6 01 00 CC 8A 84 24 D8 00 00 00 44 8B 8C 24 .......$....D..$ fffff800`02c0ecf0 D0 00 00 00 4D 8B C6 49 8B D5 48 8B CE 88 44 24 ....M..I..H...D$ fffff800`02c0ed00 20 E8 02 FA FF FF E9 4D 01 00 00 44 8B BC 24 D0 ......M...D..$. fffff800`02c0ed10 00 00 00 BA FF 0F 00 00 41 8B CD 23 CA 41 8B C7 ........A..#.A.. fffff800`02c0ed20 C6 84 24 B8 00 00 00 00 23 C2 44 8D A4 01 FF 0F ..$.....#.D..... fffff800`02c0ed30 00 00 41 8B C7 41 C1 EC 0C C1 E8 0C 44 03 E0 44 ..A..A......D..D fffff800`02c0ed40 89 64 24 30 40 3A FD 76 41 33 C9 49 8B C6 45 85 .d$0@:.vA3.I..E. fffff800`02c0ed50 E4 74 64 48 F7 40 10 00 F0 FF FF 74 0D 48 8B 40 [email protected].@ fffff800`02c0ed60 08 FF C1 41 3B CC 72 EB EB 4D 48 83 64 24 20 00 ...A;.r..MH.d$ .

    Read the article

  • "ERROR:Could not find java.nio.file.Paths" when using Oracle JDK 1.7

    - by Ankit
    I want to try out some features rolled out in Oracle's new JDK 1.7. I followed the post:- Oracle JDK 1.7 but the post doesn't seem to help. I was trying to fetch out the structure for java.nio.file.Paths class file but got the following error:- buffer@ankit:~$ javap java.nio.file.Paths ERROR:Could not find java.nio.file.Paths However i can easily get the information about class structures till JAVA SE 1.6, here is an example:- buffer@ankit:~$ javap java.lang.Object Compiled from "Object.java" public class java.lang.Object{ public java.lang.Object(); public final native java.lang.Class getClass(); public native int hashCode(); public boolean equals(java.lang.Object); protected native java.lang.Object clone() throws java.lang.CloneNotSupportedException; public java.lang.String toString(); public final native void notify(); public final native void notifyAll(); public final native void wait(long) throws java.lang.InterruptedException; public final void wait(long, int) throws java.lang.InterruptedException; public final void wait() throws java.lang.InterruptedException; protected void finalize() throws java.lang.Throwable; static {}; } Running java -version gives the following result:- buffer@ankit:~$ java -version java version "1.7.0_09" Java(TM) SE Runtime Environment (build 1.7.0_09-b05) Java HotSpot(TM) 64-Bit Server VM (build 23.5-b02, mixed mode) SYSTEM INFORMATION buffer@ankit:~$ sudo update-alternatives --config java [sudo] password for buffer: There are 4 choices for the alternative java (providing /usr/bin/java). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/java 1061 auto mode 1 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/java 1061 manual mode 2 /usr/lib/jvm/java-7-openjdk-amd64/jre/bin/java 1051 manual mode 3 /usr/lib/jvm/jdk1.7.0_09/ 1 manual mode * 4 /usr/lib/jvm/jdk1.7.0_09/bin/java 1 manual mode buffer@ankit:~$ sudo update-alternatives --config javac There are 2 choices for the alternative javac (providing /usr/bin/javac). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/lib/jvm/java-6-openjdk-amd64/bin/javac 1061 auto mode 1 /usr/lib/jvm/java-6-openjdk-amd64/bin/javac 1061 manual mode * 2 /usr/lib/jvm/jdk1.7.0_09/bin/javac 1 manual mode buffer@ankit:~$ sudo update-alternatives --config javaws There are 3 choices for the alternative javaws (providing /usr/bin/javaws). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/javaws 1061 auto mode 1 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/javaws 1061 manual mode 2 /usr/lib/jvm/java-7-openjdk-amd64/jre/bin/javaws 1060 manual mode * 3 /usr/lib/jvm/jdk1.7.0_09/bin/javaws 1 manual mode The directory structure of /usr/lib/jvm/ is as follows:- buffer@ankit:~$ ls -l /usr/lib/jvm/ total 24 lrwxrwxrwx 1 root root 24 Dec 2 2011 default-java -> java-1.6.0-openjdk-amd64 drwxr-xr-x 4 root root 4096 Nov 8 16:24 java-1.5.0-gcj-4.6 lrwxrwxrwx 1 root root 24 Dec 2 2011 java-1.6.0-openjdk -> java-1.6.0-openjdk-amd64 lrwxrwxrwx 1 root root 20 Oct 25 00:01 java-1.6.0-openjdk-amd64 -> java-6-openjdk-amd64 lrwxrwxrwx 1 root root 20 Oct 25 06:59 java-1.7.0-openjdk-amd64 -> java-7-openjdk-amd64 lrwxrwxrwx 1 root root 24 Dec 2 2011 java-6-openjdk -> java-1.6.0-openjdk-amd64 drwxr-xr-x 7 root root 4096 Nov 8 16:24 java-6-openjdk-amd64 drwxr-xr-x 3 root root 4096 Nov 8 16:24 java-6-openjdk-common drwxr-xr-x 5 root root 4096 Nov 8 05:48 java-7-openjdk-amd64 drwxr-xr-x 3 root root 4096 Nov 8 05:48 java-7-openjdk-common drwxr-xr-x 8 buffer buffer 4096 Sep 25 09:08 jdk1.7.0_09 Any help would be highly appreciated.

    Read the article

  • nvidia driver problems after upgrading to 3.2.0-26 on Ubuntu 12.04 64bit

    - by Lev Levitsky
    After installing latest updates I can't set screen resolution higher than 1024x768; every time after the boot I get a message Could not apply the stored configuration for the monitors (Note: removing ~/.config/monitors.xml stopped the message, but not the problem) I can boot with 3.2.0-25 and the graphics look normal. Here's what I have in /var/log/apt/term.log (excerpt): Setting up linux-image-3.2.0-26-generic (3.2.0-26.41) ... Running depmod. update-initramfs: deferring update (hook will be called later) Examining /etc/kernel/postinst.d. run-parts: executing /etc/kernel/postinst.d/dkms 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic Error! Problems with depmod detected. Automatically uninstalling this module. DKMS: Install Failed (depmod problems). Module rolled back to built state. run-parts: executing /etc/kernel/postinst.d/initramfs-tools 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic update-initramfs: Generating /boot/initrd.img-3.2.0-26-generic run-parts: executing /etc/kernel/postinst.d/pm-utils 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic run-parts: executing /etc/kernel/postinst.d/update-notifier 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic run-parts: executing /etc/kernel/postinst.d/zz-update-grub 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic Generating grub.cfg ... Found linux image: /boot/vmlinuz-3.2.0-26-generic Found initrd image: /boot/initrd.img-3.2.0-26-generic Found linux image: /boot/vmlinuz-3.2.0-25-generic Found initrd image: /boot/initrd.img-3.2.0-25-generic Found linux image: /boot/vmlinuz-3.2.0-24-generic Found initrd image: /boot/initrd.img-3.2.0-24-generic Found linux image: /boot/vmlinuz-3.2.0-23-generic Found initrd image: /boot/initrd.img-3.2.0-23-generic Found linux image: /boot/vmlinuz-3.0.0-17-generic Found initrd image: /boot/initrd.img-3.0.0-17-generic Found memtest86+ image: /boot/memtest86+.bin I went to "additional drivers" and saw some updates available there, but an attempt to install them failed, leaving the following in /var/log/jockey.log (long log, pasted here). The full log won't fit in the question, so I'm showing $ fgrep 'ERROR' /var/log/jockey.log 2012-06-30 17:29:57,897 WARNING: modinfo for module vmxnet failed: ERROR: modinfo: could not find module vmxnet 2012-06-30 17:29:57,937 WARNING: modinfo for module wl failed: ERROR: modinfo: could not find module wl 2012-06-30 17:29:58,072 WARNING: modinfo for module nvidia_96 failed: ERROR: modinfo: could not find module nvidia_96 2012-06-30 17:29:58,240 WARNING: modinfo for module nvidia_current failed: ERROR: modinfo: could not find module nvidia_current 2012-06-30 17:29:58,293 WARNING: modinfo for module nvidia_current_updates failed: ERROR: modinfo: could not find module nvidia_current_updates 2012-06-30 17:29:58,351 WARNING: modinfo for module nvidia_173_updates failed: ERROR: modinfo: could not find module nvidia_173_updates 2012-06-30 17:29:58,385 WARNING: modinfo for module nvidia_173 failed: ERROR: modinfo: could not find module nvidia_173 2012-06-30 17:29:58,420 WARNING: modinfo for module nvidia_96_updates failed: ERROR: modinfo: could not find module nvidia_96_updates 2012-06-30 17:29:58,455 WARNING: modinfo for module ath_pci failed: ERROR: modinfo: could not find module ath_pci 2012-06-30 17:29:58,478 WARNING: modinfo for module fglrx_updates failed: ERROR: modinfo: could not find module fglrx_updates 2012-06-30 17:29:58,531 WARNING: modinfo for module fglrx failed: ERROR: modinfo: could not find module fglrx 2012-06-30 17:29:58,588 WARNING: modinfo for module omapdrm_pvr failed: ERROR: modinfo: could not find module omapdrm_pvr 2012-06-30 17:29:59,537 WARNING: modinfo for module nvidia_current failed: ERROR: modinfo: could not find module nvidia_current 2012-06-30 17:29:59,613 WARNING: modinfo for module nvidia_173_updates failed: ERROR: modinfo: could not find module nvidia_173_updates 2012-06-30 17:29:59,686 WARNING: modinfo for module nvidia_173 failed: ERROR: modinfo: could not find module nvidia_173 2012-06-30 17:29:59,764 WARNING: modinfo for module nvidia_current_updates failed: ERROR: modinfo: could not find module nvidia_current_updates 2012-06-30 17:30:29,544 WARNING: modinfo for module nvidia_current_updates failed: ERROR: modinfo: could not find module nvidia_current_updates 2012-06-30 17:30:29,545 ERROR: XorgDriverHandler.enable(): package or module not installed, aborting I'm not sure if it's a bug, as the first log shows some errors. What can I try?

    Read the article

  • javax.ejb.NoSuchEJBException after redeploying EJBs

    - by vetler
    Using Glassfish 3.0.1 ... If I have a web application accessing EJBs in another application remotely, and the remote application containing the EJBs is redeployed, I get a javax.ejb.NoSuchEJBException (see stacktrace below). Shouldn't this work? I can see that the EJB in question was successfully deployed, using the exact same JNDI name. Is there any other way to fix this than to restart the web application? It should be noted that in this particular example that the stacktrace is from, I'm accessing a servlet that injects the bean with CDI: public class StatusServlet extends HttpServlet { @Inject private StatusService statusService; @Override public void doGet(final HttpServletRequest req, final HttpServletResponse res) throws IOException { res.getWriter().write(statusService.getStatus()); } } The injection is done with the following producer to get the right EJB: public class StatusServiceProducer extends AbstractServiceProducer { @EJB(name = "StatusService") private StatusService service; @Produces public StatusService getService(final InjectionPoint ip) { return service; } } A producer is used to make it easier to wrap the service in a proxy, and to make it easier to change how the EJBs are looked up. The StatusService interface and implementation is as follows: @Stateless(name = "StatusService") public class StatusServiceImpl implements StatusService { private static final String OK = "OK"; public String getStatus() { // Some code return OK; } } public interface StatusService { String getStatus(); } Full stacktrace: [#|2011-01-12T10:45:28.273+0100|WARNING|glassfish3.0.1|javax.enterprise.system.container.web.com.sun.enterprise.web|_ThreadID=50;_ThreadName=http-thread-pool-8080-(1);|StandardWrapperValve[Load Balancer status servlet]: PWC1406: Servlet.service() for servlet Load Balancer status servlet threw exception javax.ejb.NoSuchEJBException at org.example.service._StatusService_Wrapper.getStatus(org/example/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: java.rmi.NoSuchObjectException: CORBA OBJECT_NOT_EXIST 1330446338 No; nested exception is: org.omg.CORBA.OBJECT_NOT_EXIST: ----------BEGIN server-side stack trace---------- org.omg.CORBA.OBJECT_NOT_EXIST: vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3457) at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3475) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:222) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.findObjectAdapter(CorbaServerRequestDispatcherImpl.java:450) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.dispatch(CorbaServerRequestDispatcherImpl.java:209) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.handleRequestRequest(CorbaMessageMediatorImpl.java:1841) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:119) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) at no.evote.service._StatusService_Wrapper.getStatus(no/evote/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: org.omg.PortableServer.POAPackage.AdapterNonExistent: IDL:omg.org/PortableServer/POA/AdapterNonExistent:1.0 at com.sun.corba.ee.impl.oa.poa.POAImpl.find_POA(POAImpl.java:1057) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:218) ... 48 more ----------END server-side stack trace---------- vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.javax.rmi.CORBA.Util.mapSystemException(Util.java:280) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:200) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) ... 39 more Caused by: org.omg.CORBA.OBJECT_NOT_EXIST: ----------BEGIN server-side stack trace---------- org.omg.CORBA.OBJECT_NOT_EXIST: vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3457) at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3475) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:222) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.findObjectAdapter(CorbaServerRequestDispatcherImpl.java:450) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.dispatch(CorbaServerRequestDispatcherImpl.java:209) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.handleRequestRequest(CorbaMessageMediatorImpl.java:1841) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:119) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) at no.evote.service._StatusService_Wrapper.getStatus(no/evote/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: org.omg.PortableServer.POAPackage.AdapterNonExistent: IDL:omg.org/PortableServer/POA/AdapterNonExistent:1.0 at com.sun.corba.ee.impl.oa.poa.POAImpl.find_POA(POAImpl.java:1057) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:218) ... 48 more ----------END server-side stack trace---------- vmcid: OMG minor code: 2 completed: No at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:39) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27) at java.lang.reflect.Constructor.newInstance(Constructor.java:513) at com.sun.corba.ee.impl.protocol.giopmsgheaders.MessageBase.getSystemException(MessageBase.java:913) at com.sun.corba.ee.impl.protocol.giopmsgheaders.ReplyMessage_1_2.getSystemException(ReplyMessage_1_2.java:129) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.getSystemExceptionReply(CorbaMessageMediatorImpl.java:681) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.processResponse(CorbaClientRequestDispatcherImpl.java:510) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:153) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) ... 42 more |#]

    Read the article

  • How to select from tableA sum of grouped numbers from tableB above their sums average in Oracle?

    - by Nazgulled
    I have data like this: tableA.ID --------- 1 2 3 tableB.ID tableB.NUM -------------------- 1 10 1 15 2 18 3 12 2 15 3 13 1 12 I need to select tableA IDs where the sum of their NUMs in tableB is above the average of all tableA IDs sums. In other words: SUM ID=1 -> 10+15+12 = 37 SUM ID=2 -> 18+12+15 = 45 SUM ID=3 -> 12+13 = 25 AVG ALL IDs -> (37+45+25)/3 = 35 The SELECT must only show ID 1 and 2 because 37 35, 45 35 but 25 < 35. This is my current query which is working fine: SELECT tableA.ID FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING SUM(tableB.NUM) > ( SELECT AVG(MY_SUM) FROM ( SELECT SUM(tableB.NUM) MY_SUM FROM tableA, tableB WHERE tableA.ID = tableB.ID GROUP BY tableA.ID ) ) GROUP BY tableA.ID But I have a feeling there might be a better way without all those nested SELECTs. Perhaps 2, but 3 feels like too much. I'm probably wrong though. For instance, why can't I do something simple like this: SELECT tableA.ID FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING SUM(tableB.NUM) > AVG(SUM(tableB.NUM)) GROUP BY tableA.ID Or this: SELECT tableA.ID, SUM(tableB.NUM) MY_SUM FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING MY_SUM > AVG(MY_SUM) GROUP BY tableA.ID

    Read the article

  • Why can't I send SOAP requests to Ebay finding API with this php?

    - by Jay
    This is my code: <?php error_reporting(E_ALL); //new instance of soapClient pointing to Ebay finding api $client = new SoapClient("http://developer.ebay.com/webservices/finding/latest/FindingService.wsdl"); //attach required parameters to soap message header $header_arr = array(); $header_arr[] = new SoapHeader("X-EBAY-SOA-MESSAGE-PROTOCOL", "SOAP11"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SERVICE-NAME", "FindingService"); $header_arr[] = new SoapHeader("X-EBAY-SOA-OPERATION-NAME", "findItemsByKeywords"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SERVICE-VERSION", "1.0.0"); $header_arr[] = new SoapHeader("X-EBAY-SOA-GLOBAL-ID", "EBAY-GB"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SECURITY-APPNAME", "REMOVED"); $header_arr[] = new SoapHeader("X-EBAY-SOA-REQUEST-DATA-FORMAT", "XML"); $header_arr[] = new SoapHeader("X-EBAY-SOA-MESSAGE-PROTOCOL", "XML"); $test = $client->__setSoapHeaders($header_arr); $client->__setLocation("http://svcs.ebay.com/services/search/FindingService/v1");//endpoint $FindItemsByKeywordsRequest = array( "keywords" => "potter" ); $result = $client->__soapCall("findItemsByKeywords", $FindItemsByKeywordsRequest); //print_r($client->__getFunctions()); //print_r($client->__getTypes()); //print_r($result); ? And this is the error I receive: Fatal error: Uncaught SoapFault exception: [axis2ns2:Server] Missing SOA operation name header in C:\xampplite\htdocs\OOP\newfile.php:25 Stack trace: #0 C:\xampplite\htdocs\OOP\newfile.php(25): SoapClient-__soapCall('findItemsByKeyw...', Array) #1 {main} thrown in C:\xampplite\htdocs\OOP\newfile.php on line 25 It doesnt make sense, I have already set the operation name in the header of the request... Does anyone know what is wrong here?

    Read the article

  • word wrap in tcpdf

    - by ChuckO
    I'm using tcpdf to creat a pdf version of the html table below. How do I word wrap the text in the cells? <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <style type="text/css"> table.frm { width: 960px; Height:400px; margin-left: auto; margin-right: auto; border-width: 0px 0px 0px 0px; border-spacing: 0px; border-style: solid solid solid solid; border-color: gray gray gray gray; border-collapse: collapse; background-color: white; font-family: Verdana,Arial,Helvetica,sans-serif; font-size: 11px; } table.frm th { Width: 120px; border-width: 1px 1px 1px 1px; padding: 1px 1px 1px 1px; border-style: solid solid solid solid; border-collapse: collapse; border-color: gray gray gray gray; background-color: white; } table.frm td { width: 120px; height: 80px; vertical-align: top; border-width: 1px 1px 1px 1px; padding: 2px 2px 2px 2px; border-style: solid solid solid solid; border-collapse: collapse; border-color: gray gray gray gray; background-color: white; } </style> <title>Weekly Menu</title> </head> <body> <table class="frm"> <tr> <th align="center" colspan="8"><b>WEEKLY MENU</b></th> </tr> <tr> <th align="center" colspan="8"><b>Your Name Here</b></th> </tr> <tr> <th></th> <th>Monday</th> <th>Tuesday</th> <th>Wednesday</th> <th>Thursday</th> <th>Friday</th> <th>Saturday</th> <th>Sunday</th> </tr> <tr> <td><b>Breakfast</b></td> <td>Scrambled Eggs Black Coffee</td> <td>Vegetable Omelet Black Coffee</td> <td>2 slices Toast Black Coffee</td> <td>Cereal w/milk Black Coffee</td> <td>Orange Juice Black Coffee</td> <td>Cereal w/milk Black Coffee</td> <td>Pancakes w/syrup Black Coffee</td> </tr> <tr> <td><b>Lunch</b></td> <td>Tuna Salad Sandwich Diet Coke</td> <td>Greek Salad Black Coffee</td> <td></td> <td>Amer Cheese Sandwich Orange Juice</td> <td></td> <td></td> <td></td> </tr> <tr> <td><b>Dinner</b></td> <td>Burger Fried Onions Diet Coke</td> <td>Steak Fries Diet Sprite</td> <td></td> <td>Chicken Cutlet Baked Potato Peas</td> <td></td> <td></td> <td></td> </tr> <tr> <td><b>Snack</b></td> <td>Apple</td> <td>Orange</td> <td>Sm bag of chips</td> <td>Celery Sticks</td> <td></td> <td></td> <td></td> </tr> </table> </body> </html> This is the tcpdf code: $pdf = new TCPDF('Landscape', 'mm', '', true, 'UTF-8', false); $pdf->SetTitle('Weekly Menu'); $pdf->SetMargins(15, 7.5, 12.5); $pdf->SetAutoPageBreak(TRUE, PDF_MARGIN_BOTTOM); $pdf->SetPrintHeader(false); $pdf->SetPrintFooter(false); $pdf->AddPage(); $pdf->setFormDefaultProp(array('lineWidth'=>0, 'borderStyle'=>'dot', 'fillColor'=>array(235, 235, 255), 'strokeColor'=>array(255,255,250))); $pdf->SetFont('times', 'BU', 12); $pdf->cell(250, 8, 'Weekly Menu', 0, 1, 'C'); $pdf->cell(250, 8, $yourname, 0, 1, 'C'); $pdf->SetFont('times', '', 10); $cw=35; $ch=25; $pdf->SetXY(15,50); $pdf->cell(25,5,'',1,0,'L'); $pdf->cell($cw,5,$day1,1,0,'C'); $pdf->cell($cw,5,$day2,1,0,'C'); $pdf->cell($cw,5,$day3,1,0,'C'); $pdf->cell($cw,5,$day4,1,0,'C'); $pdf->cell($cw,5,$day5,1,0,'C'); $pdf->cell($cw,5,$day6,1,0,'C'); $pdf->cell($cw,5,$day7,1,1,'C'); $pdf->cell(25,$ch,'Breakfast',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->breakfast,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Lunch',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->lunch,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Dinner',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->dinner,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Snack',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->snack,1,1,'L',0,0,false,'','T'); EOD;

    Read the article

  • XML String into a DataGridView (C#)

    - by Justin Daniels
    I am currently working with a webservice to pull a report about users in a remote support system. After pulling my report and receiving the result, I am given the following string back by the method: <report><header><field id="0">Source</field><field id="1">Session ID</field><field id="2">Date</field><field id="3">Name</field><field id="24">Technician Name</field><field id="25">Technician ID</field></header><data><row><field id="0">Email</field><field id="1">55037806</field><field id="2">4/13/2010 2:28:06 AM</field><field id="3">Bill Gates</field><field id="24">John</field><field id="25">1821852</field></row><row><field id="0">Telephone</field><field id="1">55034548</field><field id="2">4/13/2010 12:59:44 AM</field><field id="3">Steve Jobs</field><field id="24">John</field><field id="25">1821852</field></row></data></report> After receiving this string, I need to take it and display the actual data in a datagridview. I've tried putting it into an XMLDocument then reading that, but it seems to keep failing. Just interested in another set of eyes :) Application is written in C# in VS2010.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server.

    - by Hiru
    When a form with a run at server is added there will be two forms with runat server and another error occurs. Can some one give me an idea. Thankx in advance. The details of the error are as follows. Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Web.HttpException: Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [HttpException (0x80004005): Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server.] System.Web.UI.Page.VerifyRenderingInServerForm(Control control) +2052287 System.Web.UI.WebControls.TextBox.AddAttributesToRender(HtmlTextWriter writer) +49 System.Web.UI.WebControls.WebControl.RenderBeginTag(HtmlTextWriter writer) +17 System.Web.UI.WebControls.TextBox.Render(HtmlTextWriter writer) +17 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +25 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +121 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +22 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +199 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +20 System.Web.UI.Control.Render(HtmlTextWriter writer) +7 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +25 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +121 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +22 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +199 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +20 System.Web.UI.Page.Render(HtmlTextWriter writer) +26 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +25 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +121 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +22 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +2558 Version Information: Microsoft .NET Framework Version:2.0.50727.1873; ASP.NET Version:2.0.50727.1433

    Read the article

  • grails scaffolding broken

    - by damian
    Grails scaffoldin does not work in my grails application. When I go from the main page to the specific controller page it output something like this: Error 500: Servlet: default URI: /myapp/myDomain/list Exception Message: Tag [sortableColumn] is missing required attribute [title] or [titleKey] at /webTestDummyDomain/list:25 Caused by: Error processing GroovyPageView: Tag [sortableColumn] is missing required attribute [title] or [titleKey] at /myDomain/list:25 Class: /myDomain/list At Line: [25] Code Snippet: Code snippet empty. If I try to create a new app scaffold works perfectly. Additional data: Application Status * App version: 0.1 * Grails version: 1.2.2 * JVM version: 1.6.0_20 * Controllers: 11 * Domains: 10 * Services: 19 * Tag Libraries: 26 Installed Plugins * i18n - 1.2.2 * filters - 1.2.2 * logging - 1.2.2 * core - 1.2.2 * tomcat - 1.2.2 * webtest - 2.0.4 * functionalTest - 1.2.7 * yui - 2.7.0.1 * rest - 0.3 * jquery - 1.4.2.1 * bubbling - 2.1.2 * urlMappings - 1.2.2 * groovyPages - 1.2.2 * servlets - 1.2.2 * dataSource - 1.2.2 * controllers - 1.2.2 * codecs - 1.2.2 * jqueryUi - 1.8-SNAPSHOT * grailsUi - 1.2-SNAPSHOT * domainClass - 1.2.2 * mimeTypes - 1.2.2 * scaffolding - 1.2.2 * converters - 1.2.2 * hibernate - 1.2.2 * validation - 1.2.2 * services - 1.2.2 Can you give me any pointer?

    Read the article

  • Database not completely updated in rails migration

    - by Aatish Sai
    I am new to Ruby on Rails. I have a migration called create user class CreateUsers < ActiveRecord::Migration def change create_table :users do |t| t.column :username, :string, :limit => 25, :default => "", :null => false t.column :hashed_password, :string, :limit => 40, :default => "", :null => false t.column :first_name, :string, :limit => 25, :default => "", :null => false t.column :last_name, :string, :limit => 40, :default => "", :null => false t.column :email, :string, :limit => 50, :default => "", :null => false t.column :display_name, :string, :limit => 25, :default => "", :null => false t.column :user_level, :integer, :limit => 3, :default => 0, :null => false end User.create(:username=>'test',:hashed_password=>'test',:first_name=>'test',:last_name=>'test',:email=>'[email protected]',:display_name=> 'test',:user_level=>9) end end When I run rake db:migrate the table is created with the columns as mentioned above but the test data are not there mysql>select * from users; Empty set (0.00 sec) EDIT I just dropped the whole database and restarted the migration and now it is showing the following error. rake aborted! An error has occurred, all later migrations canceled: Can't mass-assign protected attributes: username, hashed_password, first_name, last_name, email, display_name, user_level What am I doing wrong please help? Thank you.

    Read the article

  • Merging Passed Parameters

    - by Josh Crowder
    I have a two data arrays sent in from a form, one called transloaded and the other video which is the actual form for the model. I need to get [:video_encoded][:url] and save that to [:video][:flash_url] This is the passed arguments or transloaded, when I try and access [:transload][:results][:video_encode] I get nil. print params[:transload] { "assembly_id":"d59b4293b3d79d2ccd1948c02421c6a6", "status":"success", "uploads":{ "video":{ "name":"bbc_one.mp4", "mime":"video/mp4", "ext":"mp4", "size":601104, "meta":{ "width":720, "height":404, "video_fps":25, "video_bitrate":null, "video_format":"avc1", "video_codec":"ffh264", "audio_bitrate":"128k", "audio_codec":"faad", "duration":3.07, "device_vendor":null, "device_name":null, "device_software":null, "latitude":null, "longitude":null }, "url":"http://tmp.transloadit.com/" } }, "results":{ "video_encode":{ "name":"bbc_one.flv", "mime":"video/x-flv", "steps":["encode","export"], "ext":"flv", "size":388317, "meta":{ "width":480, "height":320, "video_fps":25, "video_bitrate":"512k", "video_format":"FLV1", "video_codec":"ffflv", "audio_bitrate":"64k", "audio_codec":"mp3", "duration":3.11, "device_vendor":null, "device_name":null, "device_software":null, "latitude":null, "longitude":null }, "url":"http://s3.transloadit.com/b7deac9c96af6c745e914e25d0350baa/7a/2b09e822265ac2328789b40dcc02ae/bbc_one.flv" }, "video_encode_iphone":{ "name":"bbc_one.qt", "mime":"video/quicktime", "steps":["encode_iphone","export"], "ext":"qt", "size":218236, "meta":{ "width":480, "height":320, "video_fps":25, "video_bitrate":null, "video_format":"avc1", "video_codec":"ffh264", "audio_bitrate":"128k", "audio_codec":"faad", "duration":3.04, "device_vendor":null, "device_name":null, "device_software":null, "latitude":null, "longitude":null }, "url":"http://s3.transloadit.com/31/58bcc80d5345e52a42c9773125e8f0/bbc_one.qt" } } } Here is what I am trying to use video_links = { :flash_url => params[:transload][:results][:video_encode][:url], :mp4_url => params[:transload][:results][:video_encode_iphone][:url] } params[:video].merge(video_links)

    Read the article

  • Pattern for limiting number of simultaneous asynchronous calls

    - by hitch
    I need to retrieve multiple objects from an external system. The external system supports multiple simultaneous requests (i.e. threads), but it is possible to flood the external system - therefore I want to be able to retrieve multiple objects asynchronously, but I want to be able to throttle the number of simultaneous async requests. i.e. I need to retrieve 100 items, but don't want to be retrieving more than 25 of them at once. When each request of the 25 completes, I want to trigger another retrieval, and once they are all complete I want to return all of the results in the order they were requested (i.e. there is no point returning the results until the entire call is returned). Are there any recommended patterns for this sort of thing? Would something like this be appropriate (pseudocode, obviously)? private List<externalSystemObjects> returnedObjects = new List<externalSystemObjects>; public List<externalSystemObjects> GetObjects(List<string> ids) { int callCount = 0; int maxCallCount = 25; WaitHandle[] handles; foreach(id in itemIds to get) { if(callCount < maxCallCount) { WaitHandle handle = executeCall(id, callback); addWaitHandleToWaitArray(handle) } else { int returnedCallId = WaitHandle.WaitAny(handles); removeReturnedCallFromWaitHandles(handles); } } WaitHandle.WaitAll(handles); return returnedObjects; } public void callback(object result) { returnedObjects.Add(result); }

    Read the article

  • Import MySQL file in PHP

    - by Cudos
    I have a MySQL file which I want to import via PHP 5. In the name of user friendliness the user should not use tools like PHPmyadmin etc. Just hit a button and the file will get imported. I have already created code to upload the file to a location on the server. The file looks like this: INSERT INTO products VALUES ('', '0', '10', '', '1', 'be34112', '4536.jpg', '','','','0'); SET @master_id = LAST_INSERT_ID(); INSERT INTO products_description VALUES ('', '1', @master_id, '1', 'Kjole', '', 'beskrivelse', '2000', '25', 'kjole.xml', '', '', ''); INSERT INTO products_to_categories VALUES ('',@master_id,'5'); INSERT INTO products VALUES ('', @master_id, '10', '12', '1', 'be34112', '4536.jpg', '200','','','0'); SET @variant_id = LAST_INSERT_ID(); INSERT INTO products_description VALUES ('', '1', @variant_id, '1', 'Kjole', '', 'beskrivelse', '2000', '25', 'kjole.xml', '', '', ''); INSERT INTO options_to_products VALUES ('', @variant_id, '1', '1'); INSERT INTO options_to_products VALUES ('', @variant_id, '', '2'); INSERT INTO products VALUES ('', @master_id, '20', '17', '1', 'be34113', '4537.jpg', '200','','','0'); SET @variant_id = LAST_INSERT_ID(); INSERT INTO products_description VALUES ('', '1', @variant_id, '1', 'Kjole', '', 'beskrivelse æøå ÆØÅ & íjj´¨¨¨¨fdfd""', '3000', '25', 'kjole.xml', '', '', ''); INSERT INTO options_to_products VALUES ('', @variant_id, '1', ''); INSERT INTO options_to_products VALUES ('', @variant_id, '', '4');

    Read the article

  • CSS filters - sometimes working, sometimes not?

    - by a2h
    I'm on the verge of pulling my hair out over this. Here I have a block of perfectly functioning CSS: #admin .block.mode.off { opacity: 0.25; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(opacity=25)"; filter: progid:DXImageTransform.Microsoft.Alpha(opacity=25); } Meanwhile... Internet Explorer 8 couldn't care less about my filter declarations here: #admin .drop .tabs { margin-bottom: 12px; } #admin .drop .tab { margin-right: 4px; } #admin .drop .tab.off { cursor: pointer; opacity: 0.5; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(opacity=50)"; filter: progid:DXImageTransform.Microsoft.Alpha(opacity=50); } #admin .drop .tab.off:hover { text-shadow: 0px 0px 4px #fff; } #admin .drop .tab.on { cursor: default; text-shadow: 0px 0px 4px #fff; -ms-filter: "progid:DXImageTransform.Microsoft.Glow(color=#fff, strength=4)"; filter: progid:DXImageTransform.Microsoft.Glow(color=#fff, strength=4); } My document shows in IE8 Standards, and I am assuming the developer tools are a load of tuna, because the functioning block shows up in its CSS tab as: filter: progid:DXImageTransform.Microsoft.Alpha(opacity=25); opacity: 0.25 Does anyone have any ideas?

    Read the article

  • SQL Server search filter and order by performance issues

    - by John Leidegren
    We have a table value function that returns a list of people you may access, and we have a relation between a search and a person called search result. What we want to do is that wan't to select all people from the search and present them. The query looks like this SELECT qm.PersonID, p.FullName FROM QueryMembership qm INNER JOIN dbo.GetPersonAccess(1) ON GetPersonAccess.PersonID = qm.PersonID INNER JOIN Person p ON p.PersonID = qm.PersonID WHERE qm.QueryID = 1234 There are only 25 rows with QueryID=1234 but there are almost 5 million rows total in the QueryMembership table. The person table has about 40K people in it. QueryID is not a PK, but it is an index. The query plan tells me 97% of the total cost is spent doing "Key Lookup" witht the seek predicate. QueryMembershipID = Scalar Operator (QueryMembership.QueryMembershipID as QM.QueryMembershipID) Why is the PK in there when it's not used in the query at all? and why is it taking so long time? The number of people total 25, with the index, this should be a table scan for all the QueryMembership rows that have QueryID=1234 and then a JOIN on the 25 people that exists in the table value function. Which btw only have to be evaluated once and completes in less than 1 second.

    Read the article

  • Using Moq to set indexers in C#

    - by emddudley
    I'm having trouble figuring out how to set indexers in C# with Moq. The Moq documentation is weak, and I've done a lot of searching... what I'd like to do is similar in the solution to How to Moq Setting an Indexed property: var someClass = new Mock<ISomeClass>(); someClass.SetupSet(o => o.SomeIndexedProperty[3] = 25); I want to modify the above to work for any index and any value so I can just do something like this: someClass.Object.SomeIndexedProperty[1] = 5; Currently I have the following, which works great for the indexed property getter, but if I ever set the value Moq ignores it: var someValues = new int[] { 10, 20, 30, 40 }; var someClass = new Mock<ISomeClass>(); someClass.Setup(o => o.SomeIndexedProperty[It.IsAny<int>()]) .Returns<int>(index => someValues[index]); // Moq doesn't set the value below, so the Assert fails! someClass.Object.SomeIndexedProperty[3] = 25; Assert.AreEqual(25, someClass.Object.SomeIndexedProperty[3]);

    Read the article

  • Delphi: Problems with TList of Frames

    - by Dan Kelly
    I'm having a problem with an interface that consists of a number of frames (normally 25) within a TScrollBox. There are 2 problems, and I am hoping that one is a consequence of the other... Background: When the application starts up, I create 25 frames, each containing approx. 20 controls, which are then populated with the default information. The user can then click on a control to limit the search to a subset of information at which point I free and recreate my frames (as the search may return < 25 records) The problem: If I quit the application after the initial search then it takes approx. 5 seconds to return to Delphi. After the 2nd search (and dispose / recreate of frames) it takes approx. 20 seconds) Whilst I could rewrite the application to only create the frames once, I would like to understand what is going on. Here is my create routine: procedure TMF.CreateFrame(i: Integer; var FrameBottom: Integer); var NewFrame: TSF; begin NewFrame := TSF.Create(Self); NewFrame.Name := 'SF' + IntToStr(i); if i = 0 then NewSF.Top := 8 else NewSF.Top := FrameBottom + 8; FrameBottom := NewFrame.Top + NewFrame.Height; NewFrame.Parent := ScrollBox1; FrameList.Add(NewFrame); end; And here is my delete routine: procedure TMF.ClearFrames; var i: Integer; SF: TSF; begin for i := 0 to MF.FrameList.Count -1 do begin SF := FrameList[i]; SF.Free; end; FrameList.Clear; end; What am I missing?

    Read the article

  • ASP.Net Gridview paging, pageindex always == 0.

    - by David Archer
    Hi all, Having a slight problem with my ASP.Net 3.5 app. I'm trying to get the program to pick up what page number has been clicked. I'm using ASP.Net's built in AllowPaging="True" function. It's never the same without code, so here it is: ASP.Net: <asp:GridView ID="GridView1" runat="server" CellPadding="4" ForeColor="#333333" GridLines="Vertical" Width="960px" AllowSorting="True" EnableSortingAndPagingCallbacks="True" AllowPaging="True" PageSize="25" > <RowStyle BackColor="#F7F6F3" ForeColor="#333333" /> <FooterStyle BackColor="#5D7B9D" Font-Bold="True" ForeColor="White" /> <PagerStyle BackColor="#284775" ForeColor="White" HorizontalAlign="Center" /> <SelectedRowStyle BackColor="#E2DED6" Font-Bold="True" ForeColor="#333333" /> <HeaderStyle BackColor="#5D7B9D" Font-Bold="True" ForeColor="White" /> <EditRowStyle BackColor="#999999" /> <AlternatingRowStyle BackColor="White" ForeColor="#284775" /> </asp:GridView> C#: var fillTable = from ft in db.IncidentDatas where ft.pUserID == Convert.ToInt32(ClientList.SelectedValue.ToString()) select new { Reference = ft.pRef.ToString(), Date = ft.pIncidentDateTime.Value.Date.ToShortDateString(), Time = ft.pIncidentDateTime.Value.TimeOfDay, Premesis = ft.pPremises.ToString(), Latitude = ft.pLat.ToString(), Longitude = ft.pLong.ToString() }; if (fillTable.Count() > 0) { GridView1.DataSource = fillTable; GridView1.DataBind(); var IncidentDetails = fillTable.ToList(); for (int i = 0; i < IncidentDetails.Count(); i++) { int pageno = GridView1.PageIndex; int pagenostart = pageno * 25; if (i >= pagenostart && i < (pagenostart + 25)) { //Processing } } } Any idea why GridView1.PageIndex is always = 0? The thing is, the processing works correctly for the grid view.... it will always go to the correct paging page, but it's always 0 when I try to get the number. Help!

    Read the article

  • Sitecore development. Sitecore.Web.UI.WebControl.GetCacheKey() throws NullReferenceException

    - by user344010
    I just click submit button and got an exception. Unable to debug, because this happens before the submit event handler work. I tried to clear sitecore caches, browser caches and cookies... nothing helps. here the stack trace. [NullReferenceException: Object reference not set to an instance of an object.] Sitecore.Web.UI.WebControl.GetCacheKey() +242 Sitecore.Web.UI.WebControl.Render(HtmlTextWriter output) +61 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.HtmlControls.HtmlHead.RenderChildren(HtmlTextWriter writer) +17 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +32 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.Page.Render(HtmlTextWriter writer) +29 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1266

    Read the article

  • What algorithm should i follow to retrieve data in the prescribed format?

    - by Prateek
    I have to retrieve data from a database in which tables are consisting of fields like "ttc, rm, atc and lta" namely. Actually these values are stored on daily basis with a 15 min interval like From_time to_time ttc rm atc lta 00:00 00:15 45 10 35 25, 00:15 00:30 35 10 25 25 and so on .. These values are stored for every day of every month and i want it to be previewed in the prescribed format then what algorithm should i follow. I am confused about how to do comparisons for a format like below mentioned. The format is at this link https://drive.google.com/a/itbhu.ac.in/file/d/0B_J0Ljq64i4Za2J1V0lvbDZ4eGc/edit?usp=sharing To be specific once again, my question is, I have to prepare a report from the retrieved data which is being stored in the databases as explained above. But the report which is going to be prepared will be of entire month. So, to say the least, there may be cases that for two particular days the value of "ttc" would be same for some time so i want it to be listed together (as shown in format). And the confusing part is any of the values "ttc", "rm", "atc", "lta" can be same for any particular interval. So what algorithm should i follow for such comparisons. And if still any query with question, u can ask your doubt. Thanks

    Read the article

  • jQuery rotator not rotating properly - too much recursion

    - by Matt Nathanson
    I've built a custom jQuery rotator using just basic animation to rotate the 3 Divs (images). I've built the function and then reinitiate the function using it as a call back. Here's the code: function ImageRotate() { var CurrentFeature = "#container" + featureNumber; $(CurrentFeature).stop(false, true).delay(4500).animate({'top' : '330px'}, 3000); var featureNumber2 = featureNumber-1; if ( featureNumber == 1) {featureNumber2=3} var CurrentFeature2 = "#container" + featureNumber2; $(CurrentFeature2).stop(false, true).delay(4500).animate({'top' : '0px'}, 3000); $('#container2').stop(false, true).delay(4500).animate({'top' : '-330px'}, 25); var featureNumber3 = featureNumber+1; if ( featureNumber == 3){featureNumber3=1} var CurrentFeature3 = "#container" + featureNumber3; $(CurrentFeature3).stop(false, true).delay(7500).animate({'top' : '0px'}, 3000); $(CurrentFeature2).stop(false, true).delay(4500).animate({'top' : '330px'}, 3000); $(CurrentFeature).stop(false, true).delay(4500).animate({'top' : '-330px'}, 25); if (featureNumber ==1) {featureNumber=3} else{featureNumber--}; $(CurrentFeature).stop(false, true).delay(7500).animate({'top' : '0px'}, 3000); $(CurrentFeature3).stop(false, true).delay(4500).animate({'top' : '330px'}, 3000); $(CurrentFeature2).stop(false, false).delay(4500).animate({'top' : '-330px'}, 25,ImageRotate()); }; It's worth noting that when calling the function again I also tried making another function called ImageRotate2(); and it did the same thing. It loops, but i get all sorts of funkiness. Edit: I've also tried some answers in the replies and they both leave me with recursion errors each second.

    Read the article

< Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >