Search Results

Search found 4745 results on 190 pages for 'spare parts'.

Page 32/190 | < Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >

  • Illustration for code presentation

    - by Lasse V. Karlsen
    I got an odd request, and I fear it will be closed as off-topic. So be it, but it's worth a shot. I'm creating a presentation about dependency injection and inversion of control, and I thought I'd make the point of interchangeable parts that serve a common purpose, but has different implementations, by showing an image I've seen before. Basically the image is of a man or a woman, but the image is split up into four parts: Head Torso uhm... not sure the name of this part, stomach, etc. Legs Possibly a fifth with feet and for each part you can choose among a few variants, creating odd people in the process. ie. a man torso with a woman head. But, I can't find such an image now of course. Does anyone know of such an image and can provide me with an url?

    Read the article

  • asp.net repeater returns weird html

    - by emre
    I have a repeater that is supposed to create div tags with their onclick functions from databind. Which is like onclick='<%# "functionname('" + Eval("somestring") +"');" %>' but the single quotes ' after the js func ( and before ) , they become something like ?,= .. I don't understand what's happening. .. the full code is below <div id="dvPager"> <asp:Repeater ID="pagerSorular" runat="server"> <ItemTemplate> <div class='<%# "pageritem pagertext" + ((this.PageNumber == int.Parse(Container.DataItem.ToString())) ? " pagerselected" : "") %>' onclick='<%# "gotopage('" + this.PageName + "', " + Container.DataItem + ");" %>'> <%# Container.DataItem %> </div> </ItemTemplate> </asp:Repeater> </div> and codebehind is: public int PageNumber { get { string strPgNum = Request.QueryString["pg"] as String; if (!String.IsNullOrEmpty(strPgNum)) { int pgnum; if (int.TryParse(strPgNum, out pgnum)) { if (pgnum <= 0) { return pgnum; } else { return 1; } } else { return 1; } } else { return 1; } } } public string PageName { get { string url = Request.Url.ToString(); string[] parts = url.Split(new char[]{'/'}); return parts[parts.Length - 1]; } } public void Doldur(List<SoruGridView> sorulistesi) { gridSorular.DataSource = sorulistesi; gridSorular.DataBind(); /// PagerYap(sorulistesi); } protected void PagerYap(List<SoruGridView> sorulistesi) { List<int> numpgs = new List<int>(); int count = 1; foreach (SoruGridView sgv in sorulistesi) { numpgs.Add(count); count++; } pagerSorular.DataSource = numpgs.ToArray(); pagerSorular.DataBind(); }

    Read the article

  • Coordinates in distorted grid

    - by Carsten
    I have a grid in a 2D system like the one in the before image where all points A,B,C,D,A',B',C',D' are given (meaning I know the respective x- and y-coordinates). I need to calculate the x- and y-coordinates of A(new), B(new), C(new) and D(new) when the grid is distorted (so that A' is moved to A'(new), B' is moved to B'(new), C' is moved to C'(new) and D' is moved to D'(new)). The distortion happens in a way in which the lines of the grid are each divided into sub-lines of equal length (meaning for example that AB is divided into 5 parts of the equal length |AB|/5 and A(new)B(new) is divided into 5 parts of the equal length |A(new)B(new)|/5). The distortion is done with the DistortImage class of the Sandy 3D Flash engine. (My practical task is to distort an image using this class where the handles are not positioned at the corners of the image like in this demo but somewhere within it).

    Read the article

  • SQL Split function.

    - by Wardy
    Hi guys, I'm looking for a way to do this ... SELECT FirstName, LastName, Split(AddressBlock, ' ', 1), Split(AddressBlock, ' ', 2), PostCode FROM Contacts The arguments I want to pass are ... The address The separator (current situation requires 2 spaces but this might be a comma or a space followed by a comma) or something else (it varies). The address part I want to return (i don't always need all parts of the split result). I seem to be able to find a few examples of splitting functions about the internet but they return a table containing the entire set of split parts. My SQL skills aren't that great so I need the answer to be ultra simple. I'm always working with nvarchar data and the function needs to be reusable.

    Read the article

  • What needs checking in for a Grails app?

    - by Bill James
    What parts of a Grails application need to be stored in source-control? Some obvious parts that are needed: grails-app directory test directory web-app directory Now we reach questions like: If we use a Grails plug-in (like gldapo), do we need to check in that plugin? Do Grails plugins install in the Grails directory, or your project? I'm not looking to start a religious war about .project, so please ignore that, but are there any "hidden" project files I need to worry about, along with the plugin issues? Converted to a community wiki, as new versions of Grails have changed some of these solutions, especially as regards plugins.

    Read the article

  • New to programming

    - by Shaun
    I have a form (Quote) with an auto-number ID, on the form at the moment are two subforms that show different items (sub 1 shows partition modules sub 2 shows partition abutments) both forms use the same parts tables to build them. Both forms are linked to the quote form using the ID. All works well until the forms is refreshed or re-loaded, subform 1 shows the module names and quantities and blank spaces for the abutment names but shows the quantiews for the abutments, the reverse of this is shown in the abutments subform 2. When the lists for the variuos types and the detailed parts lists are printed they are correct. This seems to be only a visual problem. All based on Access 2003. Subform 1 SELECT Quote_Modules.ModuleID, Quote_Modules.QuoteID, Quote_Modules.ModuleDescription, Quote_Modules.ModuleQty, Quote.Style, Quote.Trim FROM Quote INNER JOIN Quote_Modules ON Quote.QuoteID=Quote_Modules.QuoteID ORDER BY Quote_Modules.ModuleID; Subform 2 SELECT Quote_Modules.ModuleID, Quote_Modules.QuoteID, Quote_Modules.ModuleDescription, Quote_Modules.ModuleQty, Quote.Style, Quote.Trim FROM Quote INNER JOIN Quote_Modules ON Quote.QuoteID=Quote_Modules.QuoteID ORDER BY Quote_Modules.ModuleID;

    Read the article

  • Steps in subclassing UINavigationController

    - by RickiG
    Hello I would like to subclass the UINavigationController to get some more freedom in regards to the appearance of the controller. I have some graphics for the different parts, bars, buttons, text etc. Looking at the UINavigationController header file I get little help, I don't know where to start out. I have never subclassed/overridden a UIKit component before, it seems it is a bit like playing Sherlock Holmes. What is the approach? How do I know what to override to get a a specific piece of graphics "injected" the correct place? Do I need to subclass UINavigationBar, UIBarButtonItem etc. etc to get the complete customized look? How do I know if something is off limits in regards to being approved by Apple? Hope someone can point me in the right direction, I have only been able to find examples of changing small parts of the controller, not a full customization by subclassing. Am I going about this the wrong way? Thanks:)

    Read the article

  • from one-dimensional to two-dimensional array

    - by Thijs
    Hi again, I have this PHP one dimensional array: Array ( [Female--N] => 11 [Male--N] => 11 [Humans--N] => 11 [Adult--N] => 8 [Adolescent--N] => 8 [Reaction Time-physiology--N] => 6 [Acoustic Stimulation-methods--N] => 6 [Schizophrenia-genetics--Y] => 5 [Motion Perception--N] => 3 ) And i want a new array from this that looks like (i think this tow-dimensional..?): Array ( [Female][N] => 11 [Male][N] => 11 [Humans][N] => 11 [Adult][N] => 8 [Adolescent][N] => 8 [Reaction Time-physiology][N] => 6 [Acoustic Stimulation-methods][N] => 6 [Schizophrenia-genetics][Y] => 5 [Motion Perception][N] => 3 ) Can i use split method on key elements? Little bit harder... i also need to split on the single '_' underscore, i did this to prevent the columns getting mixed up... But the example below doesn't do the job right... $new_array = array(); foreach($MeshtagsArray as $key => $value) { $parts = explode('__', $key, 2); $parts2 = explode('_', $key, 2); $new_array[] = array( 'discriptor' => $parts[0], 'qualifier' => $parts2[1], 'major' => $parts[1], '#occurence' => $value ); So the output should be something like: [0] => Array ( [discriptor] => Female [qualifier] => [major] => N [#occurence] => 11 ........ [5] => Array ( [discriptor] => Reaction Time [qualifier] => physiology [major] => N [#occurence] => 6 Best regards, Thijs

    Read the article

  • Pros and cons of cloud computing?

    - by Vimvq1987
    After 3 months of research, my thesis is nearly complete. Now I'm writing the report. Interesting parts are finished, now the boring and hard-to-write parts. I need to write about pros and cons of cloud computing. What it gives us and what it take us. I've searched much but there's only list, no explains. So I need your helps, to list and explains all of pros and cons of cloud computing. Thank you so much for this.

    Read the article

  • Open source configuration framework for ASP.NET - does one exist?

    - by Jon
    We currently have an old product written in classic asp and are about to re-write parts in ASP.NET. One big problem is that much of the cutomer-specifics within the system are hard coded. We want to split this out for specific customers by storing data in the database. Is there a quick an easy open source framework which allows me to set up some quick tables and simple UIs to allow me to change configuration items? We have 6-7 modules, and it would be nice to have the ability to have system admins gain access to a configuration area where they can set-up settings in a tabbed UI format, settings could also be set-up to allow dropdown, fields, numbers etc. The items could then be accessed via classes in C#/vb for use within the operational parts of the system. If not, I'm suprised and it might even be a good basis for a new open source project.

    Read the article

  • How to communicate/share a session between pages over HTTP and HTTPS

    - by spirytus
    What is common practice for coding web applications where part of the site has to be secured (e.g. checkout section) and part not necessarily, let's say homepage? As far as I know sharing sessions in between HTTP and HTTPS parts of the site is not easily possible (or is it?). What would be common approach if I wanted to display on HTTP page like homepage, shopping cart data (items) that users ordered on HTTPS pages? How those two parts of the site would communicate if necessary? Also isn't it security flaw in popular shopping carts as it seems that many of these have only checkout pages secured (SSL) and the rest not? I'm using PHP if it makes any difference.

    Read the article

  • Recommended Python publish/subscribe/dispatch module ?

    - by Eli Bendersky
    From PyPubSub: Pypubsub provides a simple way for your Python application to decouple its components: parts of your application can publish messages (with or without data) and other parts can subscribe/receive them. This allows message "senders" and message "listeners" to be unaware of each other: one doesn't need to import the other a sender doesn't need to know "who" gets the messages, what the listeners will do with the data, or even if any listener will get the message data. similarly, listeners don't need to worry about where messages come from. This is a great tool for implementing a Model-View-Controller architecture or any similar architecture that promotes decoupling of its components. There seem to be quite a few Python modules for publishing/subscribing floating around the web, from PyPubSub, to PyDispatcher to simple "home-cooked" classes. Can you recommend a module that works well in most cases ? Which modules have you had positive experience with ? Negative ? Thanks in advance

    Read the article

  • problem with parsing string from excel file

    - by ohana
    hi, i have ruby code to parse data in excel file using Parseexcel gem. I need to save 2 columns in that file into a Hash, here is my code: worksheet.each { |row| if row != nil key = row.at(1).to_s.strip value = row.at(0).to_s.strip if !parts.has_key?(key) and key.length 0 parts[key] = value end end } however it still save duplicate keys into the hash: "020098-10". I checked the excel file at the specified row and found the difference are " 020098-10" and "020098-10". the first one has a leading space while the second doesn't. I dont' understand is it true that .strip function already remove all leading and trailing white space? also when i tried to print out key.length, it gave me these weird number: 020098-10 length 18 020098-10 length 17 which should be 9....

    Read the article

  • IE6 background appears-disappears on scrolling

    - by itarato
    Hi, Given IE6, an UL-LI list and a background image for the UL container. <style> ul {background-image: url(images/bgr.png);} </style> ... <ul> <li>...</li> ... </ul> When I load the page, the background is randomly loaded, some parts are visible, some are not. Moreover, it changes on runtime when I'm scrolling on the page. When I scroll out the UL list and scroll back, different parts of the background will be visible, depends on the speed of scrolling. Do you have any idea? Thanks in advance.

    Read the article

  • Streaming content from (sharepoint) web part

    - by Mikko Rantanen
    How does one stream files, html or custom AJAX responses from web parts? Our current quick-and-very-dirty solution is to make the web part call the current page with certain query parameters, which the web part checks and instead of performing normal load it writes the required things to output and calls response end. This sounds bad since SharePoint might load other web parts and execute their code before reaching our web part. The web part is configured with data source settings which means the streaming context must be specific to the web part so it can acquire the correct data source settings.

    Read the article

  • Use filter(), but work with both results

    - by Tomalak
    In jQuery, filter() reduces your result to those elements that fulfill a certain condition. This splits the list in two parts. Working with the "good half" of the elements is easy: $("some selector").filter(function() { // determine result... return result; }).each( /* do something */ ); But how can I work with the "other half" of my elements, too - but without doing the equivalent of this: $("some selector").filter(function() { // determine result... return !result; }).each( /* do something else */ ); Basically, I'd like to feed two separate /* do something */ parts to a single filter. One for those that match, and one for the others - without having to filter twice. Am I missing a jQuery function that does this? P.S.: I guess I could do: $("some selector").each(function() { // determine result... if (result) /* do something */ else /* do something else */ }); But I was hoping for something nicer.

    Read the article

  • How to detect identical part(s) inside string?

    - by Horace Ho
    I try to break down the http://stackoverflow.com/questions/2711961/decoding-algorithm-wanted question into smaller questions. This is Part I. Question: two strings: s1 and s2 part of s1 is identical to part of s2 space is separator how to extract the identical part(s)? example 1: s1 = "12 November 2010 - 1 visitor" s2 = "6 July 2010 - 100 visitors" the identical parts are "2010", "-", "1" and "visitor" example 2: s1 = "Welcome, John!" s2 = "Welcome, Peter!" the identical parts are "Welcome," and "!" Python and Ruby preferred. Thanks

    Read the article

  • InvalidOperationException sequence contains more than one element even when only one element

    - by user310256
    I have three tables, tblCompany table, tblParts table and a link table between them tblLinkCompanyParts. Since tblLinkCompanyParts is a link table so the columns that it has are LinkCompanyPartID(primary key), CompanyID from tblCompany table and PartID from tblParts as foreign keys. I have tied them up in the dbml file. In code if I write LinkCompanyParts.Parts (where LinkCompanyParts is an object of the tblLinkCompanyParts type) to get to the corresponding Part object I get the "InvalidOperationException: Sequence constains more than one element". I have looked at the data in the database and there is only one Parts record associated with the LinkCompanyPartID. The stack trace reads like at System.Linq.Enumerable.SingleOrDefault[TSource](IEnumerable`1 source) at System.Data.Linq.EntityRef`1.get_Entity() at ... I read about SingleOrDefault vs FirstOrDefault but since the link table should have a one-one mapping therefore I think SingleOrDefault should work and besides "SingleOrDefault" statement is being generated behind the scenes in the designer.cs file at the following line return this._Part.Entity; Any ideas?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • What sort of object is this and how to use it?

    - by Gary
    What would be the correct name for this type of array? There are 3 main sections and 4 sub-parts consisting of "issuedTime" "text" "url" and "validToTime", how do you start to convert this to an object? If there was only 1 main section, it would be fairly simple to do however with 3 main parts and no identification for each main section has me scratching my head as where to start. Any advise appreciated. [{ "issuedTime":"7:13pm Sunday 13 June 2010", "text":"\nAmended 7:10pm.\n\nText text and more text\n", "url":"\/folder\/fc\/name.png", "validToTime":"12:00am Monday 14 June 2010" },{ "issuedTime":"8:33pm Sunday 13 June 2010", "text":"\nText and more text.\n", "url":"\/folder\/fc\/name.png", "validToTime":"12:00pm Monday 14 June 2010" },{ "issuedTime":"10:40am Sunday 13 June 2010", "text":"\nAnd even more text.", "url":"\/folder\/fc\/name.png", "validToTime":"12:00am Tuesday 15 June 2010" } ]

    Read the article

  • Why Doesn't This Java Code Skip Lines with #?

    - by Nathan
    I'm trying to allow an external .txt file that is read by a Java script be able to have some comments in the beginning of the file so others can easily edit it and add more to it. But if the file contains # (the sign designated for a line that is a comment) it just returns the error that there is a "Format Error in file" (the IOException - so it is getting past that first "IF"...) Can someone help? Here's the portion of the code that deals with commenting lines out of the .txt file being called earlier in the script: while ((line = br.readLine()) != null) { line = line.trim(); if (line.length() < 1 || line.charAt(0) == '#') { // ignore comments continue; } final String[] parts = line.split("="); if (parts.length != 2) { throw new IOException("Format error in file " + JLanguageTool.getDataBroker().getFromRulesDirAsUrl(getFileName()) + ", line: " + line); }

    Read the article

  • preg_replace only replaces first occurrence then skips to next line

    - by Dom
    Got a problem where preg_replace only replaces the first match it finds then jumps to the next line and skips the remaining parts on the same line that I also want to be replaced. What I do is that I read a CSS file that sometimes have multiple "url(media/pic.gif)" on a row and replace "media/pic.gif" (the file is then saved as a copy with the replaced parts). The content of the CSS file is put into the variable $resource_content: $resource_content = preg_replace('#(url\((\'|")?)(.*)((\'|")?\))#i', '${1}'.url::base(FALSE).'${3}'.'${4}', $resource_content); Does anyone know a solution for why it only replaces the first match per line?

    Read the article

< Previous Page | 28 29 30 31 32 33 34 35 36 37 38 39  | Next Page >