Search Results

Search found 8725 results on 349 pages for 'beginning steps'.

Page 323/349 | < Previous Page | 319 320 321 322 323 324 325 326 327 328 329 330  | Next Page >

  • What am I doing wrong with this use of StructLayout( LayoutKind.Explicit ) when calling a PInvoke st

    - by csharptest.net
    The following is a complete program. It works fine as long as you don't uncomment the '#define BROKEN' at the top. The break is due to a PInvoke failing to marshal a union correctly. The INPUT_RECORD structure in question has a number of substructures that might be used depending on the value in EventType. What I don't understand is that when I define only the single child structure of KEY_EVENT_RECORD it works with the explicit declaration at offset 4. But when I add the other structures at the same offset the structure's content get's totally hosed. //UNCOMMENT THIS LINE TO BREAK IT: //#define BROKEN using System; using System.Runtime.InteropServices; class ConIOBroken { static void Main() { int nRead = 0; IntPtr handle = GetStdHandle(-10 /*STD_INPUT_HANDLE*/); Console.Write("Press the letter: 'a': "); INPUT_RECORD record = new INPUT_RECORD(); do { ReadConsoleInputW(handle, ref record, 1, ref nRead); } while (record.EventType != 0x0001/*KEY_EVENT*/); Assert.AreEqual((short)0x0001, record.EventType); Assert.AreEqual(true, record.KeyEvent.bKeyDown); Assert.AreEqual(0x00000000, record.KeyEvent.dwControlKeyState & ~0x00000020);//strip num-lock and test Assert.AreEqual('a', record.KeyEvent.UnicodeChar); Assert.AreEqual((short)0x0001, record.KeyEvent.wRepeatCount); Assert.AreEqual((short)0x0041, record.KeyEvent.wVirtualKeyCode); Assert.AreEqual((short)0x001e, record.KeyEvent.wVirtualScanCode); } static class Assert { public static void AreEqual(object x, object y) { if (!x.Equals(y)) throw new ApplicationException(); } } [DllImport("Kernel32.dll", CharSet = CharSet.Unicode, SetLastError = true)] public static extern IntPtr GetStdHandle(int nStdHandle); [DllImport("Kernel32.dll", CharSet = CharSet.Unicode, SetLastError = true)] public static extern bool ReadConsoleInputW(IntPtr hConsoleInput, ref INPUT_RECORD lpBuffer, int nLength, ref int lpNumberOfEventsRead); [StructLayout(LayoutKind.Explicit)] public struct INPUT_RECORD { [FieldOffset(0)] public short EventType; //union { [FieldOffset(4)] public KEY_EVENT_RECORD KeyEvent; #if BROKEN [FieldOffset(4)] public MOUSE_EVENT_RECORD MouseEvent; [FieldOffset(4)] public WINDOW_BUFFER_SIZE_RECORD WindowBufferSizeEvent; [FieldOffset(4)] public MENU_EVENT_RECORD MenuEvent; [FieldOffset(4)] public FOCUS_EVENT_RECORD FocusEvent; //} #endif } [StructLayout(LayoutKind.Sequential)] public struct KEY_EVENT_RECORD { public bool bKeyDown; public short wRepeatCount; public short wVirtualKeyCode; public short wVirtualScanCode; public char UnicodeChar; public int dwControlKeyState; } [StructLayout(LayoutKind.Sequential)] public struct MOUSE_EVENT_RECORD { public COORD dwMousePosition; public int dwButtonState; public int dwControlKeyState; public int dwEventFlags; }; [StructLayout(LayoutKind.Sequential)] public struct WINDOW_BUFFER_SIZE_RECORD { public COORD dwSize; } [StructLayout(LayoutKind.Sequential)] public struct MENU_EVENT_RECORD { public int dwCommandId; } [StructLayout(LayoutKind.Sequential)] public struct FOCUS_EVENT_RECORD { public bool bSetFocus; } [StructLayout(LayoutKind.Sequential)] public struct COORD { public short X; public short Y; } } UPDATE: For those worried about the struct declarations themselves: bool is treated as a 32-bit value the reason for offset(4) on the data is to allow for the 32-bit structure alignment which prevents the union from beginning at offset 2. Again, my problem isn't making PInvoke work at all, it's trying to figure out why these additional structures (supposedly at the same offset) are fowling up the data by simply adding them.

    Read the article

  • Web reference problem on WCF

    - by kaivalya
    I have a WCF service which I am able to connect to from my web application and get data. I now added a web reference to this wcf project to a wsdl file that a shipping company provides. Intention is to get shipping quotes.. I am able to access the objects that are generated from this wsdl file but when I call service.Authenticate("DEMO"); method almost nothing happens. I debug and see the debugger continue to the next lines but there is no change on service parameters and service.isauthorized is null.. Can you lead me to how I should debug this further and things I should check, or if there are additional steps that I need to ensure to have a web reference working on wcf app Thanks using System; using System.Collections.Generic; using System.Linq; using System.Runtime.Serialization; using System.ServiceModel; using System.Text; using ShippingCalculator.com.freight.api; namespace ShippingCalculator { public class ShippingService : IShippingService { freight_service service = new freight_service(); public string GetData(int value) { service.setConnectionType(".net"); service.Authenticate("DEMO"); OriginRequest origin = new OriginRequest(); origin.zip = "60101"; DestinationRequest destination = new DestinationRequest(); destination.zip = "10001"; PackageRequest package = new PackageRequest(); package.weight = "10"; ShipmentInfoRequest shipmentInfo = new ShipmentInfoRequest(); shipmentInfo.ship_date = DateTime.Now.AddDays(5); service.setOrigin(origin); service.setDestination(destination); service.setPackage(package); service.setShipmentInfo(shipmentInfo); Quote quote = service.getQuote(); return string.Format("Quote Number: {0}<br /> ", quote.QuoteNumber); } } } using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.Mvc; using ShippingTestApp.ShippingServiceReference; namespace ShippingTestApp.Controllers { [HandleError] public class HomeController : Controller { public ActionResult Index() { ShippingServiceClient shipClient = new ShippingServiceClient(); shipClient.GetData(0); ViewData["Message"] = shipClient.GetData(0); return View(); } } }

    Read the article

  • sharepoint custom aspx page with database connection

    - by Megini
    hi there i have created a custom aspx page whithin my sharepoint site with a sql server connection to a database on that server to select data when i view the page it works but when another user tries to view it it gives the following error : Server Error in '/' Application. Login failed for user 'GRINCOR\GuguK'. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.SqlClient.SqlException: Login failed for user 'GRINCOR\GuguK'. Source Error: The source code that generated this unhandled exception can only be shown when compiled in debug mode. To enable this, please follow one of the below steps, then request the URL: Add a "Debug=true" directive at the top of the file that generated the error. Example: <%@ Page Language="C#" Debug="true" % or: 2) Add the following section to the configuration file of your application: Note that this second technique will cause all files within a given application to be compiled in debug mode. The first technique will cause only that particular file to be compiled in debug mode. Important: Running applications in debug mode does incur a memory/performance overhead. You should make sure that an application has debugging disabled before deploying into production scenario. Stack Trace: [SqlException (0x80131904): Login failed for user 'GRINCOR\GuguK'.] System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) +248 System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) +245 System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) +2811 System.Data.SqlClient.SqlInternalConnectionTds.CompleteLogin(Boolean enlistOK) +53 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, Int64 timerExpire, SqlConnection owningObject) +327 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(String host, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, Int64 timerStart) +2445370 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +2445224 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +354 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +703 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +54 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +2414776 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +92 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +1657 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +84 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +1645767 System.Data.SqlClient.SqlConnection.Open() +258 ASP.d7922f0d_ac20_4f87_91a2_a99a52c2b2fa__233736835.DisplayData() in C:\inetpub\wwwroot\wss\VirtualDirectories\80\sites\hrportal2\tester.aspx:151 ASP.d7922f0d_ac20_4f87_91a2_a99a52c2b2fa_233736835._RenderMain(HtmlTextWriter __w, Control parameterContainer) in C:\inetpub\wwwroot\wss\VirtualDirectories\80\sites\hrportal2\tester.aspx:346 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +115 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +42 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlForm.RenderChildren(HtmlTextWriter writer) +253 System.Web.UI.HtmlControls.HtmlForm.Render(HtmlTextWriter output) +87 System.Web.UI.HtmlControls.HtmlForm.RenderControl(HtmlTextWriter writer) +53 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +42 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.Page.Render(HtmlTextWriter writer) +38 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +4240 Version Information: Microsoft .NET Framework Version:2.0.50727.3603; ASP.NET Version:2.0.50727.3601 can someone give me a solution to this problem ? i am using sharepoint services 3.0

    Read the article

  • What does the `forall` keyword in Haskell/GHC do?

    - by JUST MY correct OPINION
    I've been banging my head on this one for (quite literally) years now. I'm beginning to kinda/sorta understand how the foreach keyword is used in so-called "existential types" like this: data ShowBox = forall s. Show s => SB s (This despite the confusingly-worded explanations of it in the fragments found all around the web.) This is only a subset, however, of how foreach is used and I simply cannot wrap my mind around its use in things like this: runST :: forall a. (forall s. ST s a) -> a Or explaining why these are different: foo :: (forall a. a -> a) -> (Char,Bool) bar :: forall a. ((a -> a) -> (Char, Bool)) Or the whole RankNTypes stuff that breaks my brain when "explained" in a way that makes me want to do that Samuel L. Jackson thing from Pulp Fiction. (Don't follow that link if you're easily offended by strong language.) The problem, really, is that I'm a dullard. I can't fathom the chicken scratchings (some call them "formulae") of the elite mathematicians that created this language seeing as my university years are over two decades behind me and I never actually had to put what I learnt into use in practice. I also tend to prefer clear, jargon-free English rather than the kinds of language which are normal in academic environments. Most of the explanations I attempt to read on this (the ones I can find through search engines) have these problems: They're incomplete. They explain one part of the use of this keyword (like "existential types") which makes me feel happy until I read code that uses it in a completely different way (like runST, foo and bar above). They're densely packed with assumptions that I've read the latest in whatever branch of discrete math, category theory or abstract algebra is popular this week. (If I never read the words "consult the paper whatever for details of implementation" again, it will be too soon.) They're written in ways that frequently turn even simple concepts into tortuously twisted and fractured grammar and semantics. (I suspect that the last two items are the biggest problem. I wouldn't know, though, since I'm too much a dullard to comprehend them.) It's been asked why Haskell never really caught on in industry. I suspect, in my own humble, unintelligent way, that my experience in figuring out one stupid little keyword -- a keyword that is increasingly ubiquitous in the libraries being written these days -- are also part of the answer to that question. It's hard for a language to catch on when even its individual keywords cause years-long quests to comprehend. Years-long quests which end in failure. So... On to the actual question. Can anybody completely explain the foreach keyword in clear, plain English (or, if it exists somewhere, point to such a clear explanation which I've missed) that doesn't assume I'm a mathematician steeped in the jargon?

    Read the article

  • Smoke testing a .NET web application

    - by pdr
    I cannot believe I'm the first person to go through this thought process, so I'm wondering if anyone can help me out with it. Current situation: developers write a web site, operations deploy it. Once deployed, a developer Smoke Tests it, to make sure the deployment went smoothly. To me this feels wrong, it essentially means it takes two people to deploy an application; in our case those two people are on opposite sides of the planet and timezones come into play, causing havoc. But the fact remains that developers know what the minimum set of tests is and that may change over time (particularly for the web service portion of our app). Operations, with all due respect to them (and they would say this themselves), are button-pushers who need a set of instructions to follow. The manual solution is that we document the test cases and operations follow that document each time they deploy. That sounds painful, plus they may be deploying different versions to different environments (specifically UAT and Production) and may need a different set of instructions for each. On top of this, one of our near-future plans is to have an automated daily deploy environment, so then we'll have to instruct a computer as to how to deploy a given version of our app. I would dearly like to add to that instructions for how to smoke test the app. Now developers are better at documenting instructions for computers than they are for people, so the obvious solution seems to be to use a combination of nUnit (I know these aren't unit tests per se, but it is a built-for-purpose test runner) and either the Watin or Selenium APIs to run through the obvious browser steps and call to the web service and explain to the Operations guys how to run those unit tests. I can do that; I have mostly done it already. But wouldn't it be nice if I could make that process simpler still? At this point, the Operations guys and the computer are going to have to know which set of tests relate to which version of the app and tell the nUnit runner which base URL it should point to (say, www.example.com = v3.2 or test.example.com = v3.3). Wouldn't it be nicer if the test runner itself had a way of giving it a base URL and letting it download say a zip file, unpack it and edit a configuration file automatically before running any test fixtures it found in there? Is there an open source app that would do that? Is there a need for one? Is there a solution using something other than nUnit, maybe Fitnesse? For the record, I'm looking at .NET-based tools first because most of the developers are primarily .NET developers, but we're not married to it. If such a tool exists using other languages to write the tests, we'll happily adapt, as long as there is a test runner that works on Windows.

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Makefile issue with compiling a C++ program

    - by Steve
    I recently got MySQL compiled and working on Cygwin, and got a simple test example from online to verify that it worked. The test example compiled and ran successfully. However, when incorporating MySQL in a hobby project of mine it isn't compiling which I believe is due to how the Makefile is setup, I have no experience with Makefiles and after reading tutorials about them, I have a better grasp but still can't get it working correctly. When I try and compile my hobby project I recieve errors such as: Obj/Database.o:Database.cpp:(.text+0x492): undefined reference to `_mysql_insert_id' Obj/Database.o:Database.cpp:(.text+0x4c1): undefined reference to `_mysql_affected_rows' collect2: ld returned 1 exit status make[1]: *** [build] Error 1 make: *** [all] Error 2 Here is my Makefile, it worked with compiling and building the source before I attempted to put in MySQL support into the project. The LIBMYSQL paths are correct, verified by 'mysql_config'. COMPILER = g++ WARNING1 = -Wall -Werror -Wformat-security -Winline -Wshadow -Wpointer-arith WARNING2 = -Wcast-align -Wcast-qual -Wredundant-decls LIBMYSQL = -I/usr/local/include/mysql -L/usr/local/lib/mysql -lmysqlclient DEBUGGER = -g3 OPTIMISE = -O C_FLAGS = $(OPTIMISE) $(DEBUGGER) $(WARNING1) $(WARNING2) -export-dynamic $(LIBMYSQL) L_FLAGS = -lz -lm -lpthread -lcrypt $(LIBMYSQL) OBJ_DIR = Obj/ SRC_DIR = Source/ MUD_EXE = project MUD_DIR = TestP/ LOG_DIR = $(MUD_DIR)Files/Logs/ ECHOCMD = echo -e L_GREEN = \e[1;32m L_WHITE = \e[1;37m L_BLUE = \e[1;34m L_RED = \e[1;31m L_NRM = \e[0;00m DATE = `date +%d-%m-%Y` FILES = $(wildcard $(SRC_DIR)*.cpp) C_FILES = $(sort $(FILES)) O_FILES = $(patsubst $(SRC_DIR)%.cpp, $(OBJ_DIR)%.o, $(C_FILES)) all: @$(ECHOCMD) " Compiling $(L_RED)$(MUD_EXE)$(L_NRM)."; @$(MAKE) -s build build: $(O_FILES) @rm -f $(MUD_EXE) $(COMPILER) -o $(MUD_EXE) $(L_FLAGS) $(O_FILES) @echo " Finished Compiling $(MUD_EXE)."; @chmod g+w $(MUD_EXE) @chmod a+x $(MUD_EXE) @chmod g+w $(O_FILES) $(OBJ_DIR)%.o: $(SRC_DIR)%.cpp @echo " Compiling $@"; $(COMPILER) -c $(C_FLAGS) $< -o $@ .cpp.o: $(COMPILER) -c $(C_FLAGS) $< clean: @echo " Complete compile on $(MUD_EXE)."; @rm -f $(OBJ_DIR)*.o $(MUD_EXE) @$(MAKE) -s build I like the functionality of the Makefile, instead of spitting out all the arguments etc, it just spits out the "Compiling [Filename]" etc. If I add -c to the L_FLAGS then it compiles (I think) but instead spits out stuff like: g++: Obj/Database.o: linker input file unused because linking not done After a full day of trying and research on google, I'm no closer to solving my problem, so I come to you guys to see if you can explain to me why all this is happening and if possible, steps to solve. Regards, Steve

    Read the article

  • Unit testing authorization in a Pylons app fails; cookies aren't been correctly set or recorded

    - by Ian Stevens
    I'm having an issue running unit tests for authorization in a Pylons app. It appears as though certain cookies set in the test case may not be correctly written or parsed. Cookies work fine when hitting the app with a browser. Here is my test case inside a paste-generated TestController: def test_good_login(self): r = self.app.post('/dologin', params={'login': self.user['username'], 'password': self.password}) r = r.follow() # Should only be one redirect to root assert 'http://localhost/' == r.request.url assert 'Dashboard' in r This is supposed to test that a login of an existing account forwards the user to the dashboard page. Instead, what happens is that the user is redirected back to the login. The first POST works, sets the user in the session and returns cookies. Although those cookies are sent in the follow request, they don't seem to be correctly parsed. I start by setting a breakpoint at the beginning of the above method and see what the login response returns: > nosetests --pdb --pdb-failure -s foo.tests.functional.test_account:TestMainController.test_good_login Running setup_config() from foo.websetup > /Users/istevens/dev/foo/foo/tests/functional/test_account.py(33)test_good_login() -> r = self.app.post('/dologin', params={'login': self.user['username'], 'password': self.password}) (Pdb) n > /Users/istevens/dev/foo/foo/tests/functional/test_account.py(34)test_good_login() -> r = r.follow() # Should only be one redirect to root (Pdb) p r.cookies_set {'auth_tkt': '"4c898eb72f7ad38551eb11e1936303374bd871934bd871833d19ad8a79000000!"'} (Pdb) p r.request.environ['REMOTE_USER'] '4bd871833d19ad8a79000000' (Pdb) p r.headers['Location'] 'http://localhost/?__logins=0' A session appears to be created and a cookie sent back. The browser is redirected to the root, not the login, which also indicates a successful login. If I step past the follow(), I get: > /Users/istevens/dev/foo/foo/tests/functional/test_account.py(35)test_good_login() -> assert 'http://localhost/' == r.request.url (Pdb) p r.request.headers {'Host': 'localhost:80', 'Cookie': 'auth_tkt=""\\"4c898eb72f7ad38551eb11e1936303374bd871934bd871833d19ad8a79000000!\\"""; '} (Pdb) p r.request.environ['REMOTE_USER'] *** KeyError: KeyError('REMOTE_USER',) (Pdb) p r.request.environ['HTTP_COOKIE'] 'auth_tkt=""\\"4c898eb72f7ad38551eb11e1936303374bd871934bd871833d19ad8a79000000!\\"""; ' (Pdb) p r.request.cookies {'auth_tkt': ''} (Pdb) p r <302 Found text/html location: http://localhost/login?__logins=1&came_from=http%3A%2F%2Flocalhost%2F body='302 Found...y. '/149> This indicates to me that the cookie was passed in on the request, although with dubious escaping. The environ appears to be without the session created on the prior request. The cookie has been copied to the environ from the headers, but the cookies in the request seems incorrectly set. Lastly, the user is redirected to the login page, indicating that the user isn't logged in. Authorization in the app is done via repoze.who and repoze.who.plugins.ldap with repoze.who_friendlyform performing the challenge. I'm using the stock tests.TestController created by paste: class TestController(TestCase): def __init__(self, *args, **kwargs): if pylons.test.pylonsapp: wsgiapp = pylons.test.pylonsapp else: wsgiapp = loadapp('config:%s' % config['__file__']) self.app = TestApp(wsgiapp) url._push_object(URLGenerator(config['routes.map'], environ)) TestCase.__init__(self, *args, **kwargs) That's a webtest.TestApp, by the way. The encoding of the cookie is done in webtest.TestApp using Cookie: >>> from Cookie import _quote >>> _quote('"84533cf9f661f97239208fb844a09a6d4bd8552d4bd8550c3d19ad8339000000!"') '"\\"84533cf9f661f97239208fb844a09a6d4bd8552d4bd8550c3d19ad8339000000!\\""' I trust that that's correct. My guess is that something on the response side is incorrectly parsing the cookie data into cookies in the server-side request. But what? Any ideas?

    Read the article

  • Parallel programming in C#

    - by Alxandr
    I'm interested in learning about parallel programming in C#.NET (not like everything there is to know, but the basics and maybe some good-practices), therefore I've decided to reprogram an old program of mine which is called ImageSyncer. ImageSyncer is a really simple program, all it does is to scan trough a folder and find all files ending with .jpg, then it calculates the new position of the files based on the date they were taken (parsing of xif-data, or whatever it's called). After a location has been generated the program checks for any existing files at that location, and if one exist it looks at the last write-time of both the file to copy, and the file "in its way". If those are equal the file is skipped. If not a md5 checksum of both files is created and matched. If there is no match the file to be copied is given a new location to be copied to (for instance, if it was to be copied to "C:\test.jpg" it's copied to "C:\test(1).jpg" instead). The result of this operation is populated into a queue of a struct-type that contains two strings, the original file and the position to copy it to. Then that queue is iterated over untill it is empty and the files are copied. In other words there are 4 operations: 1. Scan directory for jpegs 2. Parse files for xif and generate copy-location 3. Check for file existence and if needed generate new path 4. Copy files And so I want to rewrite this program to make it paralell and be able to perform several of the operations at the same time, and I was wondering what the best way to achieve that would be. I've came up with two different models I can think of, but neither one of them might be any good at all. The first one is to parallelize the 4 steps of the old program, so that when step one is to be executed it's done on several threads, and when the entire of step 1 is finished step 2 is began. The other one (which I find more interesting because I have no idea of how to do that) is to create a sort of worker and consumer model, so when a thread is finished with step 1 another one takes over and performs step 2 at that object (or something like that). But as said, I don't know if any of these are any good solutions. Also, I don't know much about parallel programming at all. I know how to make a thread, and how to make it perform a function taking in an object as its only parameter, and I've also used the BackgroundWorker-class on one occasion, but I'm not that familiar with any of them. Any input would be appreciated.

    Read the article

  • Dynamically loading modules in Python (+ multi processing question)

    - by morpheous
    I am writing a Python package which reads the list of modules (along with ancillary data) from a configuration file. I then want to iterate through each of the dynamically loaded modules and invoke a do_work() function in it which will spawn a new process, so that the code runs ASYNCHRONOUSLY in a separate process. At the moment, I am importing the list of all known modules at the beginning of my main script - this is a nasty hack I feel, and is not very flexible, as well as being a maintenance pain. This is the function that spawns the processes. I will like to modify it to dynamically load the module when it is encountered. The key in the dictionary is the name of the module containing the code: def do_work(work_info): for (worker, dataset) in work_info.items(): #import the module defined by variable worker here... # [Edit] NOT using threads anymore, want to spawn processes asynchronously here... #t = threading.Thread(target=worker.do_work, args=[dataset]) # I'll NOT dameonize since spawned children need to clean up on shutdown # Since the threads will be holding resources #t.daemon = True #t.start() Question 1 When I call the function in my script (as written above), I get the following error: AttributeError: 'str' object has no attribute 'do_work' Which makes sense, since the dictionary key is a string (name of the module to be imported). When I add the statement: import worker before spawning the thread, I get the error: ImportError: No module named worker This is strange, since the variable name rather than the value it holds are being used - when I print the variable, I get the value (as I expect) whats going on? Question 2 As I mentioned in the comments section, I realize that the do_work() function written in the spawned children needs to cleanup after itself. My understanding is to write a clean_up function that is called when do_work() has completed successfully, or an unhandled exception is caught - is there anything more I need to do to ensure resources don't leak or leave the OS in an unstable state? Question 3 If I comment out the t.daemon flag statement, will the code stil run ASYNCHRONOUSLY?. The work carried out by the spawned children are pretty intensive, and I don't want to have to be waiting for one child to finish before spawning another child. BTW, I am aware that threading in Python is in reality, a kind of time sharing/slicing - thats ok Lastly is there a better (more Pythonic) way of doing what I'm trying to do? [Edit] After reading a little more about Pythons GIL and the threading (ahem - hack) in Python, I think its best to use separate processes instead (at least IIUC, the script can take advantage of multiple processes if they are available), so I will be spawning new processes instead of threads. I have some sample code for spawning processes, but it is a bit trivial (using lambad functions). I would like to know how to expand it, so that it can deal with running functions in a loaded module (like I am doing above). This is a snippet of what I have: def do_mp_bench(): q = mp.Queue() # Not only thread safe, but "process safe" p1 = mp.Process(target=lambda: q.put(sum(range(10000000)))) p2 = mp.Process(target=lambda: q.put(sum(range(10000000)))) p1.start() p2.start() r1 = q.get() r2 = q.get() return r1 + r2 How may I modify this to process a dictionary of modules and run a do_work() function in each loaded module in a new process?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Why doe my UITableView only show two rows of each section?

    - by Mike Owens
    I have a UITableView and when I build it only two rows will be displayed. Each section has more than two cells to be displayed, I am confused since they are all done the same?`#import #import "Store.h" import "VideoViewController.h" @implementation Store @synthesize listData; // Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { [self createTableData]; [super viewDidLoad]; } (void)didReceiveMemoryWarning { // Releases the view if it doesn't have a superview. [super didReceiveMemoryWarning]; // Release any cached data, images, etc that aren't in use. } (void)viewDidUnload { //self.listData = nil; //[super viewDidUnload]; // Release any retained subviews of the main view. // e.g. self.myOutlet = nil; } pragma mark - pragma mark Table View Data Source Methods // Customize the number of sections in the table view. - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return [videoSections count]; } //Get number of rows -(NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { return [self.listData count]; } -(UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *StoreTableIdentifier = @"StoreTableIdentifier"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:StoreTableIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:StoreTableIdentifier] autorelease]; } cell.textLabel.text = [[[listData objectAtIndex:indexPath.section] objectAtIndex:indexPath.row] objectForKey:@"name"]; //Change font and color of tableView cell.accessoryType = UITableViewCellAccessoryDisclosureIndicator; cell.textLabel.font=[UIFont fontWithName:@"Georgia" size:16.0]; cell.textLabel.textColor = [UIColor brownColor]; return cell; } -(NSString *)tableView: (UITableView *)tableView titleForHeaderInSection: (NSInteger) section { return [videoSections objectAtIndex:section]; } -(void)tableView: (UITableView *)tableView didSelectRowAtIndexPath: (NSIndexPath *)indexPath { VideoViewController *videoViewController = [[VideoViewController alloc] initWithNibName: @"VideoViewController" bundle:nil]; videoViewController.detailURL = [[NSURL alloc] initWithString: [[[listData objectAtIndex:indexPath.section] objectAtIndex:indexPath.row] objectForKey:@"url"]]; videoViewController.title = [[[listData objectAtIndex:indexPath.section] objectAtIndex:indexPath.row] objectForKey:@"name"]; [self.navigationController pushViewController:videoViewController animated:YES]; [videoViewController release]; } pragma mark Table View Methods //Data in table cell -(void) createTableData { NSMutableArray *beginningVideos; NSMutableArray *intermediateVideos; videoSections = [[NSMutableArray alloc] initWithObjects: @"Beginning Videos", @"Intermediate Videos", nil]; beginningVideos = [[NSMutableArray alloc] init]; intermediateVideos = [[NSMutableArray alloc] init]; [beginningVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Shirts", @"name", @"http://www.andalee.com/iPhoneVideos/testMovie.m4v", @"url", nil]]; [beginningVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Posters", @"name", @"http://devimages.apple.com/iphone/samples/bipbopall.html", @"url", nil]]; [beginningVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Stickers",@"name", @"http://www.andalee.com/iPhoneVideos/mov.MOV",@"url",nil]]; [beginningVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Egyptian",@"name", @"http://www.andalee.com/iPhoneVideos/2ndMovie.MOV",@"url",nil]]; [intermediateVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Drum Solo", @"name", @"http://www.andalee.com", @"url", nil]]; [intermediateVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Veil", @"name", @"http://www.andalee.com", @"url", nil]]; [intermediateVideos addObject:[[NSMutableDictionary alloc] initWithObjectsAndKeys:@"Three Quarter Shimmy",@"name", @"http://www.andalee.com", @"url",nil]]; listData = [[NSMutableArray alloc] initWithObjects:beginningVideos, intermediateVideos, nil]; [beginningVideos release]; [intermediateVideos release]; } (void)dealloc { [listData release]; [videoSections release]; [super dealloc]; } @end `

    Read the article

  • Greasemonkey is getting an empty document.body on select Google pages.

    - by Brock Adams
    Hi, I have a Greasemonkey script that processes Google search results. But it's failing in a few instances, when xpath searches (and document body) appear to be empty. Running the code in Firebug's console works every time. It only fails in a Greasemonkey script. Greasemonkey sees an empty document.body. I've boiled the problem down to a test, greasemonkey script, below. I'm using Firefox 3.5.9 and Greasemonkey 0.8.20100408.6 (but earlier versions had the same problem). Problem: Greasemonkey sees an empty document.body. Recipe to Duplicate: Install the Greasemonkey script. Open a new tab or window. Navigate to Google.com (http://www.google.com/). Search on a simple term like "cats". Check Firefox's Error console (Ctrl-shift-J) or Firebug's console. The script will report that document body is empty. Hit refresh. The script will show a good result (document body found). Note that the failure only reliably appears on Google results obtained this way, and on a new tab/window. Turn javascript off globally (javascript.enabled set to false in about:config). Repeat steps 2 thru 5. Only now the Greasemonkey script will work. It seems that Google javascript is killing the DOM tree for greasemonkey, somehow. I've tried a time-delayed retest and even a programmatic refresh; the script still fails to see the document body. Test Script: // // ==UserScript== // @name TROUBLESHOOTING 2 snippets // @namespace http://www.google.com/ // @description For code that has funky misfires and defies standard debugging. // @include http://*/* // ==/UserScript== // function LocalMain (sTitle) { var sUserMessage = ''; //var sRawHtml = unsafeWindow.document.body.innerHTML; //-- unsafeWindow makes no difference. var sRawHtml = document.body.innerHTML; if (sRawHtml) { sRawHtml = sRawHtml.replace (/^\s\s*/, ''). substr (0, 60); sUserMessage = sTitle + ', Doc body = ' + sRawHtml + ' ...'; } else { sUserMessage = sTitle + ', Document body seems empty!'; } if (typeof (console) != "undefined") { console.log (sUserMessage); } else { if (typeof (GM_log) != "undefined") GM_log (sUserMessage); else if (!sRawHtml) alert (sUserMessage); } } LocalMain ('Preload'); window.addEventListener ("load", function() {LocalMain ('After load');}, false);

    Read the article

  • SSL Authentication with Certificates: Should the Certificates have a hostname?

    - by sixtyfootersdude
    Summary JBoss allows clients and servers to authenticate using certificates and ssl. One thing that seems strange is that you are not required to give your hostname on the certificate. I think that this means if Server B is in your truststore, Sever B can pretend to be any server that they want. (And likewise: if Client B is in your truststore...) Am I missing something here? Authentication Steps (Summary of Wikipeida Page) Client Server ================================================================================================= 1) Client sends Client Hello ENCRIPTION: None - highest TLS protocol supported - random number - list of cipher suites - compression methods 2) Sever Hello ENCRIPTION: None - highest TLS protocol supported - random number - choosen cipher suite - choosen compression method 3) Certificate Message ENCRIPTION: None - 4) ServerHelloDone ENCRIPTION: None 5) Certificate Message ENCRIPTION: None 6) ClientKeyExchange Message ENCRIPTION: server's public key => only server can read => if sever can read this he must own the certificate - may contain a PreMasterSecerate, public key or nothing (depends on cipher) 7) CertificateVerify Message ENCRIPTION: clients private key - purpose is to prove to the server that client owns the cert 8) BOTH CLIENT AND SERVER: - use random numbers and PreMasterSecret to compute a common secerate 9) Finished message - contains a has and MAC over previous handshakes (to ensure that those unincripted messages did not get broken) 10) Finished message - samething Sever Knows The client has the public key for the sent certificate (step 7) The client's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the server's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Client Knows The server has the public key for the sent certificate (step 6 with step 8) The server's certificate is valid because either: it has been signed by a CA (verisign) it has been self-signed BUT it is in the client's truststore It is not a replay attack because presumably the random number (step 1 or 2) is sent with each message Potential Problem Suppose the client's truststore has certs in it: Server A Server B (malicous) Server A has hostname www.A.com Server B has hostname www.B.com Suppose: The client tries to connect to Server A but Server B launches a man in the middle attack. Since server B: has a public key for the certificate that will be sent to the client has a "valid certificate" (a cert in the truststore) And since: certificates do not have a hostname feild in them It seems like Server B can pretend to be Server A easily. Is there something that I am missing?

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • log4bash: Cannot find a way to add MaxBackupIndex to this logger implementation

    - by Syffys
    I have been trying to modify this log4bash implementation but I cannot manage to make it work. Here's a sample: #!/bin/bash TRUE=1 FALSE=0 ############### Added for testing log4bash_LOG_ENABLED=$TRUE log4bash_rootLogger=$TRACE,f,s log4bash_appender_f=file log4bash_appender_f_dir=$(pwd) log4bash_appender_f_file=test.log log4bash_appender_f_roll_format=%Y%m log4bash_appender_f_roll=$TRUE log4bash_appender_f_maxBackupIndex=10 #################################### log4bash_abs(){ if [ "${1:0:1}" == "." ]; then builtin echo ${rootDir}/${1} else builtin echo ${1} fi } log4bash_check_app_dir(){ if [ "$log4bash_LOG_ENABLED" -eq $TRUE ]; then dir=$(log4bash_abs $1) if [ ! -d ${dir} ]; then #log a seperation line mkdir $dir fi fi } # Delete old log files # $1 Log directory # $2 Log filename # $3 Log filename suffix # $4 Max backup index log4bash_delete_old_files(){ ##### Added for testing builtin echo "Running log4bash_delete_old_files $@" &2 ##### if [ "$log4bash_LOG_ENABLED" -eq $TRUE ] && [ -n "$3" ] && [ "$4" -gt 0 ]; then local directory=$(log4bash_abs $1) local filename=$2 local maxBackupIndex=$4 local suffix=$(echo "${3}" | sed -re 's/[^.]/?/g') local logFileList=$(find "${directory}" -mindepth 1 -maxdepth 1 -name "${filename}${suffix}" -type f | xargs ls -1rt) local fileCnt=$(builtin echo -e "${logFileList}" | wc -l) local fileToDeleteCnt=$(($fileCnt-$maxBackupIndex)) local fileToDelete=($(builtin echo -e "${logFileList}" | head -n "${fileToDeleteCnt}" | sed ':a;N;$!ba;s/\n/ /g')) ##### Added for testing builtin echo "log4bash_delete_old_files About to start deletion ${fileToDelete[@]}" &2 ##### if [ ${fileToDeleteCnt} -gt 0 ]; then for f in "${fileToDelete[@]}"; do #### Added for testing builtin echo "Removing file ${f}" &2 #### builtin eval rm -f ${f} done fi fi } #Appender # $1 Log directory # $2 Log file # $3 Log file roll ? # $4 Appender Name log4bash_filename(){ builtin echo "Running log4bash_filename $@" &2 local format local filename log4bash_check_app_dir "${1}" if [ ${3} -eq 1 ];then local formatProp=${4}_roll_format format=${!formatProp} if [ -z ${format} ]; then format=$log4bash_appender_file_format fi local suffix=.`date "+${format}"` filename=${1}/${2}${suffix} # Old log files deletion local previousFilenameVar=int_${4}_file_previous local maxBackupIndexVar=${4}_maxBackupIndex if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then builtin eval export $previousFilenameVar=$filename log4bash_delete_old_files "${1}" "${2}" "${suffix}" "${!maxBackupIndexVar}" else builtin echo "log4bash_filename $previousFilenameVar = ${!previousFilenameVar}" fi else filename=${1}/${2} fi builtin echo $filename } ######################## Added for testing filename_caller(){ builtin echo "filename_caller Call $1" output=$(log4bash_abs $(log4bash_filename "${log4bash_appender_f_dir}" "${log4bash_appender_f_file}" "1" "log4bash_appender_f" )) builtin echo ${output} } #### Previous logs generation for i in {1101..1120}; do file="${log4bash_appender_f_file}.2012${i:2:3}" builtin echo "${file} $i" touch -m -t "2012${i}0000" ${log4bash_appender_f_dir}/$file done for i in {1..4}; do filename_caller $i done I expect log4bash_filename function to step into the following if only when the calculated log filename is different from the previous one: if [ -n "${!maxBackupIndexVar}" ] && [ "${!previousFilenameVar}" != "${filename}" ]; then For this scenario to apply, I'd need ${!previousFilenameVar} to be correctly set, but it's not the case, so log4bash_filename steps into this if all the time which is really not necessary... It looks like the issue is due to the following line not working properly: builtin eval export $previousFilenameVar=$filename I have a some theories to explain why: in the original code, functions are declared and exported as readonly which makes them unable to modify global variable. I removed readonly declarations in the above sample, but probleme persists. Function calls are performed in $() which should make them run into seperated shell instances so variable modified are not exported to the main shell But I cannot manage to find a workaround to this issue... Any help is appreciated, thanks in advance!

    Read the article

  • How would you implement this "WorkerChain" functionality in .NET?

    - by Dan Tao
    Sorry for the vague question title -- not sure how to encapsulate what I'm asking below succinctly. (If someone with editing privileges can think of a more descriptive title, feel free to change it.) The behavior I need is this. I am envisioning a worker class that accepts a single delegate task in its constructor (for simplicity, I would make it immutable -- no more tasks can be added after instantiation). I'll call this task T. The class should have a simple method, something like GetToWork, that will exhibit this behavior: If the worker is not currently running T, then it will start doing so right now. If the worker is currently running T, then once it is finished, it will start T again immediately. GetToWork can be called any number of times while the worker is running T; the simple rule is that, during any execution of T, if GetToWork was called at least once, T will run again upon completion (and then if GetToWork is called while T is running that time, it will repeat itself again, etc.). Now, this is pretty straightforward with a boolean switch. But this class needs to be thread-safe, by which I mean, steps 1 and 2 above need to comprise atomic operations (at least I think they do). There is an added layer of complexity. I have need of a "worker chain" class that will consist of many of these workers linked together. As soon as the first worker completes, it essentially calls GetToWork on the worker after it; meanwhile, if its own GetToWork has been called, it restarts itself as well. Logically calling GetToWork on the chain is essentially the same as calling GetToWork on the first worker in the chain (I would fully intend that the chain's workers not be publicly accessible). One way to imagine how this hypothetical "worker chain" would behave is by comparing it to a team in a relay race. Suppose there are four runners, W1 through W4, and let the chain be called C. If I call C.StartWork(), what should happen is this: If W1 is at his starting point (i.e., doing nothing), he will start running towards W2. If W1 is already running towards W2 (i.e., executing his task), then once he reaches W2, he will signal to W2 to get started, immediately return to his starting point and, since StartWork has been called, start running towards W2 again. When W1 reaches W2's starting point, he'll immediately return to his own starting point. If W2 is just sitting around, he'll start running immediately towards W3. If W2 is already off running towards W3, then W2 will simply go again once he's reached W3 and returned to his starting point. The above is probably a little convoluted and written out poorly. But hopefully you get the basic idea. Obviously, these workers will be running on their own threads. Also, I guess it's possible this functionality already exists somewhere? If that's the case, definitely let me know!

    Read the article

  • Replace conditional with polymorphism refactoring or similar?

    - by Anders Svensson
    Hi, I have tried to ask a variant of this question before. I got some helpful answers, but still nothing that felt quite right to me. It seems to me this shouldn't really be that hard a nut to crack, but I'm not able to find an elegant simple solution. (Here's my previous post, but please try to look at the problem stated here as procedural code first so as not to be influenced by the earlier explanation which seemed to lead to very complicated solutions: http://stackoverflow.com/questions/2772858/design-pattern-for-cost-calculator-app ) Basically, the problem is to create a calculator for hours needed for projects that can contain a number of services. In this case "writing" and "analysis". The hours are calculated differently for the different services: writing is calculated by multiplying a "per product" hour rate with the number of products, and the more products are included in the project, the lower the hour rate is, but the total number of hours is accumulated progressively (i.e. for a medium-sized project you take both the small range pricing and then add the medium range pricing up to the number of actual products). Whereas for analysis it's much simpler, it is just a bulk rate for each size range. How would you be able to refactor this into an elegant and preferably simple object-oriented version (please note that I would never write it like this in a purely procedural manner, this is just to show the problem in another way succinctly). I have been thinking in terms of factory, strategy and decorator patterns, but can't get any to work well. (I read Head First Design Patterns a while back, and both the decorator and factory patterns described have some similarities to this problem, but I have trouble seeing them as good solutions as stated there. The decorator example seems very complicated for just adding condiments, but maybe it could work better here, I don't know. And the factory pattern example with the pizza factory...well it just seems to create such a ridiculous explosion of classes, at least in their example. I have found good use for factory patterns before, but I can't see how I could use it here without getting a really complicated set of classes) The main goal would be to only have to change in one place (loose coupling etc) if I were to add a new parameter (say another size, like XSMALL, and/or another service, like "Administration"). Here's the procedural code example: public class Conditional { private int _numberOfManuals; private string _serviceType; private const int SMALL = 2; private const int MEDIUM = 8; public int GetHours() { if (_numberOfManuals <= SMALL) { if (_serviceType == "writing") return 30 * _numberOfManuals; if (_serviceType == "analysis") return 10; } else if (_numberOfManuals <= MEDIUM) { if (_serviceType == "writing") return (SMALL * 30) + (20 * _numberOfManuals - SMALL); if (_serviceType == "analysis") return 20; } else //i.e. LARGE { if (_serviceType == "writing") return (SMALL * 30) + (20 * (MEDIUM - SMALL)) + (10 * _numberOfManuals - MEDIUM); if (_serviceType == "analysis") return 30; } return 0; //Just a default fallback for this contrived example } } All replies are appreciated! I hope someone has a really elegant solution to this problem that I actually thought from the beginning would be really simple... Regards, Anders

    Read the article

  • mySQL to .XSL help

    - by kielie
    hi guys, I have to create a script that takes a mySQL table, and exports it into .XSL format, and then saves that file into a specified folder on the web host. I got it working, but now I can't seem to get it to automatically save the file to the location without prompting the user. It needs to run every day at a specified time, so it can save the previous days leads into a .XSL file on the web host. Here is the code: <?php // DB TABLE Exporter // // How to use: // // Place this file in a safe place, edit the info just below here // browse to the file, enjoy! // CHANGE THIS STUFF FOR WHAT YOU NEED TO DO $dbhost = "-"; $dbuser = "-"; $dbpass = "-"; $dbname = "-"; $dbtable = "-"; // END CHANGING STUFF $cdate = date("Y-m-d"); // get current date // first thing that we are going to do is make some functions for writing out // and excel file. These functions do some hex writing and to be honest I got // them from some where else but hey it works so I am not going to question it // just reuse // This one makes the beginning of the xls file function xlsBOF() { echo pack("ssssss", 0x809, 0x8, 0x0, 0x10, 0x0, 0x0); return; } // This one makes the end of the xls file function xlsEOF() { echo pack("ss", 0x0A, 0x00); return; } // this will write text in the cell you specify function xlsWriteLabel($Row, $Col, $Value ) { $L = strlen($Value); echo pack("ssssss", 0x204, 8 + $L, $Row, $Col, 0x0, $L); echo $Value; return; } // make the connection an DB query $dbc = mysql_connect( $dbhost , $dbuser , $dbpass ) or die( mysql_error() ); mysql_select_db( $dbname ); $q = "SELECT * FROM ".$dbtable." WHERE date ='$cdate'"; $qr = mysql_query( $q ) or die( mysql_error() ); // Ok now we are going to send some headers so that this // thing that we are going make comes out of browser // as an xls file. // header("Pragma: public"); header("Expires: 0"); header("Cache-Control: must-revalidate, post-check=0, pre-check=0"); header("Content-Type: application/force-download"); header("Content-Type: application/octet-stream"); header("Content-Type: application/download"); //this line is important its makes the file name header("Content-Disposition: attachment;filename=export_".$dbtable.".xls "); header("Content-Transfer-Encoding: binary "); // start the file xlsBOF(); // these will be used for keeping things in order. $col = 0; $row = 0; // This tells us that we are on the first row $first = true; while( $qrow = mysql_fetch_assoc( $qr ) ) { // Ok we are on the first row // lets make some headers of sorts if( $first ) { foreach( $qrow as $k => $v ) { // take the key and make label // make it uppper case and replace _ with ' ' xlsWriteLabel( $row, $col, strtoupper( ereg_replace( "_" , " " , $k ) ) ); $col++; } // prepare for the first real data row $col = 0; $row++; $first = false; } // go through the data foreach( $qrow as $k => $v ) { // write it out xlsWriteLabel( $row, $col, $v ); $col++; } // reset col and goto next row $col = 0; $row++; } xlsEOF(); exit(); ?> I tried using, fwrite to accomplish this, but it didn't seem to go very well, I removed the header information too, but nothing worked. Here is the original code, as I found it, any help would be greatly appreciated. :-) Thanx in advance. :-)

    Read the article

  • Wordpress blog with Joomla?

    - by user427902
    Hi, I had this Wordpress installation which was installed in a subfolder (not root). Like http: //server/blog/. Now, I installed Joomla on the root (http: //server/). Everything seems to be working fine with the Joomla part. However, the blog part is messed up. If I try to browse the homepage of my blog which is http: //server/blog/ it works like a charm. But while trying to view individual blog pages like say, http: //server/blog/some_category/some_post I get a Joomla 404 page. So, I was wondering if it was possible to use both Wordpress and Joomla in the same server in the setup I am trying to. Let me clarify that I am NOT looking to integrate user login and other such things. I just want the blog to be functional under a subfolder while I run the Joomla site in the root. So, what is the correct way to go about it. Can this be solved by any .config edits or something else? Edit: Here's the .htaccess for Joomla ... (I can't find any .htaccess for Wp though, still looking for it.) ## # @version $Id: htaccess.txt 14401 2010-01-26 14:10:00Z louis $ # @package Joomla # @copyright Copyright (C) 2005 - 2010 Open Source Matters. All rights reserved. # @license http://www.gnu.org/copyleft/gpl.html GNU/GPL # Joomla! is Free Software ## ##################################################### # READ THIS COMPLETELY IF YOU CHOOSE TO USE THIS FILE # # The line just below this section: 'Options +FollowSymLinks' may cause problems # with some server configurations. It is required for use of mod_rewrite, but may already # be set by your server administrator in a way that dissallows changing it in # your .htaccess file. If using it causes your server to error out, comment it out (add # to # beginning of line), reload your site in your browser and test your sef url's. If they work, # it has been set by your server administrator and you do not need it set here. # ##################################################### ## Can be commented out if causes errors, see notes above. Options +FollowSymLinks # # mod_rewrite in use RewriteEngine On ########## Begin - Rewrite rules to block out some common exploits ## If you experience problems on your site block out the operations listed below ## This attempts to block the most common type of exploit `attempts` to Joomla! # ## Deny access to extension xml files (uncomment out to activate) #<Files ~ "\.xml$"> #Order allow,deny #Deny from all #Satisfy all #</Files> ## End of deny access to extension xml files RewriteCond %{QUERY_STRING} mosConfig_[a-zA-Z_]{1,21}(=|\%3D) [OR] # Block out any script trying to base64_encode crap to send via URL RewriteCond %{QUERY_STRING} base64_encode.*\(.*\) [OR] # Block out any script that includes a <script> tag in URL RewriteCond %{QUERY_STRING} (\<|%3C).*script.*(\>|%3E) [NC,OR] # Block out any script trying to set a PHP GLOBALS variable via URL RewriteCond %{QUERY_STRING} GLOBALS(=|\[|\%[0-9A-Z]{0,2}) [OR] # Block out any script trying to modify a _REQUEST variable via URL RewriteCond %{QUERY_STRING} _REQUEST(=|\[|\%[0-9A-Z]{0,2}) # Send all blocked request to homepage with 403 Forbidden error! RewriteRule ^(.*)$ index.php [F,L] # ########## End - Rewrite rules to block out some common exploits # Uncomment following line if your webserver's URL # is not directly related to physical file paths. # Update Your Joomla! Directory (just / for root) # RewriteBase / ########## Begin - Joomla! core SEF Section # RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteCond %{REQUEST_URI} !^/index.php RewriteCond %{REQUEST_URI} (/|\.php|\.html|\.htm|\.feed|\.pdf|\.raw|/[^.]*)$ [NC] RewriteRule (.*) index.php RewriteRule .* - [E=HTTP_AUTHORIZATION:%{HTTP:Authorization},L] # ########## End - Joomla! core SEF Section

    Read the article

  • How do I learn algorithms?

    - by Panthe
    Brief History: Just graduated high school, learned a bit of python and C++, have no friends with any helpful computer knowledge at all. Out of anyone i met in my school years I was probably the biggest nerd, but no one really knew. I consider my self to have a vast amount of knowledge on computers and tech then the average person. built/fixed tons of computers, and ability to troubleshoot pretty much any problem I came across. Now that high school is over, Ive really been thinking about my career. Loving, living computers for the past 15 years of my life I decided to take my ability's and try to learn computer programming, why I didn't start earlier I don't know, seems to be big mistake on my part... Doing some research I concluded that Python was the first programming language I should learn, since it was high level and easier to understand then C++ and Java. I also knew that to become good at what I did I needed to know more then just 2 or 3 languages, which didn't seem like a big problem considering once I learned the way Python worked, mainly syntax changed, and the rest would come naturally. I watched a couple of youtube videos, downloaded some book pdf's and snooped around from some tutorials here and there to get the hang of what to do. A two solid weeks had passed of trying to understand the syntax, create small programs that used the basic functions and understanding how it worked, I think i have got the hang of it. It breaks down into what ive been dealing with all this time (although i kinda knew) is that, input,output, loops, functions and other things derived from 0's and 1's storing data and recalling it, ect. (A VERY BASIC IDEA). Ive been able to create small programs, Hangman, file storing, temperature conversion, Caeser Cipher decode/encoding, Fibonacci Sequence and more, which i can create and understand how each work. Being 2 weeks into this, I have learned alot. Nothing at all compared to what i should be lear ning in the years to come if i get a grip on what I'm doing. While doing these programs I wont stop untill I've done doing a practice problem on a book, which embarresing enough will take me a couple hour depending on the complexity of it. I absolutly will not put aside the challenge until its complete, WHICH CAN BE EXTREMELY DRAINING, ive tried most problems without cheating and reached success, which makes me feel extremely proud of my self after completing something after much trial and error. After all this I have met the demon, alogrithm's which seem to be key to effiecent code. I cant seem to rap my head around some of the computer codes people put out there using numbers, and sometimes even basic functions, I have been able to understand them after a while but i know there are alot more complex things to come, considering my self smart, functions that require complex codes, actually hurt my brain. NOTHING EVER IN LIFE HURT MY BRAIN....... not even math classes in highschool, trying to understand some of the stuff people put out there makes me feel like i have a mental disadvantage lol... i still walk forward though, crossing my fingers that the understanding will come with time. Sorry if is this is long i just wish someone takes all these things into consideration when answering my question. even through all these downsides im still pushing through and continuing to try and get good at this, i know reading these tutorials wont make me any good unless i can become creative and make my own, understand other peoples programs, so this leads me to the simple question i could have asked in the beginning..... WHERE IN THE WORLD DO I START ? Ive been trying to find out how to understand some of the open source projects, how i can work with experianced coders to learn from them and help them, but i dont think thats even possible by the way how far people's knowledge is compared to me, i have no freinds who i can learn from, can someone help me and guide me into the right direction.. i have a huge motivation to get good at coding, anything information would be extremely helpful

    Read the article

  • optimizing the jquery in django

    - by sankar
    I have done the following code which actually dynamically generate the values in the third list box using ajax and jquery concepts. Thoug it works, i need to optimize it. Below is the code i am working on now. <html> <head> <title>Comparison based on ID Number</title> <script src="http://code.jquery.com/jquery-latest.js"></script> </head> <body> {% if form.errors %} <p style="color: red;"> Please correct the error{{ form.errors|pluralize }} below. </p> {% endif %} <form action="/idnumber/" method="post" align= "center">{% csrf_token %} <p>Select different id numbers and the name of the <b> Measurement Group </b>to start the comparison</p> <table align = "center"> <tr> <th><label for="id_criteria_1">Id Number 1:</label></th> <th> {{ form.idnumber_1 }} </th> </tr> <tr> <th><label for="id_criteria_2">Id Number 2:</label></th> <th> {{ form.idnumber_2 }} </th> </tr> <tr> <th><label for="group_name_list">Group Name:</label></th> <th><select name="group_name_list" id="id_group_name_list"> <option>Select</option> </select> </th> </tr> <script> $('#id_idnumber_2').change( function get_group_names() { var value1 = $('#id_idnumber_1').attr('value'); var value2 = $(this).attr('value'); alert(value1); alert(value2); var request = $.ajax({ url: "/getGroupnamesforIDnumber/", type: "GET", data: {idnumber_1 : value1,idnumber_2 : value2}, dataType: "json", success: function(data) { alert(data); var myselect = document.getElementById("group_name_list"); document.getElementById("group_name_list").options.length = 1; var length_of_data = data.length; alert(length_of_data); try{ for(var i = 0;i < length_of_data; i++) { myselect.add(new Option(data[i].group_name, "i"), myselect.options[i]) //add new option to beginning of "sample" } } catch(e){ //in IE, try the below version instead of add() for(var i = 0;i < length_of_data; i++) { myselect.add(new Option(data[i].group_name, data[i].group_name)) //add new option to end of "sample" } } } }); }); </script> <tr align = "center"><th><input type="submit" value="Submit"></th></tr> </table> </form> </body> </html> everything works fine but there is a little problem in my code. (ie) my ajax function calls only when there is a change in the select list 2 (ie) 'id_number_2'. I want to make it call in such a way that which ever select box, the third list box should be updated automatically. Can anyone please help me on this with a possible logical solution

    Read the article

  • WPF: Improving Performance for Running on Older PCs

    - by Phil Sandler
    So, I'm building a WPF app and did a test deployment today, and found that it performed pretty poorly. I was surprised, as we are really not doing much in the way of visual effects or animations. I deployed on two machines: the fastest and the slowest that will need to run the application (the slowest PC has an Intel Celeron 1.80GHz with 2GB RAM). The application ran pretty well on the faster machine, but was choppy on the slower machine. And when I say "choppy", I mean the cursor jumped even just passing it over any open window of the app that had focus. I opened the Task Manager Performance window, and could see that the CPU usage jumped whenever the app had focus and the cursor was moving over it. If I gave focus to another (e.g. Excel), the CPU usage went back down after a second. This happened on both machines, but the choppiness was only noticeable on the slower machine. I had very limited time to tinker on the deployment machines, so didn't do a lot of detailed testing. The app runs fine on my development machine, but I also see the CPU spiking up to 10% there, just running the cursor over the window. I downloaded the WPF performance tool from MS and have been tinkering with it (on my dev machine). The docs say this about the "Frame Rate" metric in the Perforator tool: For applications without animation, this value should be near 0. The app is not doing any heavy animation, but the frame rate stays near 50 when the cursor is over any window. The screens I tested on have column headers in a grid that "highlight" and buttons that change color and appearance when scrolled over. Even moving the mouse on blank areas of the windows cause the same Frame rate and CPU usage (doesn't seem to be related to these minor animations). (Also, I am unable to figure out how to get anything but the two default tools--Perforator and Visual Profiler--installed into the WPF performance tool. That is probably a separate question). I also have Redgate's profiling tool, but I'm not sure if that can shed any light on rendering performance. So, I realize this is not an easy thing to troubleshoot without specifics or sample code (which I can't post). My questions are: What are some general things to look for (or avoid) in the code to improve performance? What steps can I take using the WPF performance tool to narrow down the problem? Is the PC spec listed above (Intel Celeron 1.80GHz with 2GB RAM) too slow to be running even vanilla WPF applications?

    Read the article

  • Linker Issues with boost::thread under linux using Eclipse and CMake

    - by OcularProgrammer
    I'm in the process of attempting to port some code across from PC to Ubuntu, and am having some issues due to limited experience developing under linux. We use CMake to generate all our build stuff. Under windows I'm making VS2010 projects, and under Linux I'm making Eclipse projects. I've managed to get my OpenCV stuff ported across successfully, but am having major headaches trying to port my threaded boost apps. Just so we're clear, the steps I have followed so-far on a clean Ubuntu 12 installation. (I've done 2 clean re-installs to try and fix potential library cock-ups, now I'm just giving up and asking): Install Eclipse and Eclipse CDT using my package manager Install CMake and CMake Gui using my package manager Install libboost-all-dev using my package manager So-far that's all I've done. I can create the eclipse project using CMake with no errors, so CMake is successfully finding my boost install. When I try and build through eclipse is when I get issues; The app I'm attempting to build uses boost::asio for some UDP I/O and boost::thread to create worker threads for the asio I/O services. I can successfully compile each module, but when I come to link I get spammed with errors such as: /usr/bin/c++ CMakeFiles/RE05DevelopmentDemo.dir/main.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/RE05FusionListener/RE05FusionListener.cpp.o CMakeFiles/RE05DevelopmentDemo.dir/NewEye/NewEye.cpp.o -o RE05DevelopmentDemo -rdynamic -Wl,-Bstatic -lboost_system-mt -lboost_date_time-mt -lboost_regex-mt -lboost_thread-mt -Wl,-Bdynamic /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `void boost::call_once<void (*)()>(boost::once_flag&, void (*)()) [clone .constprop.98]': make[2]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' (.text+0xc8): undefined reference to `pthread_key_create' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::interruption_enabled()': (.text+0x540): undefined reference to `pthread_getspecific' make[1]: Leaving directory `/home/david/Code/Build/Support/RE05DevDemo' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x570): undefined reference to `pthread_getspecific' /usr/lib/gcc/x86_64-linux-gnu/4.6/../../../../lib/libboost_thread-mt.a(thread.o): In function `boost::this_thread::disable_interruption::disable_interruption()': (.text+0x59f): undefined reference to `pthread_getspecific' Some Gotchas that I have collected from other StackOverflow posts and have already checked: The boost libs are all present at /usr/lib I am not getting any compile errors for inability to find the boost headers, so they must be getting found. I am trying to link statically, but I believe eclipse should be passing the correct arguments to make that happen since my CMakeLists.txt includes SET(Boost_USE_STATIC_LIBS ON) I'm officially out of ideas here, I have tried doing local builds of boost and a bunch of other stuff with no more success. I even re-installed Ubuntu to ensure I haven't completely fracked the libs directories and links with multiple weird versions or anything else. Any help would be muchly appreciated.

    Read the article

  • Java: Making concurrent MySQL queries from multiple clients synchronised

    - by Misha Gale
    I work at a gaming cybercafe, and we've got a system here (smartlaunch) which keeps track of game licenses. I've written a program which interfaces with this system (actually, with it's backend MySQL database). The program is meant to be run on a client PC and (1) query the database to select an unused license from the pool available, then (2) mark this license as in use by the client PC. The problem is, I've got a concurrency bug. The program is meant to be launched simultaneously on multiple machines, and when this happens, some machines often try and acquire the same license. I think that this is because steps (1) and (2) are not synchronised, i.e. one program determines that license #5 is available and selects it, but before it can mark #5 as in use another copy of the program on another PC tries to grab that same license. I've tried to solve this problem by using transactions and table locking, but it doesn't seem to make any difference - Am I doing this right? Here follows the code in question: public LicenseKey Acquire() throws SmartLaunchException, SQLException { Connection conn = SmartLaunchDB.getConnection(); int PCID = SmartLaunchDB.getCurrentPCID(); conn.createStatement().execute("LOCK TABLE `licensekeys` WRITE"); String sql = "SELECT * FROM `licensekeys` WHERE `InUseByPC` = 0 AND LicenseSetupID = ? ORDER BY `ID` DESC LIMIT 1"; PreparedStatement statement = conn.prepareStatement(sql); statement.setInt(1, this.id); ResultSet results = statement.executeQuery(); if (results.next()) { int licenseID = results.getInt("ID"); sql = "UPDATE `licensekeys` SET `InUseByPC` = ? WHERE `ID` = ?"; statement = conn.prepareStatement(sql); statement.setInt(1, PCID); statement.setInt(2, licenseID); statement.executeUpdate(); statement.close(); conn.commit(); conn.createStatement().execute("UNLOCK TABLES"); return new LicenseKey(results.getInt("ID"), this, results.getString("LicenseKey"), results.getInt("LicenseKeyType")); } else { throw new SmartLaunchException("All licenses of type " + this.name + "are in use"); } }

    Read the article

< Previous Page | 319 320 321 322 323 324 325 326 327 328 329 330  | Next Page >